ARCHIVES
OF BIOCHEMISTRY
AND
BIOPHYSICS
Vol. 280, No. 1, July, pp. 175-180, 1990
Escherichia co/i E-39 ADPglucose Synthetase Has Different Activation Kinetics from the Wild-Type Allosteric Enzyme* Alicia Gardiol and Jack Preiss’ Department
of Biochemistry,
201 Biochemistry
Building,
Michigan
State University,
East Lansing, Michigan
48824
Received December 5,1989, and in revised form March 2,199O
Kinetic and binding studies have shown that Lys39 of Escherichia coli ADPglucose synthetase is involved in binding of the allosteric activator. In order to study structure-function relationships at the activator binding site, this lysine residue was substituted by glutamic acid (Lys39 + Glu) by site-directed mutagenesis. The resultant mutant enzyme (E-39) showed activation kinetics different from those of the wild-type enzyme. The level of activation of the E-39 enzyme by the major activators of E. coli ADPglucose synthetase, 2-phosphoglycerate, pyridoxal phosphate, and fructose- 1,6phosphatase was only approximately a-fold compared to activation of 15- to 28-fold respectively, for the wildtype enzyme. NADPH, an activator of the wild-type enzyme, was unable to activate the mutant enzyme. In addition, the concentrations of the above activators necessary to obtain 50% of the maximal stimulation of enzyme activity (AOJ were 5-, Q-, and 23-fold higher, respectively, than those for the wild-type enzyme. The E-39 enzyme also had a lower apparent affinity (S,.,) for the substrates ATP and MgCl, than the wild-type enzyme and the values obtained in the presence or absence of activator were similar. The concentration of inhibitor giving 50% of enzyme activity (l& was also similar for the E-39 enzyme in the presence or absence of activator. These results indicate that the E-39 mutant enzyme is not effectively activated by the major activators of the E. coli ADPglucose synthetase wild-type enzyme, and that this amino acid substitution also prevents the allosteric effect that the activator has on the wild-type enzyme kinetics, either increasing its apparent affinity for the substrates or modulating the eno 1990 Academic press, he. zyme’s sensitivity to inhibition.
* Research supported in part by United States Public Health vice Research Grant AI 22835. 1 TO whom correspondence should be addressed. 0003.9861/90
Copyright All
rights
$3.00 8 1990 by Academic Press, of reproduction in any form
Inc. reserved.
The biosynthesis of (r-1,4 glucosidic bonds of glycogen in bacteria occurs via synthesis of ADPglucose from ATP and glucose l-P2 catalyzed by ADPglucose synthetase (ATP:a-glucose-l-P adenylyltransferase, EC 2.7.7.27) (1, 2). The subsequent transfer of the glucosyl unit from ADPglucose to a preexisting (u-1,4 glucan or maltodextrin primer to form a new glucosyl linkage is catalyzed by an ADPglucose-specific glycogen synthase (ADPglucose:1,4-cY-D-glucan 4-glucosyltransferase, EC 2.4.1.21). The (-u-1,6 glucosyl linkages, which are about 10% of the total linkages found in glycogen, are formed in a reaction catalyzed by a branching enzyme (1,4-glucan:cul,4-glucan-6-glycosyltransferase, EC 2.4.1.18). ADPglucose synthetase from Escherichia coli B is regulated via allosteric activation mainly by glycolytic intermediates like fructose-1,6-P2 (1, 2) and via allosteric inhibition by AMP, ADP, and Pi, Many studies have shown that the structural requirements for the allosteric activator site can be satisfied by compounds having two phosphate residues such as fructose-1,6-P,, sedoheptulose, 1,7-P2, 1,6-hexanediol-Pz, and glycerol-1,3-P2. NADPH may also be viewed as an analog of fructose l,6-P2 because a portion of its structure can be considered as ribose-2,5-P,. Other activators have one phosphate plus an aldehyde or a carboxyl group such as pyridoxal-P, erythrose 4-P, 4-pyridoxic acid-5P, 2-P-glycerate, and phosphoenolpyruvate. Evidence for all of these diverse metabolites binding to the same site has been obtained via kinetic (3) and binding studies (4) and has been reviewed (1,2). Binding studies with pyridoxal-P have identified Lys39 as being involved in binding of the activator (5). In addition, there are seven positively charged amino acid residues, Arg29, 32, 40, 52, and Lys34, 42, and 51, surrounding Lys39 (2,5). Chemical modification studies
Ser’ Abbreviations phosphatase.
used: DTE,
dithioerythritol;
P, phosphate;
P,,
175
176
GARDIOL
suggest the presence of an essential arginine at the allosteric site (6). In order to study structure-function relationships at the activator binding site we performed site-directed mutagenesis to substitute lysine39 with glutamic acid and determined the kinetic characteristics of the resulting mutant enzyme. EXPERIMENTAL
PROCEDURES
Reagents. Ultrapure urea was obtained from Schwartz/Mann, Biotech (Cleveland, OH). [a-?S]dATP was obtained from Amersham (Arlington Heights, IL). AC&amide, N,N’-methylene bisacrylamide, chloramphenicol, isopropyl fl-D-galactopyranoside, 5’-bromo-4-chloro-3 indolyl fl-D-galactopyranoside, and deoxyribonucleoside 5’-triphosphates were obtained from Sigma Chemical Co. (St. Louis, MO). An Ml3 sequencing system was purchased from Bethesda Research Laboratories (Gaithersburg, MD). All other chemicals were of analytical grade quality. Bacterial strains and media. The bacterial strains used were E. coli K12 G6MD3 (Hfr, his, thi, Str”, A (mal A-aad) (7), E. coli JMlOl (rk+, mk+) sup E, thi A (/UC-pro A,B)/F, truD36,proA,B, km IqZM15 (8) from Bethesda Research Laboratories (Gaithersburg, MD), and E. coli CJ236 dut, ung, thi, rel A/pCJ105(Cm’) (9) from Bio-Rad Laboratories, CA). M9 medium (10) contained 0.6% Na2HP04, 0.3% KHPPOl, 0.05% NaCl, 0.1% NH,Cl, 0.2% glucose, 0.1 mM CaCl,, 1 mM MgSO,. 7H20, and 1 pg/ml thiamine:HCl. YT medium (10) contained 0.8% tryptone, 0.5% yeast extract, and 0.5% NaCl. 2YT medium (10) contained 1.6% tryptone, 1% yeast extract, 0.5% NaCl. Enriched medium containing 1.1% KzHPOl, 0.85% KH2P04, 0.6% yeast extract, and 0.3% glucose. Plates contained 2% agar, and top agar was used at 0.8%. E. coli K-12 G6MD3 was grown in a medium containing 50 rg/ ml diaminopimelic acid, and E. coli CJ236 in medium containing 30 pg/ml chloramphenicol. Enzymes. T4 DNA ligase was obtained from New England Biolabs. T, DNA polymerase was from Boehringer-Mannheim Biochemicals. Yeast inorganic pyrophosphatase, alkaline phosphatase, and T, polynucleotide kinase were from Sigma Chemical Co. Oligonucleotide site-directed mutagenesis. Site-directed mutagenesis was performed by a modification of the method of Zoller and Smith (10) as developed by Kunkel (11). A 1.9-kilobase pair Hi&I restriction fragment (12) containing the wild type gig C gene previously cloned (13) into the M13mp18 phage vector (N-terminal codon of the gene toward the promoter of the vector) was used to prepare the template DNA. Single-stranded uracil-containing DNA was isolated after growing the phage in the host E. coli CJ236 dut ung (9). An 18-base mutagenic oligonucleotide, 5’ TGCTCGCTCATTGGTTAA with a T/ C mismatch (14), was designed to change Lys39 to Glu. In addition, two other primers, 5’ AGCACCATTACCATTAGCAAGGCC 3’ and 5 CGTAAGAATACGTGGCACAGACA 3’ with complementary sequences to M13mp18 at position 2553-2576 and 5027-5049, were included to facilitate the extension reaction and protection of the 5’ end of the mutagenic oligonucleotide (13, 15). The uridylated template (1 pg) was annealed with the three 5’P oligonucleotides (88 ng) (ratio 1: 33) by placing the reaction mixture at 92°C for 4 min and allowing it to cool to 25°C in the water bath for 90 min. Extension (T, DNA polymerase, 1 U) and ligation (T4 DNA ligase, 2.5 U) were performed by incubation of the mutagenesis mixture initially on ice for 5 min, at 25°C for 5 min, followed at 37°C for 90 min and at 16°C for 16 h. An aliquot (1:lO) of the incubation mixture containing the covalently closed heteroduplex DNA was transfected into the E. coli ung+ strain JMlOl for in uiuo selection of the mutant strand. Controls of the uridylated template gave no plaques on the ung+ host and controls of the mutagenesis mixture without ligase gave 15% of the total number of plaques. Plaques were purified and screened by sequencing with the Ml3 sequencing system by the dideoxy method (16) with an l&base oligonucleotide primer, 5’ GATAATGCGGAACTTACC 3’, comple-
AND
PREISS
mentary to the glg C gene 47 nucleotides upstream from the mutation. Three mutants of six plaques screened (50% frequency) were obtained with this method. Expression and purification of enzyme activity. The wild-type and mutantglg C genes cloned in M13mp18 as well as the M13mp18 phage vector were transfected into the E. coli strain G6MD3, a deletion mutant with no gig genes. Cultures of the host in enriched medium containing 0.3% glucose were infected in the exponential phase (OD = 0.7) with phage grown as described by Zoller and Smith (10) at a multiplicity of infection of approximately 0.5. Cells were grown for 18 h and then harvested. Crude extracts (25% homogenates) were prepared by suspension of the cell pastes (4-5 g) in 0.05 M glycyl-glycine buffer, pH 7.0, containing 5 mM DTE and 1 mM EDTA, followed by sonication, and centrifugation at 12,000g for 10 min in a refrigerated Sorvall RC-5B centrifuge. The crude extracts were assayed for enzyme activity under the standard conditions of the assay in the pyrophosphorolysis direction as previously described (3). The reaction mixture contained, in a total volume of 0.25 ml, 10 rmol of Tris-HCI buffer, pH 8.5, 100 pg of bovine plasma albumin, 2.0 Gmol of MgCIB, 0.2 pmol of ADPglucose, 0.5 pmol of 32PP,, 0.3 pmol of fructose 1,6-bisphosphate, 2.5 pmol of NaF, enzyme, and was incubated at 37°C for 10 min. Protein concentrations were determined using the BCA protein assay reagent from Pierce Chemical Co. (Rockford, IL). The sequence of the wild-type and mutant phage DNA isolated from the supernatant of these cultures was checked and corresponded to the expected E. coli wild-type and mutant glg C genes, respectively. Partial purification of the E-39 ADPglucose synthetase mutant enzyme was performed as previously described (3,17). All procedures, except where noted, were performed at 0-4°C. The crude extract (16.4 ml) was brought to a final concentration of 30 mM Pi by the addition of a 1 M potassium phosphate buffer, pH 7.0, then heat-treated at 58°C for 5 min, cooled at 4”C, and centrifuged at 30,OOOgfor 10 min. The supernatant was absorbed onto a DEAE-Sepharose CL-6B column (1.5 X 10 cm), equilibrated with 0.5 M potassium phosphate buffer, pH 7.0, containing 5 mM DTE, 1 mM EDTA, and 10% glycerol. The column was washed with 36 ml of 0.1 M potassium phosphate buffer, pH 7.5, containing 5 mM DTE, and 10% glycerol. A linear gradient containing 80 ml of the above 0.1 M phosphate buffer in the mixing chamber and 80 ml of the above 0.2 M potassium phosphate buffer, pH 7.0, containing 0.5 M KCl, 5 mM DTE, 1 mM EDTA, and 10% glycerol in the reservoir chamber was used to elute the enzyme from the column. The fraction volume was 4 ml, and the enzyme activity was eluted from the column after 32 ml. The fractions containing high specific activity were pooled and precipitated with solid (NH&SO, at 70% saturation. The resultant precipitate which contained the activity was centrifuged, dissolved in 50 mM Tris-HCI buffer, pH 7.5, containing 1 mM EDTA, 0.5 mM DTE, and 10% glycerol, and dialyzed against the same buffer. The purified E-39 mutant enzyme did not contain any detectable glucose l-P, ATP, ADPglucose, or fructose-1,6-P, degrading activity to interfere in the kinetic studies. All kinetic studies were performed in the Kinetic characterization. synthesis direction as described (3,5,18). The optimal concentrations of substrates of the E-39 enzyme were determined and used in the enzyme assay. In the direction of ADPglucose synthesis, the reaction mixture contained, in a total volume of 0.2 ml, 0.9 pmol of ATP, 0.1 pmol of glucose l-[i4C]phosphate (sp act 1093 cpm/nmol), 2.6 pmol of MgCl,, 20 pmol of Hepes buffer (4.2-hydroxyethyl-l-piperazineethanesulfonic acid), pH 7.0, 100 pg of bovine plasma albumin, 0.7 unit of yeast inorganic pyrophosphatase, 0.8 pmol of the activator, fructose- 1,6-P*, and 0.19 pg of enzyme. The same substrate concentrations were used for the assay of the E-39 enzyme in the absence of activator. For the assay of the purified wild-type enzyme (18), the reaction mixture containing, in presence of activator, 0.3 pmol of ATP, 0.1 kmol of glucose l-[‘4C]phosphate, 1.0 pmol of MgCl,, 0.3 pmol of activator, fructose-1,6-P,, and 0.02 rg of enzyme. The reaction mixture in absence of the activator contained 1.5 Fmol of ATP, 0.2 pmol of glucose l-[‘4C]phosphate, and 5.0 Fmol of MgCl*. Kinetic data were plotted as reaction rate (a) versus substrate or effector concentration. Kinetic
Escherichia TABLE
coli E-39 ADPGLUCOSE
177
SYNTHETASE
I
Expression of ADPglucose Synthetase in E. coli G6MD3” Activity (~mol/min/mg)
Strains E. cob G6MD3 G6MD3/M13mp18 GGMD3/M13mpl8-wild-typeglg G6MD3/M13mp@-E-39glg
C C
OF BIOCHEMISTRY
AND
BIOPHYSICS
Vol. 280, No. 1, July, pp. 175-180, 1990
Escherichia co/i E-39 ADPglucose Synthetase Has Different Activation Kinetics from the Wild-Type Allosteric Enzyme* Alicia Gardiol and Jack Preiss’ Department
of Biochemistry,
201 Biochemistry
Building,
Michigan
State University,
East Lansing, Michigan
48824
Received December 5,1989, and in revised form March 2,199O
Kinetic and binding studies have shown that Lys39 of Escherichia coli ADPglucose synthetase is involved in binding of the allosteric activator. In order to study structure-function relationships at the activator binding site, this lysine residue was substituted by glutamic acid (Lys39 + Glu) by site-directed mutagenesis. The resultant mutant enzyme (E-39) showed activation kinetics different from those of the wild-type enzyme. The level of activation of the E-39 enzyme by the major activators of E. coli ADPglucose synthetase, 2-phosphoglycerate, pyridoxal phosphate, and fructose- 1,6phosphatase was only approximately a-fold compared to activation of 15- to 28-fold respectively, for the wildtype enzyme. NADPH, an activator of the wild-type enzyme, was unable to activate the mutant enzyme. In addition, the concentrations of the above activators necessary to obtain 50% of the maximal stimulation of enzyme activity (AOJ were 5-, Q-, and 23-fold higher, respectively, than those for the wild-type enzyme. The E-39 enzyme also had a lower apparent affinity (S,.,) for the substrates ATP and MgCl, than the wild-type enzyme and the values obtained in the presence or absence of activator were similar. The concentration of inhibitor giving 50% of enzyme activity (l& was also similar for the E-39 enzyme in the presence or absence of activator. These results indicate that the E-39 mutant enzyme is not effectively activated by the major activators of the E. coli ADPglucose synthetase wild-type enzyme, and that this amino acid substitution also prevents the allosteric effect that the activator has on the wild-type enzyme kinetics, either increasing its apparent affinity for the substrates or modulating the eno 1990 Academic press, he. zyme’s sensitivity to inhibition.
* Research supported in part by United States Public Health vice Research Grant AI 22835. 1 TO whom correspondence should be addressed. 0003.9861/90
Copyright All
rights
$3.00 8 1990 by Academic Press, of reproduction in any form
Inc. reserved.
The biosynthesis of (r-1,4 glucosidic bonds of glycogen in bacteria occurs via synthesis of ADPglucose from ATP and glucose l-P2 catalyzed by ADPglucose synthetase (ATP:a-glucose-l-P adenylyltransferase, EC 2.7.7.27) (1, 2). The subsequent transfer of the glucosyl unit from ADPglucose to a preexisting (u-1,4 glucan or maltodextrin primer to form a new glucosyl linkage is catalyzed by an ADPglucose-specific glycogen synthase (ADPglucose:1,4-cY-D-glucan 4-glucosyltransferase, EC 2.4.1.21). The (-u-1,6 glucosyl linkages, which are about 10% of the total linkages found in glycogen, are formed in a reaction catalyzed by a branching enzyme (1,4-glucan:cul,4-glucan-6-glycosyltransferase, EC 2.4.1.18). ADPglucose synthetase from Escherichia coli B is regulated via allosteric activation mainly by glycolytic intermediates like fructose-1,6-P2 (1, 2) and via allosteric inhibition by AMP, ADP, and Pi, Many studies have shown that the structural requirements for the allosteric activator site can be satisfied by compounds having two phosphate residues such as fructose-1,6-P,, sedoheptulose, 1,7-P2, 1,6-hexanediol-Pz, and glycerol-1,3-P2. NADPH may also be viewed as an analog of fructose l,6-P2 because a portion of its structure can be considered as ribose-2,5-P,. Other activators have one phosphate plus an aldehyde or a carboxyl group such as pyridoxal-P, erythrose 4-P, 4-pyridoxic acid-5P, 2-P-glycerate, and phosphoenolpyruvate. Evidence for all of these diverse metabolites binding to the same site has been obtained via kinetic (3) and binding studies (4) and has been reviewed (1,2). Binding studies with pyridoxal-P have identified Lys39 as being involved in binding of the activator (5). In addition, there are seven positively charged amino acid residues, Arg29, 32, 40, 52, and Lys34, 42, and 51, surrounding Lys39 (2,5). Chemical modification studies
Ser’ Abbreviations phosphatase.
used: DTE,
dithioerythritol;
P, phosphate;
P,,
175
176
GARDIOL
suggest the presence of an essential arginine at the allosteric site (6). In order to study structure-function relationships at the activator binding site we performed site-directed mutagenesis to substitute lysine39 with glutamic acid and determined the kinetic characteristics of the resulting mutant enzyme. EXPERIMENTAL
PROCEDURES
Reagents. Ultrapure urea was obtained from Schwartz/Mann, Biotech (Cleveland, OH). [a-?S]dATP was obtained from Amersham (Arlington Heights, IL). AC&amide, N,N’-methylene bisacrylamide, chloramphenicol, isopropyl fl-D-galactopyranoside, 5’-bromo-4-chloro-3 indolyl fl-D-galactopyranoside, and deoxyribonucleoside 5’-triphosphates were obtained from Sigma Chemical Co. (St. Louis, MO). An Ml3 sequencing system was purchased from Bethesda Research Laboratories (Gaithersburg, MD). All other chemicals were of analytical grade quality. Bacterial strains and media. The bacterial strains used were E. coli K12 G6MD3 (Hfr, his, thi, Str”, A (mal A-aad) (7), E. coli JMlOl (rk+, mk+) sup E, thi A (/UC-pro A,B)/F, truD36,proA,B, km IqZM15 (8) from Bethesda Research Laboratories (Gaithersburg, MD), and E. coli CJ236 dut, ung, thi, rel A/pCJ105(Cm’) (9) from Bio-Rad Laboratories, CA). M9 medium (10) contained 0.6% Na2HP04, 0.3% KHPPOl, 0.05% NaCl, 0.1% NH,Cl, 0.2% glucose, 0.1 mM CaCl,, 1 mM MgSO,. 7H20, and 1 pg/ml thiamine:HCl. YT medium (10) contained 0.8% tryptone, 0.5% yeast extract, and 0.5% NaCl. 2YT medium (10) contained 1.6% tryptone, 1% yeast extract, 0.5% NaCl. Enriched medium containing 1.1% KzHPOl, 0.85% KH2P04, 0.6% yeast extract, and 0.3% glucose. Plates contained 2% agar, and top agar was used at 0.8%. E. coli K-12 G6MD3 was grown in a medium containing 50 rg/ ml diaminopimelic acid, and E. coli CJ236 in medium containing 30 pg/ml chloramphenicol. Enzymes. T4 DNA ligase was obtained from New England Biolabs. T, DNA polymerase was from Boehringer-Mannheim Biochemicals. Yeast inorganic pyrophosphatase, alkaline phosphatase, and T, polynucleotide kinase were from Sigma Chemical Co. Oligonucleotide site-directed mutagenesis. Site-directed mutagenesis was performed by a modification of the method of Zoller and Smith (10) as developed by Kunkel (11). A 1.9-kilobase pair Hi&I restriction fragment (12) containing the wild type gig C gene previously cloned (13) into the M13mp18 phage vector (N-terminal codon of the gene toward the promoter of the vector) was used to prepare the template DNA. Single-stranded uracil-containing DNA was isolated after growing the phage in the host E. coli CJ236 dut ung (9). An 18-base mutagenic oligonucleotide, 5’ TGCTCGCTCATTGGTTAA with a T/ C mismatch (14), was designed to change Lys39 to Glu. In addition, two other primers, 5’ AGCACCATTACCATTAGCAAGGCC 3’ and 5 CGTAAGAATACGTGGCACAGACA 3’ with complementary sequences to M13mp18 at position 2553-2576 and 5027-5049, were included to facilitate the extension reaction and protection of the 5’ end of the mutagenic oligonucleotide (13, 15). The uridylated template (1 pg) was annealed with the three 5’P oligonucleotides (88 ng) (ratio 1: 33) by placing the reaction mixture at 92°C for 4 min and allowing it to cool to 25°C in the water bath for 90 min. Extension (T, DNA polymerase, 1 U) and ligation (T4 DNA ligase, 2.5 U) were performed by incubation of the mutagenesis mixture initially on ice for 5 min, at 25°C for 5 min, followed at 37°C for 90 min and at 16°C for 16 h. An aliquot (1:lO) of the incubation mixture containing the covalently closed heteroduplex DNA was transfected into the E. coli ung+ strain JMlOl for in uiuo selection of the mutant strand. Controls of the uridylated template gave no plaques on the ung+ host and controls of the mutagenesis mixture without ligase gave 15% of the total number of plaques. Plaques were purified and screened by sequencing with the Ml3 sequencing system by the dideoxy method (16) with an l&base oligonucleotide primer, 5’ GATAATGCGGAACTTACC 3’, comple-
AND
PREISS
mentary to the glg C gene 47 nucleotides upstream from the mutation. Three mutants of six plaques screened (50% frequency) were obtained with this method. Expression and purification of enzyme activity. The wild-type and mutantglg C genes cloned in M13mp18 as well as the M13mp18 phage vector were transfected into the E. coli strain G6MD3, a deletion mutant with no gig genes. Cultures of the host in enriched medium containing 0.3% glucose were infected in the exponential phase (OD = 0.7) with phage grown as described by Zoller and Smith (10) at a multiplicity of infection of approximately 0.5. Cells were grown for 18 h and then harvested. Crude extracts (25% homogenates) were prepared by suspension of the cell pastes (4-5 g) in 0.05 M glycyl-glycine buffer, pH 7.0, containing 5 mM DTE and 1 mM EDTA, followed by sonication, and centrifugation at 12,000g for 10 min in a refrigerated Sorvall RC-5B centrifuge. The crude extracts were assayed for enzyme activity under the standard conditions of the assay in the pyrophosphorolysis direction as previously described (3). The reaction mixture contained, in a total volume of 0.25 ml, 10 rmol of Tris-HCI buffer, pH 8.5, 100 pg of bovine plasma albumin, 2.0 Gmol of MgCIB, 0.2 pmol of ADPglucose, 0.5 pmol of 32PP,, 0.3 pmol of fructose 1,6-bisphosphate, 2.5 pmol of NaF, enzyme, and was incubated at 37°C for 10 min. Protein concentrations were determined using the BCA protein assay reagent from Pierce Chemical Co. (Rockford, IL). The sequence of the wild-type and mutant phage DNA isolated from the supernatant of these cultures was checked and corresponded to the expected E. coli wild-type and mutant glg C genes, respectively. Partial purification of the E-39 ADPglucose synthetase mutant enzyme was performed as previously described (3,17). All procedures, except where noted, were performed at 0-4°C. The crude extract (16.4 ml) was brought to a final concentration of 30 mM Pi by the addition of a 1 M potassium phosphate buffer, pH 7.0, then heat-treated at 58°C for 5 min, cooled at 4”C, and centrifuged at 30,OOOgfor 10 min. The supernatant was absorbed onto a DEAE-Sepharose CL-6B column (1.5 X 10 cm), equilibrated with 0.5 M potassium phosphate buffer, pH 7.0, containing 5 mM DTE, 1 mM EDTA, and 10% glycerol. The column was washed with 36 ml of 0.1 M potassium phosphate buffer, pH 7.5, containing 5 mM DTE, and 10% glycerol. A linear gradient containing 80 ml of the above 0.1 M phosphate buffer in the mixing chamber and 80 ml of the above 0.2 M potassium phosphate buffer, pH 7.0, containing 0.5 M KCl, 5 mM DTE, 1 mM EDTA, and 10% glycerol in the reservoir chamber was used to elute the enzyme from the column. The fraction volume was 4 ml, and the enzyme activity was eluted from the column after 32 ml. The fractions containing high specific activity were pooled and precipitated with solid (NH&SO, at 70% saturation. The resultant precipitate which contained the activity was centrifuged, dissolved in 50 mM Tris-HCI buffer, pH 7.5, containing 1 mM EDTA, 0.5 mM DTE, and 10% glycerol, and dialyzed against the same buffer. The purified E-39 mutant enzyme did not contain any detectable glucose l-P, ATP, ADPglucose, or fructose-1,6-P, degrading activity to interfere in the kinetic studies. All kinetic studies were performed in the Kinetic characterization. synthesis direction as described (3,5,18). The optimal concentrations of substrates of the E-39 enzyme were determined and used in the enzyme assay. In the direction of ADPglucose synthesis, the reaction mixture contained, in a total volume of 0.2 ml, 0.9 pmol of ATP, 0.1 pmol of glucose l-[i4C]phosphate (sp act 1093 cpm/nmol), 2.6 pmol of MgCl,, 20 pmol of Hepes buffer (4.2-hydroxyethyl-l-piperazineethanesulfonic acid), pH 7.0, 100 pg of bovine plasma albumin, 0.7 unit of yeast inorganic pyrophosphatase, 0.8 pmol of the activator, fructose- 1,6-P*, and 0.19 pg of enzyme. The same substrate concentrations were used for the assay of the E-39 enzyme in the absence of activator. For the assay of the purified wild-type enzyme (18), the reaction mixture containing, in presence of activator, 0.3 pmol of ATP, 0.1 kmol of glucose l-[‘4C]phosphate, 1.0 pmol of MgCl,, 0.3 pmol of activator, fructose-1,6-P,, and 0.02 rg of enzyme. The reaction mixture in absence of the activator contained 1.5 Fmol of ATP, 0.2 pmol of glucose l-[‘4C]phosphate, and 5.0 Fmol of MgCl*. Kinetic data were plotted as reaction rate (a) versus substrate or effector concentration. Kinetic
Escherichia TABLE
coli E-39 ADPGLUCOSE
177
SYNTHETASE
I
Expression of ADPglucose Synthetase in E. coli G6MD3” Activity (~mol/min/mg)
Strains E. cob G6MD3 G6MD3/M13mp18 GGMD3/M13mpl8-wild-typeglg G6MD3/M13mp@-E-39glg
C C
