Fish & Shellfish Immunology 38 (2014) 255e264

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Establishment and characterization of a rainbow trout heart endothelial cell line with susceptibility to viral hemorrhagic septicemia virus (VHSV) Alfonso Luque, Aitor González Granja, Lucia González, Carolina Tafalla* Centro de Investigación en Sanidad Animal (CISA-INIA), Valdeolmos, Madrid, Spain

a r t i c l e i n f o

a b s t r a c t

Article history: Received 18 December 2013 Received in revised form 19 February 2014 Accepted 7 March 2014 Available online 1 April 2014

In the current work, we have established and characterized a novel cell line from rainbow trout (Oncorhynchus mykiss). The cell line, designated as RTH (rainbow trout heart), was obtained by immortalizing heart cells with recombinant retroviruses that transduced polyoma middle T antigen. This is the first time such a strategy is used to obtain an immortalized fish cell line. The cells showed an endothelial-like morphology and characteristics, constitutively transcribing collagen, selectin and VCAM (vascular cell adhesion molecule), as well as different chemokines and chemokine receptors, but not cytokeratin. As already described for heart endothelial cells, RTH cells actively phagocytized latex beads. Furthermore, RTH cells showed a high susceptibility to viral hemorrhagic septicemia virus (VHSV). VHSV modulated the transcription of Mx, major histocompatibility complex II (MHC-II), VCAM and many of the chemokine and chemokine receptors expressed in these cells. Therefore, RTH cells constitute an excellent model to study the immune regulation of endothelial cells in fish and their role in leukocyte extravasation. Ó 2014 Elsevier Ltd. All rights reserved.

Keywords: Heart Endothelium Rainbow trout Cell lines Viral hemorrhagic septicemia virus (VHSV)

1. Introduction In vitro models are highly valuable tools to directly study specific cellular mechanisms without individual variability. Because primary cultures are usually short-lived, easily contaminated and require specific culture conditions, the establishment of immortalized cell lines is a valuable research instrument to understand the physiology of a specific tissue. To date, different cell lines have been established in rainbow trout (Onchorhynchus mykiss). The RTG-2 cell line derived from rainbow trout gonad was established in 1962 as a fibroblast cell line widely used with a broad range of viral susceptibility [1]. The RTS11, established in 1998 from rainbow trout spleen cultures, is a

Abbreviations: HSMI, heart and skeletal muscle inflammation; IPNV, infectious pancreatic necrosis virus; ISAV, infectious salmon anemia virus; IFN-g, interferon g; MHC-II, major histocompatibility complex II; PRV, piscine orthoreovirus; RTH, rainbow trout heart; SPDV, salmon pancreas disease virus; TNF-a, tumor necrosis factor a; VCAM, vascular cell adhesion molecule; VHSV, viral hemorrhagic septicemia virus. * Corresponding author. Centro de Investigación en Sanidad Animal (CISA-INIA), Carretera de Algete a El Casar km. 8.1, Valdeolmos, 28130 Madrid, Spain. Tel.: þ34 91 6202300; fax: þ34 91 6202247. E-mail address: [email protected] (C. Tafalla). http://dx.doi.org/10.1016/j.fsi.2014.03.027 1050-4648/Ó 2014 Elsevier Ltd. All rights reserved.

monocyte-macrophage cell line [2]. This cell line has been very useful to study different aspects of monocyte-macrophage functionality and their response to different pathogens [3e5]. RTS34 is another cell line obtained from a long-term spleen hemopoietic culture. This cell line consisted in a mixed stromal cell layer with an associated cell population of macrophage-like cells that form proliferative foci and release non-adherent progeny cells into the culture medium [6]. RTgill-W1, an epithelial cell line established from rainbow trout gill, has also been proposed as an important tool to study aquatic toxicology [7]. Up to date, however, no endothelial cell lines have been established to our knowledge neither in rainbow trout nor in other fish species. In the current study, we have established an immortalized heart endothelial cell line from rainbow trout using supernatants from packaging cells producing recombinant retroviruses that transduced polyoma middle T antigen. Middle T antigen is a membrane bound polypeptide that interacts with a number of proteins used by tyrosine kinase associated receptors to stimulate mitogenesis [8]. This method has been very well accepted for the generation of cell lines in mammals, usually generating immortalized endothelial cultures [9e12]. In our case, the cell line obtained, designated as RTH (rainbow trout heart) also showed an endothelial-morphology and accordingly expressed collagen and the cell adhesion molecules selectin and VCAM (vascular cell adhesion molecule), but not

256

A. Luque et al. / Fish & Shellfish Immunology 38 (2014) 255e264

cytokeratin. As reported for endothelial cells [13], and specifically for fish heart endothelial cells [14,15], RTH cells actively phagocytized latex beads. Because chemokines play an important role in the regulation of endothelial cell function, including proliferation, migration and differentiation during angiogenesis, and reendothelialization after injury [16], we also studied their capacity to express rainbow trout chemokines and chemokine receptors. In addition, the heart is an important target for viral infections in fish and constitutes one of the main replication sites for viruses such as viral hemorrhagic septicemia virus (VHSV) [17], infectious hematopoietic necrosis virus (IHNV) [18], the piscine orthoreovirus (PRV) associated with heart and skeletal muscle inflammation (HSMI) [19] or salmon pancreas disease virus (SPDV) [20]. On the other hand, infectious salmon anemia virus (ISAV) specifically targets heart endothelial cells in salmon [21]. Therefore, the susceptibility of RTH cells to common viral pathogens from rainbow trout such VHSV or infectious pancreatic necrosis virus (IPNV) was also addressed in the current study. This newly established RTH cell line constitutes a novel tool to study the immune regulation of heart endothelium in fish and can be further used as a model in angiogenesis, homeostasis and leukocyte transmigration in fish as well as in VHSV pathogenesis studies.

with 10%FCS and antibiotics (P/S). Cells were grown at 20  C and passaged at a 1:2 ratio every week using a 0.25% trypsin solution. The epithelioma papillosum cyprini (EPC) cell line from fathead minnow (Pimephales promelas) was also used in this study. EPC cells were also cultured at 20  C in L-15 supplemented with 10%FCS and antibiotics. Cells were grown at 20  C and passaged at a 1:3 ratio every week. 2.3. RNA extraction and cDNA preparation Total RNA was extracted from cells using a combination of Trizol (Invitrogen) and RNAeasy Mini kit (Qiagen). In summary, Table 1 Primers used for real time PCR in this study. Gene

Name

Sequence (50 -30 )

Collagen

Collagen-F Collagen-R Selectin-F Selectin-R VCAM-F VCAM-R Cytokeratin-F Cytokeratin-R MHCII-F MHCII-R Mx-F Mx-R N VHSV-F N-VHSV-R CK1-F CK1-R CK3-F CK3-R CK5B-F CK5B-R CK6-F CK6-R CK7A-F CK7A-R CK9-F CK9-R CK10-F CK10-R CK11-F CK11-R CK12-F CK12-R CXCL8-F CXCL8-R CXCd-F CXCd-R CXCL11-R CXCL11-F CCR6-F CCR6-R CCR7-F CCR7-R CCR9-F CCR9-R CCR9B-F CCR9B-R CCR13-F CCR13-R CXCR1-F CXCR1-R CXCR3A-F CXCR3A-R CXCR3B-F CXCR3B-R CXCR4-F CXCR4-R EF-1a-F EF-1a-R

TCTCAACCCTTTTCTATGCATTTTTT TTTAAGCAAGTGGACCATTTTTGAA CTCATGTTACCATGGAGAGTGTGTG CTCCTCCATCTTACATTCAACAACG TCACTGTATGCTGTCGCTCTGTTAG ACCTGGTATAGGCCTGTATCTTTGG GGGTGGTTTGACCTCCTTAGCT CAAAGTGCATCCAGTAATTCCTATCA ACACCCTTATCTGCCACGTC TCTGGGGTGAAGCTCAGACT AGCTCAAACGCCTGATGAAG CTGGGTCCACAGTGTACATTTAGTT GAGAGAACTGGCCCTGACTG CCCGAGTTTCTTGGTGATGT GATGGCTGAAAGGCTACACC TGGGATTTGTTCTCCTGACG AGATCACCGTTCCCATCATC GTGACTTTCTGGCCATCTCC TTTGCTGATCGTCAGATACCC GTGTCTGCTCCCCAGACTTC TGAAAGGCCTACGAATCTGC GTTGTTGTTGGCTGGTTGTG CCGAGAATCCCTCTTCAACA TCATCGTCGTCTTGGCAGTA GGCTCTTATGGGAACTGCTG CTGGGATTGGCACAAACAG ATTGCCAAGATCCTCTTCTGTGTTC CCTGAGGCTGGTAACCTATGACAAC CCTTTGAGCATACTAATGCGAGTGG GTCTGCACAATACTTCCTCCCATTG GACATCGATGCCACTGTGTT GGAGATGGTTCGCTCCAGAC ATTGAGACGGAAAGCAGACG CTTGCTCAGAGTGGCAATGA GCTCACACTGCTCTAAGGAAGAA GGAGAGAGTCTCAATGGAACGT TGGACTGGTGAACCGTGTTA TCTTGGCAAATGGAGCTTCT TGCAGAGGAAACAGTTAACAATTCACC CCAGTAAACCCAGGATACAGATGAC TTCACTGATTACCCCACAGACAATA AAGCAGATGAGGGAGTAAAAGGTG TCAATCCCTTCCTGTATGTGTTTGT GTCCGTGTCTGACATAACTGAGGAG AATATTTCCAACGTCTGAAACAGGA CTCACCCAGGACTTATCACACATTC GTTCTGTACAACGTCTGGAAGGATT ATGGCCAAAGGAAGTAGAAAGAAGA CCTGATATCCAGAAGCTCTTTGTGT TTGCATCCAGCTCTATGATAATGAA CAAGGCAACCACAAATTACTATATTTATGATG CAGCACACACAGCACCAGGAT CACTGGAGCCATGTTTACAATCAACT CCCTCACAGACTCCAGGAAGTG GTGCATGTGATCTACACCATC GAGCTGTGGCAAACACTATGT GATCCAGAAGGAGGTCACCA TTACGTTCGACCTTCCATCC

Selectin VCAM Cytokeratin

2. Materials and methods

MHC-II

2.1. Generation of RTH cell line

Mx

Hearts were aseptically removed from rainbow trout (O. mykiss) of 10e12 cm under a dissecting microscope. Tissues from 2 to 3 animals were placed in tubes containing 7 ml of L-15 medium (Gibco, USA) and 0.15 mg/ml collagenase (Sigma). Single cell suspensions were accomplished by mechanical tissue dissociation followed by enzymatic digestion. Organs from 2 to 3 animals were placed on a sterile 100 mm tissue culture plate and minced using sharp scissors followed by scalpel blades into pieces as small as possible to increase the final cell yield. With a sterile spatula, the minced tissues were transferred to tubes containing 7 ml of L-15 medium (Gibco, USA) and 0.15 mg/ml collagenase (Sigma) and incubated for 30 min at 20  C with agitation. The reaction was stopped by adding 7 ml of L-15 supplemented with 10% fetal bovine serum (FBS, Gibco). The non-digested tissue was discarded by retention on a 70 mm filter. Dissociated cells were washed by centrifugation and incubated on 0.1% gelatin-coated plates at 20  C with L-15 supplemented with 20% FBS, 2% heparin (Sigma), 0.005% Brain and Heart Infusion broth (Merck), 100 I.U./ml penicillin and 100 mg/ml streptomycin (P/S). Non-adhered cells were removed after 2 h in culture. The next day, culture medium was replaced by medium without heparin. The RTH line was established using a modified version from previous reports [11,12]. Subconfluent primary cultures (48 h postseeding) were incubated in the presence of polybrene (8 mg/ml, Sigma) with supernatant from packaging cells producing recombinant retroviruses that transduced polyoma middle T antigen (virus concentration about 10e200 pfu/cell). The virus-containing medium was replaced the next day with fresh complete medium. Cells were subjected to a second round of infection after 2 days of incubation at 20  C. Cells were passaged when confluent in L-15 supplemented with 20% FBS, 0.005% Brain and Heart Infusion broth and P/S. Non-infected cells died within a few passages.

N VHSV

2.2. Cell cultures

CK1 CK3 CK5B CK6 CK7A CK9 CK10 CK11 CK12 CXCL8_L1 CXCd CXCL11_L1 CCR6 CCR7 CCR9 CR9B CCR13 CXCR1 CXCR3A CXCR3B CXCR4

Following immortalization, after 10 passages in L-15 supplemented with 20% FBS, 0.005% Brain and Heart Infusion broth and P/ S, RTH proliferating cells were maintained in L-15 supplemented

EF-1a

A. Luque et al. / Fish & Shellfish Immunology 38 (2014) 255e264

samples were mechanically disrupted in 1 ml of Trizol using a disruption pestle. Then, 200 ml of chloroform were added and the suspension centrifuged at 12,000  g for 15 min. The clear upper phase was recovered, mixed with an equal volume of 100% ethanol and immediately transferred to RNAeasy Micro kit columns. The procedure was then continued following manufacturer’s instructions, performing on-column DNase treatment. cDNA was obtained from 1 mg of RNA using Bioscript reverse transcriptase (Bioline Reagents Ltd) and oligo (dT)12e18 (0.5 mg/ml) following manufacturer’s instructions. The resulting cDNA was diluted in a 1:5 proportion with water and stored at 20  C. 2.4. Evaluation of immune gene expression by real time PCR To evaluate the levels of transcription of the different genes, real-time PCR was performed in a LightCyclerÒ 96 instrument (Roche) using SYBR Green PCR core Reagents (Applied Biosystems) and specific primers (shown in Table 1). The efficiency of the amplification was determined for each primer pair using serial 10 fold dilutions of pooled cDNA, and only primer pairs with efficiencies between 1.95 and 2 were used. Each sample was measured in duplicate under the following conditions: 10 min at 95  C, followed by 45 amplification cycles (15 s at 95  C and 1 min at 60  C). The expression of individual genes was normalized to relative expression of trout EF-1a and the expression levels were calculated using the 2DCt method, where DCt is determined by subtracting the EF-1a value from the target Ct. Negative controls with no template were included in all the experiments. A melting curve for each PCR was determined by reading fluorescence every degree between 60  C and 95  C to ensure only a single product had been amplified.

257

2.5. Phagocytosis assay RTH cells were seeded for the phagocytosis assays in 24-well plates (Nunc) at a cell density of 1  106 cells per well. After 48 h of incubation at 20  C, cells were incubated for 3 or 16 h in 5% CO2 at 20  C with fluorescent beads (FluoSpheresÒ Carboxylate-Modified Microspheres, 1.0 mm, Crimson Fluorescent 625/645, 2% solids; Life Technologies) at a cell/bead ratio of 1:10, in the absence or presence of 0.04 mg/ml cytochalasin B (SigmaeAldrich). Cells were resuspended using a standard cell scrapper (Corning) and harvested. Non-ingested beads were removed by centrifugation (100  g for 10 min at 4  C) over a cushion of 3% (weight/volume) BSA (Fraction V; Fisher Scientific) in PBS supplemented with 4.5% (weight/volume) D-glucose (Sigma). For imaging analysis, cells were incubated for 48 h in 5% CO2 at 20  C, and images were analyzed in an Olympus CKX41 microscope. For FACS analysis, cells were resuspended in FACS buffer and analyzed on a FACSCalibur with CellQuest sofware (BD Biosciences). In some wells, after 3 h of incubation with the beads, RTH cells were collected in Trizol for RNA extraction. Controls with no beads were also collected. 2.6. Viral infection of RTH cells VHSV (strain 0771) was propagated in the EPC cell line in L-15 with antibiotics and 2%FCS at 14  C. When cytopathic effect was extensive, the supernatant was harvested and centrifuged to eliminate cell debris. Clarified supernatants were used for the experiments. The virus stock was titrated in 96-well plates according to Reed and Müench [22]. For the infection of RTH cells with VHSV, cells were passaged and seeded in 24-well plates with L-15 medium supplemented with 10% FCS. After overnight incubation at 20  C, the medium was removed

Fig. 1. Establishment of a novel rainbow trout cell line from heart. A. Light microscopy image of rainbow trout RTH cells after 2 passages. Optical magnification, 200. Bars, 50 mm. B. Light microscopy image of rainbow trout RTH cells after 20 passages. Optical magnification, 200. Bars, 50 mm. C. Levels of transcription of genes characteristic of specific cell populations in RTH cells, compared to the levels observed in other rainbow trout cell lines, RTG-2 and RTS11 cells. Data are shown as the mean gene expression relative to the expression of endogenous control EF-1a  SD (N ¼ 3 replicates).

258

A. Luque et al. / Fish & Shellfish Immunology 38 (2014) 255e264

and 200 mL of L-15 medium with 2%FCS containing VHSV (1 105 TCID50/ml) added to each well. After 1 h of incubation at 14  C, additional 800 mL of L-15 with 2%FCS were added to each well, and the cells were incubated at 14  C for the different incubation periods. In some experiments, the IPNV Sp strain was also used to infect RTH cells, following the same protocol as that already described for VHSV.

differences were determined using a ManneWhitney U test or a one-way ANOVA (p < 0.05).

2.7. Analysis of VHSV replication by Western blot

We successfully established an immortalized rainbow trout cell line from dissociated hearts using supernatants from cells infected with a recombinant retrovirus expressing the polyoma middle T antigen. This is the first time this strategy has been used to immortalize fish cells. From dissociated organs that presented a mixture of cells of different morphology, polyoma middle T antigen was able to immortalize specifically endothelial cells as previously described [9e12]. In the first passages in 20%FCS and when fully confluent, the cell line exhibited a cobblestone morphology, typical of endothelial cells ([24]; Fig. 1(A)). When longer passages were made in 10%FCS, RTH cells became more elongated, resembling morphologies also reported for endothelial cultures in mammals (Fig. 1(B)) [25]. No apparent morphological or phenotypical changes were observed with further passaging (currently 40 passages). The RTH cell line was cryopreserved at different passages in liquid nitrogen (196  C). After 3e5 months, cells were thawed and the viability of the cell culture verified. Cells remained mostly viable and grew as prior to cryopreservation after seeding at 20  C. No apparent morphological differences were observed following cryopreservation.

RTH cells infected with either VHSV or mock-infected were collected at different times post-infection (days 1, 3 and 5) for the detection of VHSV N protein through Western blot. Western blotting was performed according to the previously described protocol [23] using a mouse monoclonal antibody for VHSV N protein (1:600 dilution) kindly donated by Dr. Niels Lorenzen (Aarhus University, Denmark). Goat anti-Mouse IgG (H þ L)-HRP conjugate (Bio-Rad) was used as the secondary antibody (1:5000 dilution). Both primary and secondary antibodies were incubated either at room temperature for 1 h or overnight at 4  C. Chemiluminescence was detected using Amersham ECL Plus Western Blotting Detection Reagents (GE Healthcare) in combination with a MF-ChemiBIS imager (DNR BioImaging Systems). 2.8. Statistics Data handling, analyses and graphic representation was performed using Microsoft Office Excel 2010. Statistically significant

3. Results 3.1. Immortalization of RTH cells

A 0.04 0.035

Relave expression

0.03 0.025 0.02 0.015 0.01 0.005 0

B 0.002 0.0018

Relave expression

0.0016 0.0014 0.0012 0.001 0.0008 0.0006 0.0004 0.0002 0 CCR6

CCR7

CCR9

CCR9B

CCR13

CXCR1 CXCR3A CXCR3B CXCR4

Fig. 2. Constitutive levels of transcription for different chemokine (A) and chemokine receptor (B) genes in RTH cells. Data are shown as the mean gene expression relative to the expression of endogenous control EF-1a  SD (N ¼ 3 replicates).

A. Luque et al. / Fish & Shellfish Immunology 38 (2014) 255e264

3.2. Phenotype of immortalized rainbow trout heart endothelial cells RTH cells constitutively transcribed collagen, selectin and VCAM, but not cytokeratin (Fig. 1(C)). RTG-2 cells on the other hand transcribed all four genes studied, whereas the monocytemacrophage cell line established from rainbow trout spleen, RTS11, only transcribed cytokeratin. No changes were detected in

259

the expression of these markers from early passages, to passage 40, the highest investigated so far. Chemokines and chemokine receptors should play an important role in regulating the traffic of leukocytes from the blood to the organs, across the endothelium. Thus, to further characterize this cell line, we have also studied the levels of constitutive transcription of a wide range of chemokine and chemokine receptor genes. RTH cells constitutive transcribe CK9, CK10, CK11, CK12, CXCL11_L1

Fig. 3. Analysis of the phagocytic capacities of RTH cells. A. Light microscopy images of rainbow trout RTH cells after being incubated with control medium (no beads, left panel) or medium containing fluorescent beads (Crimson Red, 1 mm diameter) for 3 h (middle panel) or 16 h (right panel). Images are representative from three independent experiments. Optical magnification, 200. Bars, 50 mm. B. Flow cytometry analysis of heart cells incubated with control medium (no beads, left column) or medium containing fluorescent beads for 3 h (middle column) or 16 h (right column). Cells were incubated in the absence (top row) or presence (bottom row) of cytochalasin B (cyt. B). After elimination of non-ingested beads, cells were FACS analyzed, and data were plotted as beads fluorescence intensity histograms. Percentage of phagocytic cells (cells with high fluorescence intensity) are included in each histogram. Data are representative from three independent experiments. C. Effect of bead internalization on the transcription of different genes in RTH cells. After 3 h of incubation with the beads, cells were collected in Trizol for RNA extraction and the mRNA levels of different genes studied through real time PCR. Data are shown as the mean gene expression relative to the expression of endogenous control EF-1a  SD (N ¼ 3 replicates).

260

A. Luque et al. / Fish & Shellfish Immunology 38 (2014) 255e264

and CXCL_F1 chemokines (Fig. 2(A)). Concerning chemokine receptors, the RTH cell line constitutively transcribed CCR7, CXCR1, CXCR3B and CXCR4 (Fig. 2(B)). 3.3. Phagocytic capacity of RTH cells Since endothelial cells are known to be phagocytic, we studied the phagocytic capacity of RTH cells using fluorescent beads. RTH actively started to phagocytize beads after 3 h of incubation and increased the number of ingested beads after 16 h (Fig. 3(A) and (B)). This ingestion of beads was in fact phagocytosis because it was inhibited in the presence of cytochalasin B (Fig. 3(B)). When RTH cells were incubated with the beads, the transcription of some genes was affected. Mx, selectin, CCR7 and CXCR4 mRNA levels significantly decreased in the presence of the beads, whereas major histocompatibility complex II (MHC-II), CXCL11_L1 and CXCR3B mRNA levels significantly increased (Fig. 3(C)). 3.4. Susceptibility of RTH cells to VHSV Since VHSV is known to actively replicate in the heart, we studied whether the virus could actively infect RTH cells. We found that as early as 3 days post-infection, a clear cytophatic effect was visible in infected cultures (Fig. 4(A)). Accordingly, transcription of the viral N protein was detected from day 1 to day 3 post-infection

(Fig. 4(B)). The N protein was also detected through Western blot. Although it was not detected at day 1 post-infection, the N protein was visible at day 3 and at day 5 post-infection, when it strongly increased (Fig. 4(C)). When supernatants from infected cultures were collected and titrated in EPC cells, we could verify that RTH cells were supporting an active VHSV replication (data not shown). On the other hand, when RTH cultures were infected in parallel with either IPNV, no viral transcription was ever detected, nor could we visualize a clear cytophatic effect. 3.5. Modulation of immune genes in RTH cells by VHSV After having demonstrated that VHSV actively replicates in RTH cells, we studied the effect that the virus provoked in the levels of transcription of the different immune genes know to be expressed in these cells. As expected, VHSV up-regulated Mx mRNA levels (Fig. 5), as well as MHC-II and VCAM mRNA levels. On the contrary, the virus did not provoke a significant modulation of selectin transcription. VHSV was also capable of up-regulating CK9, CK10, CK11, CK12, CXCL11_L1 and CXCL_F1 chemokines in RTH cells (Fig. 6). The upregulation was detected at different time point post-infection, depending on the gene studied, but in all cases the up-regulation induced was statistically significant. Finally, we also studied whether VHSV could modulate the transcription of chemokine receptors. In this case, VHSV up-

Fig. 4. VHSV replication in RTH cells. A. Light microscopy images of RTH cells infected with VHSV after 1, 2 or 3 days post-infection. Control mock-infected cells (Control) were maintained in the same conditions. Optical magnification, 200. Bars, 50 mm. B. Transcription of VHSV N gene in VHSV-infected RTH cultures. The mRNA levels of VHSV N gene were measured through real time PCR at different times post-infection. Data are shown as the mean gene expression relative to the expression of endogenous control EF-1a  SD (N ¼ 3 replicates). C. Western blot detection of the VHSV N protein in infected RTH cultures after 1 (D1), 3 (D3) or 5 (D5) days post-infection. Cþ corresponded to a lysate of EPC cells infected with VHSV (7 days post-infection). Cþ corresponded to a lysate of non-infected RTH cells.

A. Luque et al. / Fish & Shellfish Immunology 38 (2014) 255e264

endothelial cells are known to be highly phagocytic, phagocyting bacteria [29] or even aged neutrophils [30] and RTH cells also showed a strong phagocytic activity, sensitive to cytochalasin treatment. Further studies including internalization of acetylated low-density lipoprotein uptake, expression of von Willebrand factor or the formation of capillary-like tubes have been pointed out as important characteristics to analyze in standardized endothelial cell cultures in mammals [31], however some of these assays are difficult to establish in fish. Although endothelial cell lines from the bulbous arteriosus have been mentioned in passing or in an abstract [32,33], this is the first report of an endothelial cell line in teleosts. The endothelium is a highly responsive tissue, with crucial functions in various physiological functions, in addition to their clearance capacity of pathogens or senescent cells. Chemokines retained on the endothelial cell surface have been shown to account for the recruitment and extravasation of leukocyte subtypes involved in the inflammation [34]. RTH cells constitutively transcribed several chemokines such as CK9, CK10, CK11, CK12, CXCL11_L1 and CXCL_F1. For many of these chemokines, it is very difficult to establish whether they have true mammalian orthologues; however, this is easier for chemokine receptors that seem better conserved [35]. Concerning chemokine receptors, RTH expressed CCR7, CXCR1, CXCR3B and CXCR4. Chemokine receptors expressed in the surface of endothelial cells allow these cells to respond at two different levels. First, the proliferation, migration, and differentiation of vascular endothelial cells during angiogenesis, is modulated by chemokines such as IL-8 that act through their specific receptors [36]. Second, it has been suggested that leukocyte adhesion and transmigration require that the chemotactic factors

regulated the mRNA levels of CCR7, CXCR3B and CXCR4, but downregulated the levels of CXCR1 mRNA (Fig. 7). 4. Discussion In the current work, we have developed a new immortalized endothelial cell line in rainbow trout using recombinant retroviruses that transduced polyoma middle T antigen, a strategy commonly used to establish mammalian cell lines [9,11,12]. This is the first time such an approach is used in teleost, thus it opens the possibility to further use it to establish novel cell lines in different teleost species. So far, cell lines in fish have been established by spontaneous immortalization from continuous subcultivation of a mixture of cells, whereas several alternative strategies are currently used in mammals to establish cell lines from primary cultures. Many of these technologies are based on cell immortalization with oncogenes produced by viruses such as Simian virus 40 (SV40), human papilloma virus (HPV) or polyoma middle T antigen [26e 28]. These novel techniques have significantly expanded the ability of researchers to generate useful cell lines of specific cell types. Although in mammals it seems that endothelial cells are preferentially immortalized using polyoma middle T antigen [9,10], we have applied this technique further in fish and non-endothelial cells have also been generated (data not shown). RTH cells showed an endothelial-like morphology and constitutively transcribed collagen, selectin and VCAM, but not cytokeratin, in addition to several chemokines and chemokine receptors. These results, together with the cobblestone morphology that these cells show when cultivated in high percentages of FBS, strongly suggest that RTH cells are endothelial. Furthermore, in mammals,

*

Mx

Relave expression

0.5

0.0008

*

0.4 0.3 0.2

*

0.1

Control

VHSV

0.0006 0.0005 0.0004 0.0003 0.0002

0.0001

0

0

0.007 0.006

VCAM

Day 2

Day 3

Day 1 0.012

*

0.005 0.004

*

0.003 0.002

Relave expression

Day 1

Relave expression

*

MHC-II

0.0007

Relave expression

0.6

261

Day 2

Day 3 Control

Selecn

VHSV

0.01 0.008 0.006 0.004 0.002

0.001 0

0 Day 1

Day 2

Day 3

Day 1

Day 2

Day 3

Fig. 5. Effect of VHSV infection on the transcription of Mx, MHC-II, selectin and VCAM in RTH cells. RTH cells were seeded in 24 well plates and infected with VHSV (1  105 TCID50/ ml) as described in the Materials and Methods Section. The cells were incubated at 14  C and after different incubation periods, the cells were harvested for RNA extraction using Trizol. Mock-infected controls were included in all time points. The levels of transcription of the different genes were measured through real time PCR. Data are shown as the mean gene expression relative to the expression of endogenous control EF-1a  SD (N ¼ 3 replicates). * Levels of transcription in infected cultures significantly higher relative to levels observed in corresponding controls (p < 0.05).

262

A. Luque et al. / Fish & Shellfish Immunology 38 (2014) 255e264

are immobilized on the endothelial surface that allows the establishment of a chemokine gradient in blood flow conditions [37]. All the chemokine receptors expressing by RTH cells with the exception of CCR7 (not analyzed) were expressed by a human brain endothelial cell line [25]. However, endothelial cells from different sources are known to be heterogeneous in their expression of adhesion proteins, secretory products, and responsiveness to cytokines. For example, human umbilical vein endothelial cells do not express detectable mRNA for the IL-8 receptors CXCR1 and CXCR2, whereas microvascular dermal endothelial cells express high levels of CXCR1 and intermediate levels of CXCR2. However, both cell types express equal levels of CXCR4 [38]. In general, endothelial cells from microvascular structures in specific tissues differ significantly from large vessel endothelial cells [39]. It would be interesting to determine if rainbow trout endothelial cells from other tissue exhibit different patterns of chemokine and chemokine receptor transcription. Interestingly, a previous study by Roca et al. [40] revealed that teleost endothelial cells were highly responsive

*

1.8

CK9

0.12

1.4 1.2 1 0.8 0.6 0.4

0 Day 2

0.04

Day 1 0.03

*

CK11

CK12

0.4 0.3 0.2

Day 2

0.1

Day 3 Control

*

0.025

RelaƟve expression

0.5

RelaƟve expression

*

0.06

Day 3

0.6

VHSV

*

0.02 0.015 0.01 0.005

0

0 Day 1

Day 2

Day 3

Day 1 0.005

CXCL11_L1

1.4

RelaƟve expression

RelaƟve expression

0.08

VHSV

0 Day 1

1.2

0.1

Control

0.02

0.2

1.6

*

CK10 RelaƟve expression

RelaƟve expression

1.6

to tumor necrosis factor a (TNF-a) and responded up-regulating the transcription of chemokines and MHC-II. The heart is one of the main target organs for VHSV replication and VHSV isolation is associated with myocardial mineralization [17]. Therefore, we studied whether this and another rainbow trout virus, IPNV, were capable of replicating in RTH cells. Surprisingly, the cells did not transcribe IPNV genes after viral infection, nor was a cytophatic effect visible. VHSV, on the other hand, provoked a generalized cytophatic effect in a short period (3 days). In this study, the virus susceptibility of RTH cells has only been preliminarily tested using a single strain and concentration per virus; therefore further studies are necessary to assess the real susceptibility of the newly developed cell line to fish viruses. However, the high permissiveness of RTH cells to VHSV, allowed us to study the effects that a viral infection provoked in these cells. VHSV upregulated the transcription of MHC-II and VCAM in RTH cells, in parallel to an up-regulation of Mx mRNA levels. Brain endothelial cells also up-regulated VCAM and MHC-II in response to a

*

1 0.8 0.6 0.4

*

Day 2

Day 3 Control

CXCL_F1

VHSV

0.004 0.003

*

0.002

0.001

0.2 0

0 Day 1

Day 2

Day 3

Day 1

Day 2

Day 3

Fig. 6. Effect of VHSV infection on the expression of chemokine transcripts in RTH cells. RTH cells were seeded in 24 well plates and infected with VHSV (1  105 TCID50/ml) as described in the Materials and Methods Section. The cells were incubated at 14  C and after different incubation periods, the cells were harvested for RNA extraction using Trizol. Mock-infected controls were included in all time points. The levels of transcription of the different genes were measured through real time PCR. Data are shown as the mean gene expression relative to the expression of endogenous control EF-1a  SD (N ¼ 3 replicates). * Levels of transcription in infected cultures significantly higher relative to levels observed in corresponding controls (p < 0.05).

A. Luque et al. / Fish & Shellfish Immunology 38 (2014) 255e264

RelaƟve expression

0,005

0,006

Control

CXCR1

CCR7

*

0,004

VHSV

0,005 0,004

0,003 0,003 0,002

0,002

0,001

0,001

0

0 Day 1

Day 2

0,0025

RelaƟve expression

263

*

CXCR3B

Day 1

Day 3

0,002

Day 2

Day 3

0,0004

CXCR4

Control VHSV

0,0003

0,0015 0,001

*

*

0,0002

* 0,0001

0,0005 0

0 Day 1

Day 2

Day 3

Day 1

Day 2

Day 3

Fig. 7. Effect of VHSV infection on the expression of chemokine receptor transcripts in RTH cells. RTH cells were seeded in 24 well plates and infected with VHSV (1  105 TCID50/ml) as described in the Materials and Methods Section. The cells were incubated at 14  C and after different incubation periods, the cells were harvested for RNA extraction using Trizol. Mock-infected controls were included in all time points. The levels of transcription of the different genes were measured through real time PCR. Data are shown as the mean gene expression relative to the expression of endogenous control EF-1a  SD (N ¼ 3 replicates). * Levels of transcription in infected cultures significantly higher relative to levels observed in corresponding controls (p < 0.05).

combination of interferon g (IFN-g) and TNF-a [25]. The virus also increased the levels of transcription of CK9, CK10, CK11, CK12, CXCL1_L11, CXCL-F1, CCR7, CXCR3A and CXCR4. In mammals, viruses can have different effects on endothelial cells. For example, Dengue virus induces the production of several chemokines by endothelial cells of different origins, provoking the vascular leakage, characteristic of the disease [41]. On the other hand, influenza virus down-modulates chemokine production by lung endothelial cells to inhibit the recruitment of immune cells to the lung [42]. Additional studies on the functionality of some of these molecules should be performed to understand the biological significance of this specific transcriptional regulation in response to the virus, since surprisingly the transcriptional response of RTH cells to latex beads upon phagocytosis is very different. In summary, we have generated an endothelial cell line from rainbow trout heart that will be helpful to dissect the role of endothelium in physiological and pathological conditions in teleost fish. Its susceptibility to VHSV and the capacity of the virus to modulate different immune genes in these cells also provide an interesting model to study viral effects on endothelial cells. Acknowledgments This work was supported by the European Research Council (ERC Starting Grant 2011 280469) and by project AGL2011-29676 from the Spanish Ministry of Economy and Competitiveness (MINECO). References [1] Wolf K, Quimby MC. Established eurythermic line of fish cells in vitro. Science 1962;135:1065e6.

[2] Ganassin RC, Bols NC. Development of a monocyte/macrophage-like cell line, RTS11, from rainbow trout spleen. Fish Shellfish Immunol 1998;8:457e76. [3] Reinhart B, DeWitte-Orr SJ, Van Es SJ, Bols NC, Lee LE. Cell adhesion characteristics of a monocytic cell line derived from rainbow trout, Oncorhynchus mykiss. Comp Biochem Physiol A Mol Integr Physiol 2006;144:437e43. [4] Tafalla C, Sanchez E, Lorenzen N, DeWitte-Orr SJ, Bols NC. Effects of viral hemorrhagic septicemia virus (VHSV) on the rainbow trout (Oncorhynchus mykiss) monocyte cell line RTS-11. Mol Immunol 2008;45:1439e48. [5] Pham PH, Lai YS, Lee FF, Bols NC, Chiou PP. Differential viral propagation and induction of apoptosis by grouper iridovirus (GIV) in cell lines from three nonhost species. Virus Res 2012;167:16e25. [6] Ganassin RC, Bols NC. A stromal cell line from rainbow trout spleen, RTS34ST, that supports the growth of rainbow trout macrophages and produces conditioned medium with mitogenic effects on leukocytes. In Vitro Cell Dev Biol Anim 1999;35:80e6. [7] Lee LE, Dayeh VR, Schirmer K, Bols NC. Applications and potential uses of fish gill cell lines: examples with RTgill-W1. In Vitro Cell Dev Biol Anim 2009;45:127e34. [8] Ichaso N, Dilworth SM. Cell transformation by the middle T-antigen of polyoma virus. Oncogene 2001;20:7908e16. [9] Williams RL, Risau W, Zerwes HG, Drexler H, Aguzzi A, Wagner EF. Endothelioma cells expressing the polyoma middle T oncogene induce hemangiomas by host cell recruitment. Cell 1989;57:1053e63. [10] Garlanda C, Parravicini C, Sironi M, De Rossi M, Wainstok de Calmanovici R, Carozzi F, et al. Progressive growth in immunodeficient mice and host cell recruitment by mouse endothelial cells transformed by polyoma middle-sized T antigen: implications for the pathogenesis of opportunistic vascular tumors. Proc Natl Acad Sci U S A 1994;91:7291e5. [11] Balconi G, Spagnuolo R, Dejana E. Development of endothelial cell lines from embryonic stem cells: a tool for studying genetically manipulated endothelial cells in vitro. Arterioscler Thromb Vasc Biol 2000;20:1443e51. [12] Hortelano S, Lopez-Fontal R, Traves PG, Villa N, Grashoff C, Bosca L, et al. ILK mediates LPS-induced vascular adhesion receptor expression and subsequent leucocyte trans-endothelial migration. Cardiovasc Res 2010;86:283e92. [13] Cotran RS. Endothelial phagocytosis: an electron-microspopic study. Exp Mol Pathol 1965;28:217e31. [14] Nakamura H, Shimozawa A. Phagocytotic cells in the fish heart. Arch Histol Cytol 1994;57:415e25. [15] Seternes T, Sorensen K, Smedsrod B. Scavenger endothelial cells of vertebrates: a nonperipheral leukocyte system for high-capacity elimination of waste macromolecules. Proc Natl Acad Sci U S A 2002;99:7594e7.

264

A. Luque et al. / Fish & Shellfish Immunology 38 (2014) 255e264

[16] Gupta SK, Lysko PG, Pillarisetti K, Ohlstein E, Stadel JM. Chemokine receptors in human endothelial cells. Functional expression of CXCR4 and its transcriptional regulation by inflammatory cytokines. J Biol Chem 1998;273: 4282e7. [17] Marty GD, Freiberg EF, Meyers TR, Wilcock J, Farver TB, Hinton DE. Viral hemorrhagic septicemia virus, Ichthyophonus hoferi, and other causes of morbidity in Pacific herring Clupea pallasi spawning in Prince William Sound, Alaska, USA. Dis Aquat Org 1998;32:15e40. [18] Miller TA, Rapp J, Wastlhuber U, Hoffmann RW, Enzmann PJ. Rapid and sensitive reverse transcriptase polymerase chain reaction based detection and differential diagnosis of fish pathogenic rhabdoviruses in organ samples and cultured cells. Dis Aquat Org 1998;34:13e20. [19] Markussen T, Dahle MK, Tengs T, Lovoll M, Finstad OW, Wiik-Nielsen CR, et al. Sequence analysis of the genome of piscine orthoreovirus (PRV) associated with heart and skeletal muscle inflammation (HSMI) in Atlantic salmon (Salmo salar). PLoS One 2013;8:e70075. [20] Petterson E, Stormoen M, Evensen O, Mikalsen AB, Haugland O. Natural infection of Atlantic salmon (Salmo salar L.) with salmonid alphavirus 3 generates numerous viral deletion mutants. J Gen Virol 2013;94:1945e54. [21] Aamelfot M, Dale OB, Weli SC, Koppang EO, Falk K. Expression of the infectious salmon anemia virus receptor on atlantic salmon endothelial cells correlates with the cell tropism of the virus. J Virol 2012;86:10571e8. [22] Reed LJ, Muench A. A simple method of stimating fifty per cent end points. Am J Epidemiol 1938;27:493e7. [23] Pham PH, Lumsden JS, Tafalla C, Dixon B, Bols NC. Differential effects of viral hemorrhagic septicaemia virus (VHSV) genotypes IVa and IVb on gill epithelial and spleen macrophage cell lines from rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol 2013;34:632e40. [24] Ades EW, Candal FJ, Swerlick RA, George VG, Summers S, Bosse DC, et al. HMEC-1: establishment of an immortalized human microvascular endothelial cell line. J Invest Dermatol 1992;99:683e90. [25] Weksler BB, Subileau EA, Perriere N, Charneau P, Holloway K, Leveque M, et al. Blood-brain barrier-specific properties of a human adult brain endothelial cell line. FASEB J 2005;19:1872e4. [26] Gudjonsson T, Villadsen R, Nielsen HL, Ronnov-Jessen L, Bissell MJ, Petersen OW. Isolation, immortalization, and characterization of a human breast epithelial cell line with stem cell properties. Genes Dev 2002;16:693e 706. [27] MacKenzie TC, Kobinger GP, Kootstra NA, Radu A, Sena-Esteves M, Bouchard S, et al. Efficient transduction of liver and muscle after in utero injection of lentiviral vectors with different pseudotypes. Mol Ther 2002;6:349e58. [28] Wen VW, MacKenzie KL. Modeling human endothelial cell transformation in vascular neoplasias. Dis Model Mech 2013;6:1066e79.

[29] Hamill RJ, Vann JM, Proctor RA. Phagocytosis of Staphylococcus aureus by cultured bovine aortic endothelial cells: model for postadherence events in endovascular infections. Infect Immun 1986;54:833e6. [30] Gao C, Xie R, Li W, Zhou J, Liu S, Cao F, et al. Endothelial cell phagocytosis of senescent neutrophils decreases procoagulant activity. Thromb Haemost 2013;109:1079e90. [31] Olyslaegers DA, Desmarets LM, Dedeurwaerder A, Dewerchin HL, Nauwynck HJ. Generation and characterization of feline arterial and venous endothelial cell lines for the study of the vascular endothelium. BMC Vet Res 2013;9:170. [32] Lewis DH, Marks JE. Microcultures of Sarotherodon mossambicus (Peters) cells: their use in detecting fish viruses. J Fish Dis 2006;8:477e8. [33] Vo NTK, Chen C, Lumsden JS, Dixon B, Lee LEJ, Bols NC. Establishing and characterizing an endothelial cell line from the bulbus arteriosus of juvenile walleye, Sander vitreus, for physiology, toxicology and virology research. In Vitro Cell Dev Biol Anim 2012;48:32e3. [34] Luster AD. Chemokinesechemotactic cytokines that mediate inflammation. N Engl J Med 1998;338:436e45. [35] Alejo A, Tafalla C. Chemokines in teleost fish species. Dev Comp Immunol 2011;35:1215e22. [36] Koch AE, Polverini PJ, Kunkel SL, Harlow LA, DiPietro LA, Elner VM, et al. Interleukin-8 as a macrophage-derived mediator of angiogenesis. Science 1992;258:1798e801. [37] Luster AD, Greenberg SM, Leder P. The IP-10 chemokine binds to a specific cell surface heparan sulfate site shared with platelet factor 4 and inhibits endothelial cell proliferation. J Exp Med 1995;182:219e31. [38] Salcedo R, Resau JH, Halverson D, Hudson EA, Dambach M, Powell D, et al. Differential expression and responsiveness of chemokine receptors (CXCR1-3) by human microvascular endothelial cells and umbilical vein endothelial cells. FASEB J 2000;14:2055e64. [39] Gerritsen ME. Functional heterogeneity of vascular endothelial cells. Biochem Pharmacol 1987;36:2701e11. [40] Roca FJ, Mulero I, Lopez-Munoz A, Sepulcre MP, Renshaw SA, Meseguer J, et al. Evolution of the inflammatory response in vertebrates: fish TNF-alpha is a powerful activator of endothelial cells but hardly activates phagocytes. J Immunol 2008;181:5071e81. [41] Avirutnan P, Malasit P, Seliger B, Bhakdi S, Husmann M. Dengue virus infection of human endothelial cells leads to chemokine production, complement activation, and apoptosis. J Immunol 1998;161:6338e46. [42] Teijaro JR, Walsh KB, Cahalan S, Fremgen DM, Roberts E, Scott F, et al. Endothelial cells are central orchestrators of cytokine amplification during influenza virus infection. Cell 2011;146:980e91.