Cell Biology International ISSN 1065-6995 doi: 10.1002/cbin.10468
SHORT COMMUNICATION
Estrogen-mediated signaling is differentially affected by the expression levels of Sfrp1 in mammary epithelial cells Kelly J. Gregory1,2* and Sallie S. Schneider1,3 1 Pioneer Valley Life Sciences Institute, Baystate Medical Center, Springfield, Massachusetts 01199, USA 2 Biology Department, University of Massachusetts, Amherst, Massachusetts 01003, USA 3 Veterinary and Animal Sciences, University of Massachusetts, Amherst, Massachusetts 01003, USA
Abstract Estrogen has been implicated in breast cancer risk for a variety of reasons including its role in stimulating mammary cell division. Secreted frizzled-related proteins (SFRPs) are a family of Wnt signaling antagonists. Loss of Sfrp1 in mice results in focal ductal epithelial hyperplasias and in humans, loss of SFRP1 is associated with early changes in premalignant breast lesions as well as poor overall survival in patients with early stage breast cancer. Considering that SFRP1 expression is further reduced in ER positive breast cancers when compared with ER negative breast cancers, we chose to determine whether loss of Sfrp1 alters ER signaling. Immunohistochemical analysis revealed that loss of Sfrp1 significantly increased the number of PR and BrdU positve cells in the mammary gland. We further demonstrate that down stream actions of ER-mediated signaling, including cellular proliferation and PR transcription, are elevated in estradiol treated explant cultures derived from Sfrp1/ mice. Additionally, we show that Control explant cultures treated with estradiol exhibit an increase in the mRNA levels of Sfrp1. Finally, we establish that in human mammary epithelial cells with either SFRP1 knocked down (TERT-siSFRP1) and rescued SFRP1 expression (MCF7-SFRP1), estrogen signaling is augmented. Modulation of ER activity appears to be through a mechanism dependent upon Wnt/b-catenin activity. Taken together, our data suggest an important control mechanism by which estrogen signaling is tempered in normal cells and indicates why loss of SFRP1 in early lesions might be a causal change leading to enhanced estrogen-mediated proliferation. Keywords: estrogen signaling; mammary gland; proliferation; SFRP1
Introduction Breast cancer is the most common cancer that occurs in women and is the leading cause of cancer death among women. Cancer results from cellular mutations that enhance proliferation, decrease anti-proliferative signals, and decrease programmed cell death; and from cellular alterations that enhance angiogenesis and metastasis (Hanahan and Weinberg, 2000). Hormones have a substantial effect on breast cancer occurrence in women (Clemons and Goss, 2001). Specifically, in several animal models estradiol (E2) administration causes proliferation and increased breast cancer risk and anti-estrogens abolish this effect (Hollingsworth et al., 1998; Zumoff, 1998). Estrogens are mitogens that enhance cellular proliferation in immature and mature
human mammary epithelial cells and as such, the elevated rate of proliferation represents a putative ER dependent mechanism which leads to breast carcinogenesis (Hofseth et al., 1999). The mammary gland undergoes extensive proliferation during puberty, resulting in the formation of a distinctive cluster of branching ducts that fills the adult mammary fat pad. With each estrous cycle, the mammary epithelium undergoes cycles of proliferation and differentiation giving rise to alveolar buds from the walls of ducts. During pregnancy, these develop into lobuloalveolar structures and compose the secretory component of the fully differentiated mammary gland (Shyamala, 1997). Mammary glands in mice lacking the expression of ERa (aERKO) do not undergo lobular alveolar development indicating the
Corresponding author: e-mail: [email protected] Abbreviations: Sfrp1, secreted frizzled related protein 1; E2, 17b-estradiol; ER, estrogen receptor 11; PR, progesterone receptor; BrdU, 5-bromo-2deoxyuridine
Cell Biol Int 39 (2015) 873–879 © 2015 International Federation for Cell Biology
873
Estrogen signaling and Sfrp1 expression
importance of these ovarian hormones on this developmental process (Couse and Korach, 1999). Members of the Wnt family of secreted proteins activate b-catenin-mediated transcription which in turn regulates cellular proliferation, morphology, and migration. (Polakis, 2000; Brennan and Brown, 2004; Karim et al., 2004). Inappropriate activation of the Wnt/b-catenin pathway contributes to the genesis of a wide range of human cancers, including breast cancer (Polakis, 2000). Secreted frizzledrelated proteins (SFRPs) are a family of Wnt antagonists (Finch et al., 1997) and loss of SFRP expression is found in breast cancer as well as many other cancers (Zhou et al., 1998; Wong et al., 2002; Klopocki et al., 2004). SFRP1 is a member of this protein family that is significantly downregulated in breast tumors and in breast carcinoma cell lines (Zhou et al., 1998; Wong et al., 2002). In mice with a targeted deletion for Sfrp1, we have shown that it plays a role in controlling mammary epithelial cell proliferation and the number of mammosphere forming units as well as in mediating the cellular apoptotic response to DNA damage in vivo (Gauger and Schneider, 2014). Importantly, we also noted precocious lobuloalveolar development in C57/bl6 Sfrp1/ mice (Gauger et al., 2012). Considering the aberrant mammary gland development observed in Sfrp1/ mice, we chose to determine whether loss of Sfrp1 alters ER signaling. Materials and methods
Animals All procedures were performed in accordance with the NIH guidelines for the ethical treatment of animals and were approved by the Baystate Medical Center Institutional Animal Care and Use Committee before initiating these studies. Female BALB/c mice (n ¼ 10/genotype) were individually housed in plastic cages with food and water provided continuously and maintained on a 12:12 light cycle. Mice were injected 70 mg/g body weight of 5-bromo-2deoxyuridine (BrdU; Sigma, St Louis, MO) and the mammary glands were harvested 24 h later.
Immunohistochemisty Immunohistochemistry (IHC) was performed on a DakoCytomation autostainer as described previously (Gauger et al., 2014). After cooling for 20 min, sections were rinsed in TBS and subjected to the following primary antibodies: Rabbit polyclonal anti-ER 1:100, (Santa Cruz Technologies); Rabbit polyclonal anti-PR, (Abcam); Rat monoclonal anti-BrdU 1:100, (Abcam) for 45 min. Immunoreactivity was visualized as described (Gauger et al., 2014). 874
K. J. Gregory and S. S. Schneider
Ex vivo tissue culture Mice were euthanized with carbon dioxide and fourth inguinal mammary glands were excised (n ¼ 6 animals/ genotype). Culture conditions were carried out as previously described (Gauger et al., 2012). Culture dishes contained Phenol-Red Free DMEM/F12 (Gibco) with vehicle (100% EtOH) or 10 nM 17b-estradiol (E2; Sigma) and were subsequently formalin-fixed and paraffin-embedded.
Plasmids and constructs The siSFRP1 plasmid was created as previously described (Gauger et al., 2009). The SFRP1-pCDNA3.1 construct was supplied by Dr. Yoshitaka Sekido (Aichi Cancer Center Research Institute, Nagoya, Japan). The pGL3-Luc.3ERE Luciferase vector was kindly provided by Fern Murdoch (Northwestern University, Evanston, IL) and pRL-CMV was purchased from Promega (Madison, WI).
Cell culture 76N TERT cells were obtained from Dr. Vimla Band and were routinely cultivated as described (Gauger et al., 2009). MCF7 cells were purchased from ATCC (ATTC# HTB-22) and were cultured in DMEM (GIBCO) supplemented with 10% FBS, 1 mg/ml human Insulin solution, and gentamycin. MCF7 cells were plated at a density of 1.5 106 cells per 10 cm dish and transfected with 24 mg the SFRP1pCDNA3.1 construct using LipofectamineTM2000 (Invitrogen, Carlsbad, CA). The pCDNA3.1 vector was trasfected into 76N TERT cells to provide a negative control because the experiments use stably transfected populations, which were obtained by selection with 2 mg/ml puromycin (Sigma).
Luciferase assay A total of 1 105 cells/well were plated in 24 well plates and were transfected the following day with 0.8 mg ERE-Luc and 0.08 mg pRL-CMV using lipofectamine TM 2000 (Invitrogen). After a 24 h incubation, the media was removed and replaced with treatment Phenol-Red Free DMEM/F12 media [either vehicle (10% EtOH/.01% DMSO), 10mM XAV-939 (Tocris Bioscience, Brisol, United Kingdom), 10nM E2, or 10 mM XAV-939 þ 10nM E2]. Twenty-four hours after treatment, cells were washed with 1 PBS and lysed using passive lysis buffer (Promega). Luciferase activity was detected as previously described (Gauger et al., 2011).
RNA isolation and real-time PCR Total RNA was extracted from from the 6th inguinal mammary glands or treated cell lines using an acid-phenol Cell Biol Int 39 (2015) 873–879 © 2015 International Federation for Cell Biology
K. J. Gregory and S. S. Schneider
extraction procedure (Chomczynski and Sacchi, 1987), according to the manufacturer’s instructions (Trizol, Invitrogen, Carlsbad, CA). Relative levels of mRNA were determined by quantitative real-time PCR using the Mx3005PTM real time PCR system (Stratagene, La Jolla, CA) and all values were normalized to the amplification of b-Actin. The PCR primer sequences used are as follows: mouse pgr forward: 50 - TTTGCTGACCAGTCTCAACC -30 , mouse pgr reverse: 50 -CAAACACCATCAGGCTCATC-30 ; mouse b-Actin forward: 50 - CTAAGGCCAACCGTGAAAAG -30 , mouse b-Actin reverse: 50 ACCAGAGGCATACAGGGACA -3’; human PGR forward: 5’- CAGACTTGCCTTTCTGTGGA-3’, human PGR reverse: 50 -CACTGGACCTTTCTCCTGGT -30 ; human bActin forward: 50 - CCAACCGCGAGAAGATGA -30 , human b-Actin reverse: 50 - CCAGAGGCGTACAGGGATAG30 . The assays were performed as described (Gauger et al., 2011). Results and discussion
Loss of Sfrp1 increases proliferation and PR expression in the murine mammary gland The ductal network in the mammary glands of Sfrp1/ mice have significantly more secondary and tertiary branching, as well as aberrant lobular development that more closely resemble the development in pregnant (day 8) animals (Gauger et al., 2012). We sought to examine whether this developmental phenotype was related to changes in estrogen receptor expression or a known transcriptional target. Our initial experiment was aimed at determining whether expressed at higher levels in the absence of Sfrp1. Immunohistochemical analysis revealed that there was no difference in the expression of ERa between control and Sfrp1/ mice (Figure 1A). During normal mammary gland development, progesterone plays a noteworthy role in stimulating the proliferation and differentiation of mammary epithelial cells (Shyamala, 1997) and these processes are mediated by the progesterone receptor (PR). The expression of PR is under the control of estrogen by way of transcriptional regulation due to estrogen-response elements (EREs) in the promoter region (Kraus et al., 1994). We found that there is a significant increase in PR protein expression in the absence of Sfrp1 (Figure 1B). Next, mice were injected with BrdU to measure the effect of Sfrp1 loss on cellular proliferation and we clearly demonstrate that mammary glands derived from Sfrp1/ mice exhibit an increase in the number of BrdU positive cells (Figure 1C). Taken together, these data suggest that SFRP1 expression controls the level of PR and proliferation. Considering that both PR and proliferation are also regulated by estrogen receptor signaling, we turned our Cell Biol Int 39 (2015) 873–879 © 2015 International Federation for Cell Biology
Estrogen signaling and Sfrp1 expression
attention to focus on how SFRP1 expression affects activity downstream of the estrogen receptor.
The relationship between SFRP1 expression and estrogen signaling To determine whether estrogen-mediated proliferation is increased in the absence of SFRP1, we exploited an ex vivo mammary gland explant assay to measure cellular proliferation under specific treatment conditions and to survey the expression the estrogen responsive gene, PR, in mammary glands derived from Sfrp1/ mice. Mouse explant cultures were stained with Proliferating Cell Nuclear Antigen (PCNA) to establish the effect of estrogen treatment on cellular proliferation in mammary epithelial cells. Images captured from treated explants illustrate that cellular proliferation is enhanced by estrogen treatment as expected, and moreover, that loss of Sfrp1 further increases E2mediated proliferation (Figure 2A, left panel). Quantification of PCNA positive cells corroborates this observation (Figure 2A, right panel). Real-time PCR analysis revealed that whole organ cultures from Sfrp1/ mice treated with estradiol expressed significantly higher mRNA levels of PR (Figure 2B). These results are in concordance with our in vivo results and suggest that there is indeed an exacerbated estrogen response when Sfrp1 levels are diminished. SFRP1 has been demonstrated to be an estrogen-induced target in neuroendocrine tumors and bone marrow stromal cells (Yokota et al., 2008; Estrella et al., 2014). Therefore, we wished to establish whether estrogen could reciprocally upregulate Sfrp1 expression in mammary tissue as well. Our findings demonstrate that explant cultures derived from Control mammary glands treated with estrogen express significantly higher levels of Sfrp1 mRNA (Figure 2C). Together, these data suggest that there is a negative feedback loop that occurs between estrogen signaling and Sfrp1 expression. We next wished to establish the relevance of our findings to humans. Immortalized non-malignant human mammary epithelial cells (76N TERT) and human breast cancer cells (MCF-7) were used for our subsequent studies. Control cells (TERT-pSUPER) and cells with SFRP1 knocked-down (TERT-siSFRP1) cells were treated with estradiol and realtime PCR analysis of PR revealed that similar to Sfrp1/ mammary explant cultures, Control cells (TERT-pSUPER) treated with estrogen exhibit an increase in PR mRNA levels and cells with reduced SFRP1 (TERT-siSFRP1) display higher levels of PR expression even in the absence of estrogen treatment (Figure 3A, left panel). Moreover, MCF7cells overexpressing SFRP1 exhibit a suppressed induction of PR mRNA expression (Figure 3A, right panel). Next, TERTpSUPER and TERT-siSFRP1 cells were transfected with an ERE-Luciferase construct and treated with estradiol for 24 h. 875
Estrogen signaling and Sfrp1 expression
K. J. Gregory and S. S. Schneider
Figure 1 Loss of Sfrp1 Increase ER-mediated activity in the murine mammary gland. (A) Left panel, 3rd & 4th inguinal mammary gland sections were subjected to immunohistochemical analysis, stained for ER (brown chromogen), and representative images were captured at 400 are displayed for mice in each treatment group. Right panel, ER-stained cells were counted in each mammary gland (n¼10/genotype) and bars represent mean SEM % ER-positive cells. (B) Left panel, 3rd & 4th inguinal mammary gland sections were subjected to immunohistochemical analysis, stained for PR (brown chromogen), and representative images were captured at 400 are displayed for mice in each treatment group. Right panel, PR-stained cells were counted in each mammary gland (n ¼ 10/genotype) and bars represent mean SEM % PR-positive cells. Left panel, 3rd & 4th inguinal mammary gland sections were subjected to immunohistochemical analysis, stained for BrdU (brown chromogen), and representative images were captured at 400 are displayed for mice in each treatment group (scale bar 50 mm). Right panel, BrDU-stained cells were counted out for each mammary gland (n ¼ 10/ genotype) and bars represent mean SEM % BrdU-positive cells. (*P < 0.05, significantly different from control mice fed a ND using Bonferroni’s t test after a two-way ANOVA.) (*P < 0.05, significantly different from Control mice using Bonferroni’s t-test.)
Luciferase activity was measured and we found that cells with reduced SFRP1 exhibited a significantly higher estrogen-mediated fold increase in relative luciferase activity (Figure 3B, left panel). Conversely, breast cancer cell lines that we engineered to over-express SFRP1 [MCF7-SFRP1 and T47D-SFRP1 (data not shown)] displayed a diminished 876
fold change in ER-mediated relative luciferase activity (Figure 3B, right panel). Considering that E2 has been shown to upregulate Wnt expression in mammary epithelial cells and b-catenin has been demonstrated to affect estrogen signaling in breast cancer cells (Arendt et al., 2014; Gupta et al., 2014), we sought to determine whether the observed Cell Biol Int 39 (2015) 873–879 © 2015 International Federation for Cell Biology
K. J. Gregory and S. S. Schneider
Estrogen signaling and Sfrp1 expression
Figure 2 The relationship between SFRP1 expression and estrogen signaling. (A) Mouse mammary gland explant cultures from Control and Sfrp1/ mice treated with 17b-estradiol (E2) were subjected to immunohistochemical analysis, stained for PCNA (brown chromogen), and representative images were captured at 400X are displayed for mice in each treatment group (scale bar 50 mm). Right panel, PCNA-stained cells were counted in each mammary gland (n ¼ 3mice/treatment group) and bars represent mean SEM % PCNA-positive cells. (B) Total RNA was harvested from Control and Sfrp1/ E2 treated explant cultures and real-time PCR analysis of Pgr mRNA. The results shown represent experiments performed in duplicate and are normalized to the amplification of b-Actin mRNA. Bars represent mean SEM of the difference in fold change compared with vehicle treated cultures from control mice. Bars represent mean SEM of the difference in fold change compared with vehicle treated cultures. (C) Total RNA was harvested from explant cultures derived from Control mice treated with E2 and employed for real-time PCR analysis of Sfrp1 gene expression and results were obtained as described above. Bars represent mean SEM of the difference in fold change compared with vehicle treated cultures. (*P < 0.05, **P < 0.01, ***P < 0.001, significantly different mean using Bonferroni’s t-test)
effects of SFRP1 expression on estrogen-mediated signaling were dependent upon the canonical Wnt/b-catenin signaling pathway. We used a tankyrase inhibitor (XAV-939) to inhibit the Wnt/b-catenin pathway and showed that estrogen signaling is reduced in both non-malignant and malignant human mammary epithelial cells when the Wnt/ b-catenin pathway is blocked. Moreover, we clearly demonstrate that when cells are treated with XAV-939, both the E2-mediated increase in estrogen signaling observed in TERT-siSFRP1 cells and the reciprocal E2Cell Biol Int 39 (2015) 873–879 © 2015 International Federation for Cell Biology
mediated decrease in MCF7-SFRP1 cells no longer occurs (Figure 3A). Finally, similar to our findings with Control mouse explant cultures treated with estrogen, SFRP1 mRNA levels are elevated in response to estrogen in 76N TERT cells (data not shown) revealing the negative feedback loop between estrogen signaling and SFRP1 expression in human mammary epithelial cells. Taken together, these data show that SFRP1 levels modulate estrogen signaling in the mammary epithelium through its control of the canonical Wnt/b-catenin pathway. 877
Estrogen signaling and Sfrp1 expression
K. J. Gregory and S. S. Schneider
Figure 3 SFRP1 expression levels alter estrogen-mediated transcription in human mammary epithelial cells. (A) Twenty-four hours after TERTpSUPER, TERT-siSFRP1, MCF7-PCDNA and MCF7-SFRP1 cells were treated with either vehicle or E2 (n ¼ 3/treatment group), total RNA was isolated for real-time PCR analysis. The level of PGR mRNA was normalized to amplification of b-actin mRNA, which was performed in parallel wells for each treatment. (B) The cell lines depicted were transfected with the ERE-Luciferase and CMV-Renilla Luciferase reporter vectors and relative luciferase activity was measured after an overnight incubation in the presence or absence of the E2 and/or XAV-939 (n ¼ 6/treatment group). Bars represent mean SEM of relative luciferase activity (firefly luciferase activity/renilla luciferase activity) normalized to the relative luciferase activity in Control cells treated with vehicle. (*P < 0.05, **P < 0.01, ***P < 0.001, significantly different mean using Bonferroni’s t-test)
Conclusions Loss of Sfrp1 expression in the mouse mammary gland has been linked to precocious lobuloalveologenesis, enhanced proliferation and resistance to apoptosis (Gauger et al., 2012, 2014; Gauger and Schneider, 2014). Work in human mammary epithelial cells and breast tissue has shown that loss of SFRP1 expression is associated with early changes in human premalignant breast lesions (Dumont et al., 2009) and is also associated with poor overall survival in patients with early stage breast cancer (Klopocki et al., 2004). Moreover, SFRP1 expression is further reduced in ER positive breast cancers when compared with ER negative breast cancers (Bernemann et al., 2014). In this manuscript we sought to determine whether different levels of SFRP1 could modulate estrogen signaling in mouse as well as human breast epithelium. We found that a targeted deletion or partial knockdown of SFRP1 enhanced ER signaling and that rescue of SFRP1 expression in breast cancer cell lines suppressed ER signaling. Furthermore, we were able to show that this modulation was through a mechanism dependent upon b-catenin activity. These data are in agreement with 878
several recent studies showing that estrogen can induce the Wnt/b-catenin pathway in human mammary epithelial cells to enhance progenitor activity (Arendt et al., 2014) and that knockdown of b-catenin can inhibit ER signaling in breast cancer cell lines (Gupta et al., 2014). Finally, we show that in non-cancerous human and mouse mammary epithelial cell lines, estrogen induces SFRP1 expression. This is important because it suggests an important control mechanism by which estrogen signaling is tempered in normal cells and indicates why loss of SFRP1 in early lesions might be a causal change leading to enhanced estrogen-mediated proliferation. Acknowledgment and funding We would like to thank the members of the Schneider laboratory for their continued support. This work was funded by The Rays of Hope Foundation. Conflicts of interest: The authors do not have any financial or personal relationships with other people or organizations that could inappropriately influence the work described in this manuscript. Cell Biol Int 39 (2015) 873–879 © 2015 International Federation for Cell Biology
K. J. Gregory and S. S. Schneider
REFERENCES Arendt LM, St Laurent J, Wronski A, Caballero S, Lyle SR, Naber SP, Kuperwasser C (2014) Human breast progenitor cell numbers are regulated by WNT and T BX3. PloS ONE 9(10): e11442. Bernemann C, Hulsewig C, Ruckert C, Schafer S, Blumel L, Hempel G, Gotte M, Greve B, Barth PJ, Kiesel L, Liedtke C (2014) Influence of secreted frizzled receptor protein 1 (SFRP1) on neoadjuvant chemotherapy in triple negative breast cancer does not rely on WNT signaling. Mol Cancer 13: 174. Brennan KR, Brown AM (2004) Wnt proteins in mammary development and cancer. J Mammary Gland Biol Neoplasia 9(2): 119–31. Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162(1): 156–9. Clemons M, Goss P (2001) Estrogen and the risk of breast cancer. N Engl J Med 344(4): 276–85. Couse JF, Korach KS (1999) Estrogen receptor null mice: what have we learned and where will they lead us?. Endocr Rev 20(3): 358–417. Dumont N, Crawford YG, Sigaroudinia M, Nagrani SS, Wilson MB, Buehring GC, Turashvili G, Aparicio S, Gauthier ML, Fordyce CA, McDermott KM, Tlsty TD (2009) Human mammary cancer progression model recapitulates methylation events associated with breast premalignancy. Breast Cancer Res 11(6): R87. Estrella JS, Ma LT, Milton DR, Yao JC, Wang H, Rashid A, Broaddus RR (2014) Expression of estrogen-induced genes and estrogen receptor beta in pancreatic neuroendocrine tumors: implications for targeted therapy. Pancreas 43(7): 996–1002. Finch PW, He X, Kelley MJ, Uren A, Schaudies RP, Popescu NC, Rudikoff S, Aaronson SA, Varmus HE, Rubin JS (1997) Purification and molecular cloning of a secreted, Frizzledrelated antagonist of Wnt action. Proc Natl Acad Sci U S A 94(13): 6770–5. Gauger KJ, Bassa LM, Henchey EM, Wyman J, Ser-Dolansky J, Shimono A, Schneider SS (2014) The effects of diet induced obesity on breast cancer associated pathways in mice deficient in SFRP1. Mol Cancer 13(1): 117. Gauger KJ, Chenausky KL, Murray ME, Schneider SS (2011) SFRP1 reduction results in an increased sensitivity to TGF-beta signaling. BMC Cancer 11: 59. Gauger KJ, Hugh JM, Troester MA, Schneider SS (2009) Downregulation of sfrp1 in a mammary epithelial cell line promotes the development of a cd44high/cd24low population which is invasive and resistant to anoikis. Cancer Cell Int 9: 11. Gauger KJ, Schneider SS (2014) The tumor supressor sectrete frizzled related protein 1 regulates p53-mediated apoptosis. Cell Biol Int 38(1): 124–30. Gauger KJ, Shimono A, Crisi GM, Schneider SS (2012) Loss of SFRP1 promotes ductal branching in the murine mammary gland. BMC Dev Biol 12: 25.
Cell Biol Int 39 (2015) 873–879 © 2015 International Federation for Cell Biology
Estrogen signaling and Sfrp1 expression
Gupta N, Schmitt F, Grebhardt S, Mayer, D (2014) Beta-Catenin is a positive regulator of estrogen receptor-alpha function in breast cancer cells. Cancers 3(3): 2990–3001. Hanahan D, Weinberg RA (2000) The hallmarks of cancer. Cell 100(1): 57–70. Hofseth LJ, Raafat AM, Osuch JR, Pathak DR, Slomski CA, Haslam SZ (1999) Hormone replacement therapy with estrogen or estrogen plus medroxyprogesterone acetate is associated with increased epithelial proliferation in the normal postmenopausal breast. J Clin Endocrinol Metab 84(12): 4559–65. Hollingsworth AB, Lerner MR, Lightfoot SA, Wilkerson KB, Hanas JS, McCay PB, Brackett DJ (1998) Prevention of DMBA-induced rat mammary carcinomas comparing leuprolide, oophorectomy, and tamoxifen. Breast Cancer Res Treat 47(1): 63–70. Karim R, Tse G, Putti T, Scolyer R, Lee S (2004) The significance of the Wnt pathway in the pathology of human cancers. Pathology 36(2): 120–8. Klopocki E, Kristiansen G, Wild PJ, Klaman I, Castanos-Velez E, Singer G, Stohr R, Simon R, Sauter G, Leibiger H, Essers L, Weber B, Hermann K, Rosenthal A, Hartmann A, Dahl E (2004) Loss of SFRP1 is associated with breast cancer progression and poor prognosis in early stage tumors. Int J Oncol 25(3): 641–9. Kraus WL, Montano MM, Katzenellenbogen BS (1994) Identification of multiple, widely spaced estrogen-responsive regions in the rat progesterone receptor gene. Mol Endocrinol 8(8): 952–69. Polakis P (2000) Wnt signaling and cancer. Genes 14(15): 1837– 51. Shyamala G (1997) Roles of estrogen and progesterone in normal mammary gland development insights from progesterone receptor null mutant mice and in situ localization of receptor. Trends Endocrinol Metab 8(1): 34–9. Wong SC, Lo SF, Lee KC, Yam JW, Chan JK, Wendy Hsiao WL (2002) Expression of frizzled-related protein and Wntsignalling molecules in invasive human breast tumours. J Pathol 196(2): 145–53. Yokota T, Oritani K, Garrett KP, Kouro T, Nishida M, Takahashi I, Ichii M, Satoh Y, Kincade PW, Kanakura Y (2008) Soluble frizzled-related protein 1 is estrogen inducible in bone marrow stromal cells and suppresses the earliest events in lymphopoiesis. J Immunol 181(9): 6061–72. Zhou Z, Wang J, Han X, Zhou J, Linder S (1998) Up-regulation of human secreted frizzled homolog in apoptosis and its downregulation in breast tumors. Int J Cancer 78(1): 95–9. Zumoff B (1998) Does postmenopausal estrogen administration increase the risk of breast cancer? Contributions of animal, biochemical, and clinical investigative studies to a resolution of the controversy. Proc Soc Exp Biol Med 217(1): 30–7. Received 19 February 2015; accepted 26 February 2015. Final version published online 5 May 2015.
879
SHORT COMMUNICATION
Estrogen-mediated signaling is differentially affected by the expression levels of Sfrp1 in mammary epithelial cells Kelly J. Gregory1,2* and Sallie S. Schneider1,3 1 Pioneer Valley Life Sciences Institute, Baystate Medical Center, Springfield, Massachusetts 01199, USA 2 Biology Department, University of Massachusetts, Amherst, Massachusetts 01003, USA 3 Veterinary and Animal Sciences, University of Massachusetts, Amherst, Massachusetts 01003, USA
Abstract Estrogen has been implicated in breast cancer risk for a variety of reasons including its role in stimulating mammary cell division. Secreted frizzled-related proteins (SFRPs) are a family of Wnt signaling antagonists. Loss of Sfrp1 in mice results in focal ductal epithelial hyperplasias and in humans, loss of SFRP1 is associated with early changes in premalignant breast lesions as well as poor overall survival in patients with early stage breast cancer. Considering that SFRP1 expression is further reduced in ER positive breast cancers when compared with ER negative breast cancers, we chose to determine whether loss of Sfrp1 alters ER signaling. Immunohistochemical analysis revealed that loss of Sfrp1 significantly increased the number of PR and BrdU positve cells in the mammary gland. We further demonstrate that down stream actions of ER-mediated signaling, including cellular proliferation and PR transcription, are elevated in estradiol treated explant cultures derived from Sfrp1/ mice. Additionally, we show that Control explant cultures treated with estradiol exhibit an increase in the mRNA levels of Sfrp1. Finally, we establish that in human mammary epithelial cells with either SFRP1 knocked down (TERT-siSFRP1) and rescued SFRP1 expression (MCF7-SFRP1), estrogen signaling is augmented. Modulation of ER activity appears to be through a mechanism dependent upon Wnt/b-catenin activity. Taken together, our data suggest an important control mechanism by which estrogen signaling is tempered in normal cells and indicates why loss of SFRP1 in early lesions might be a causal change leading to enhanced estrogen-mediated proliferation. Keywords: estrogen signaling; mammary gland; proliferation; SFRP1
Introduction Breast cancer is the most common cancer that occurs in women and is the leading cause of cancer death among women. Cancer results from cellular mutations that enhance proliferation, decrease anti-proliferative signals, and decrease programmed cell death; and from cellular alterations that enhance angiogenesis and metastasis (Hanahan and Weinberg, 2000). Hormones have a substantial effect on breast cancer occurrence in women (Clemons and Goss, 2001). Specifically, in several animal models estradiol (E2) administration causes proliferation and increased breast cancer risk and anti-estrogens abolish this effect (Hollingsworth et al., 1998; Zumoff, 1998). Estrogens are mitogens that enhance cellular proliferation in immature and mature
human mammary epithelial cells and as such, the elevated rate of proliferation represents a putative ER dependent mechanism which leads to breast carcinogenesis (Hofseth et al., 1999). The mammary gland undergoes extensive proliferation during puberty, resulting in the formation of a distinctive cluster of branching ducts that fills the adult mammary fat pad. With each estrous cycle, the mammary epithelium undergoes cycles of proliferation and differentiation giving rise to alveolar buds from the walls of ducts. During pregnancy, these develop into lobuloalveolar structures and compose the secretory component of the fully differentiated mammary gland (Shyamala, 1997). Mammary glands in mice lacking the expression of ERa (aERKO) do not undergo lobular alveolar development indicating the
Corresponding author: e-mail: [email protected] Abbreviations: Sfrp1, secreted frizzled related protein 1; E2, 17b-estradiol; ER, estrogen receptor 11; PR, progesterone receptor; BrdU, 5-bromo-2deoxyuridine
Cell Biol Int 39 (2015) 873–879 © 2015 International Federation for Cell Biology
873
Estrogen signaling and Sfrp1 expression
importance of these ovarian hormones on this developmental process (Couse and Korach, 1999). Members of the Wnt family of secreted proteins activate b-catenin-mediated transcription which in turn regulates cellular proliferation, morphology, and migration. (Polakis, 2000; Brennan and Brown, 2004; Karim et al., 2004). Inappropriate activation of the Wnt/b-catenin pathway contributes to the genesis of a wide range of human cancers, including breast cancer (Polakis, 2000). Secreted frizzledrelated proteins (SFRPs) are a family of Wnt antagonists (Finch et al., 1997) and loss of SFRP expression is found in breast cancer as well as many other cancers (Zhou et al., 1998; Wong et al., 2002; Klopocki et al., 2004). SFRP1 is a member of this protein family that is significantly downregulated in breast tumors and in breast carcinoma cell lines (Zhou et al., 1998; Wong et al., 2002). In mice with a targeted deletion for Sfrp1, we have shown that it plays a role in controlling mammary epithelial cell proliferation and the number of mammosphere forming units as well as in mediating the cellular apoptotic response to DNA damage in vivo (Gauger and Schneider, 2014). Importantly, we also noted precocious lobuloalveolar development in C57/bl6 Sfrp1/ mice (Gauger et al., 2012). Considering the aberrant mammary gland development observed in Sfrp1/ mice, we chose to determine whether loss of Sfrp1 alters ER signaling. Materials and methods
Animals All procedures were performed in accordance with the NIH guidelines for the ethical treatment of animals and were approved by the Baystate Medical Center Institutional Animal Care and Use Committee before initiating these studies. Female BALB/c mice (n ¼ 10/genotype) were individually housed in plastic cages with food and water provided continuously and maintained on a 12:12 light cycle. Mice were injected 70 mg/g body weight of 5-bromo-2deoxyuridine (BrdU; Sigma, St Louis, MO) and the mammary glands were harvested 24 h later.
Immunohistochemisty Immunohistochemistry (IHC) was performed on a DakoCytomation autostainer as described previously (Gauger et al., 2014). After cooling for 20 min, sections were rinsed in TBS and subjected to the following primary antibodies: Rabbit polyclonal anti-ER 1:100, (Santa Cruz Technologies); Rabbit polyclonal anti-PR, (Abcam); Rat monoclonal anti-BrdU 1:100, (Abcam) for 45 min. Immunoreactivity was visualized as described (Gauger et al., 2014). 874
K. J. Gregory and S. S. Schneider
Ex vivo tissue culture Mice were euthanized with carbon dioxide and fourth inguinal mammary glands were excised (n ¼ 6 animals/ genotype). Culture conditions were carried out as previously described (Gauger et al., 2012). Culture dishes contained Phenol-Red Free DMEM/F12 (Gibco) with vehicle (100% EtOH) or 10 nM 17b-estradiol (E2; Sigma) and were subsequently formalin-fixed and paraffin-embedded.
Plasmids and constructs The siSFRP1 plasmid was created as previously described (Gauger et al., 2009). The SFRP1-pCDNA3.1 construct was supplied by Dr. Yoshitaka Sekido (Aichi Cancer Center Research Institute, Nagoya, Japan). The pGL3-Luc.3ERE Luciferase vector was kindly provided by Fern Murdoch (Northwestern University, Evanston, IL) and pRL-CMV was purchased from Promega (Madison, WI).
Cell culture 76N TERT cells were obtained from Dr. Vimla Band and were routinely cultivated as described (Gauger et al., 2009). MCF7 cells were purchased from ATCC (ATTC# HTB-22) and were cultured in DMEM (GIBCO) supplemented with 10% FBS, 1 mg/ml human Insulin solution, and gentamycin. MCF7 cells were plated at a density of 1.5 106 cells per 10 cm dish and transfected with 24 mg the SFRP1pCDNA3.1 construct using LipofectamineTM2000 (Invitrogen, Carlsbad, CA). The pCDNA3.1 vector was trasfected into 76N TERT cells to provide a negative control because the experiments use stably transfected populations, which were obtained by selection with 2 mg/ml puromycin (Sigma).
Luciferase assay A total of 1 105 cells/well were plated in 24 well plates and were transfected the following day with 0.8 mg ERE-Luc and 0.08 mg pRL-CMV using lipofectamine TM 2000 (Invitrogen). After a 24 h incubation, the media was removed and replaced with treatment Phenol-Red Free DMEM/F12 media [either vehicle (10% EtOH/.01% DMSO), 10mM XAV-939 (Tocris Bioscience, Brisol, United Kingdom), 10nM E2, or 10 mM XAV-939 þ 10nM E2]. Twenty-four hours after treatment, cells were washed with 1 PBS and lysed using passive lysis buffer (Promega). Luciferase activity was detected as previously described (Gauger et al., 2011).
RNA isolation and real-time PCR Total RNA was extracted from from the 6th inguinal mammary glands or treated cell lines using an acid-phenol Cell Biol Int 39 (2015) 873–879 © 2015 International Federation for Cell Biology
K. J. Gregory and S. S. Schneider
extraction procedure (Chomczynski and Sacchi, 1987), according to the manufacturer’s instructions (Trizol, Invitrogen, Carlsbad, CA). Relative levels of mRNA were determined by quantitative real-time PCR using the Mx3005PTM real time PCR system (Stratagene, La Jolla, CA) and all values were normalized to the amplification of b-Actin. The PCR primer sequences used are as follows: mouse pgr forward: 50 - TTTGCTGACCAGTCTCAACC -30 , mouse pgr reverse: 50 -CAAACACCATCAGGCTCATC-30 ; mouse b-Actin forward: 50 - CTAAGGCCAACCGTGAAAAG -30 , mouse b-Actin reverse: 50 ACCAGAGGCATACAGGGACA -3’; human PGR forward: 5’- CAGACTTGCCTTTCTGTGGA-3’, human PGR reverse: 50 -CACTGGACCTTTCTCCTGGT -30 ; human bActin forward: 50 - CCAACCGCGAGAAGATGA -30 , human b-Actin reverse: 50 - CCAGAGGCGTACAGGGATAG30 . The assays were performed as described (Gauger et al., 2011). Results and discussion
Loss of Sfrp1 increases proliferation and PR expression in the murine mammary gland The ductal network in the mammary glands of Sfrp1/ mice have significantly more secondary and tertiary branching, as well as aberrant lobular development that more closely resemble the development in pregnant (day 8) animals (Gauger et al., 2012). We sought to examine whether this developmental phenotype was related to changes in estrogen receptor expression or a known transcriptional target. Our initial experiment was aimed at determining whether expressed at higher levels in the absence of Sfrp1. Immunohistochemical analysis revealed that there was no difference in the expression of ERa between control and Sfrp1/ mice (Figure 1A). During normal mammary gland development, progesterone plays a noteworthy role in stimulating the proliferation and differentiation of mammary epithelial cells (Shyamala, 1997) and these processes are mediated by the progesterone receptor (PR). The expression of PR is under the control of estrogen by way of transcriptional regulation due to estrogen-response elements (EREs) in the promoter region (Kraus et al., 1994). We found that there is a significant increase in PR protein expression in the absence of Sfrp1 (Figure 1B). Next, mice were injected with BrdU to measure the effect of Sfrp1 loss on cellular proliferation and we clearly demonstrate that mammary glands derived from Sfrp1/ mice exhibit an increase in the number of BrdU positive cells (Figure 1C). Taken together, these data suggest that SFRP1 expression controls the level of PR and proliferation. Considering that both PR and proliferation are also regulated by estrogen receptor signaling, we turned our Cell Biol Int 39 (2015) 873–879 © 2015 International Federation for Cell Biology
Estrogen signaling and Sfrp1 expression
attention to focus on how SFRP1 expression affects activity downstream of the estrogen receptor.
The relationship between SFRP1 expression and estrogen signaling To determine whether estrogen-mediated proliferation is increased in the absence of SFRP1, we exploited an ex vivo mammary gland explant assay to measure cellular proliferation under specific treatment conditions and to survey the expression the estrogen responsive gene, PR, in mammary glands derived from Sfrp1/ mice. Mouse explant cultures were stained with Proliferating Cell Nuclear Antigen (PCNA) to establish the effect of estrogen treatment on cellular proliferation in mammary epithelial cells. Images captured from treated explants illustrate that cellular proliferation is enhanced by estrogen treatment as expected, and moreover, that loss of Sfrp1 further increases E2mediated proliferation (Figure 2A, left panel). Quantification of PCNA positive cells corroborates this observation (Figure 2A, right panel). Real-time PCR analysis revealed that whole organ cultures from Sfrp1/ mice treated with estradiol expressed significantly higher mRNA levels of PR (Figure 2B). These results are in concordance with our in vivo results and suggest that there is indeed an exacerbated estrogen response when Sfrp1 levels are diminished. SFRP1 has been demonstrated to be an estrogen-induced target in neuroendocrine tumors and bone marrow stromal cells (Yokota et al., 2008; Estrella et al., 2014). Therefore, we wished to establish whether estrogen could reciprocally upregulate Sfrp1 expression in mammary tissue as well. Our findings demonstrate that explant cultures derived from Control mammary glands treated with estrogen express significantly higher levels of Sfrp1 mRNA (Figure 2C). Together, these data suggest that there is a negative feedback loop that occurs between estrogen signaling and Sfrp1 expression. We next wished to establish the relevance of our findings to humans. Immortalized non-malignant human mammary epithelial cells (76N TERT) and human breast cancer cells (MCF-7) were used for our subsequent studies. Control cells (TERT-pSUPER) and cells with SFRP1 knocked-down (TERT-siSFRP1) cells were treated with estradiol and realtime PCR analysis of PR revealed that similar to Sfrp1/ mammary explant cultures, Control cells (TERT-pSUPER) treated with estrogen exhibit an increase in PR mRNA levels and cells with reduced SFRP1 (TERT-siSFRP1) display higher levels of PR expression even in the absence of estrogen treatment (Figure 3A, left panel). Moreover, MCF7cells overexpressing SFRP1 exhibit a suppressed induction of PR mRNA expression (Figure 3A, right panel). Next, TERTpSUPER and TERT-siSFRP1 cells were transfected with an ERE-Luciferase construct and treated with estradiol for 24 h. 875
Estrogen signaling and Sfrp1 expression
K. J. Gregory and S. S. Schneider
Figure 1 Loss of Sfrp1 Increase ER-mediated activity in the murine mammary gland. (A) Left panel, 3rd & 4th inguinal mammary gland sections were subjected to immunohistochemical analysis, stained for ER (brown chromogen), and representative images were captured at 400 are displayed for mice in each treatment group. Right panel, ER-stained cells were counted in each mammary gland (n¼10/genotype) and bars represent mean SEM % ER-positive cells. (B) Left panel, 3rd & 4th inguinal mammary gland sections were subjected to immunohistochemical analysis, stained for PR (brown chromogen), and representative images were captured at 400 are displayed for mice in each treatment group. Right panel, PR-stained cells were counted in each mammary gland (n ¼ 10/genotype) and bars represent mean SEM % PR-positive cells. Left panel, 3rd & 4th inguinal mammary gland sections were subjected to immunohistochemical analysis, stained for BrdU (brown chromogen), and representative images were captured at 400 are displayed for mice in each treatment group (scale bar 50 mm). Right panel, BrDU-stained cells were counted out for each mammary gland (n ¼ 10/ genotype) and bars represent mean SEM % BrdU-positive cells. (*P < 0.05, significantly different from control mice fed a ND using Bonferroni’s t test after a two-way ANOVA.) (*P < 0.05, significantly different from Control mice using Bonferroni’s t-test.)
Luciferase activity was measured and we found that cells with reduced SFRP1 exhibited a significantly higher estrogen-mediated fold increase in relative luciferase activity (Figure 3B, left panel). Conversely, breast cancer cell lines that we engineered to over-express SFRP1 [MCF7-SFRP1 and T47D-SFRP1 (data not shown)] displayed a diminished 876
fold change in ER-mediated relative luciferase activity (Figure 3B, right panel). Considering that E2 has been shown to upregulate Wnt expression in mammary epithelial cells and b-catenin has been demonstrated to affect estrogen signaling in breast cancer cells (Arendt et al., 2014; Gupta et al., 2014), we sought to determine whether the observed Cell Biol Int 39 (2015) 873–879 © 2015 International Federation for Cell Biology
K. J. Gregory and S. S. Schneider
Estrogen signaling and Sfrp1 expression
Figure 2 The relationship between SFRP1 expression and estrogen signaling. (A) Mouse mammary gland explant cultures from Control and Sfrp1/ mice treated with 17b-estradiol (E2) were subjected to immunohistochemical analysis, stained for PCNA (brown chromogen), and representative images were captured at 400X are displayed for mice in each treatment group (scale bar 50 mm). Right panel, PCNA-stained cells were counted in each mammary gland (n ¼ 3mice/treatment group) and bars represent mean SEM % PCNA-positive cells. (B) Total RNA was harvested from Control and Sfrp1/ E2 treated explant cultures and real-time PCR analysis of Pgr mRNA. The results shown represent experiments performed in duplicate and are normalized to the amplification of b-Actin mRNA. Bars represent mean SEM of the difference in fold change compared with vehicle treated cultures from control mice. Bars represent mean SEM of the difference in fold change compared with vehicle treated cultures. (C) Total RNA was harvested from explant cultures derived from Control mice treated with E2 and employed for real-time PCR analysis of Sfrp1 gene expression and results were obtained as described above. Bars represent mean SEM of the difference in fold change compared with vehicle treated cultures. (*P < 0.05, **P < 0.01, ***P < 0.001, significantly different mean using Bonferroni’s t-test)
effects of SFRP1 expression on estrogen-mediated signaling were dependent upon the canonical Wnt/b-catenin signaling pathway. We used a tankyrase inhibitor (XAV-939) to inhibit the Wnt/b-catenin pathway and showed that estrogen signaling is reduced in both non-malignant and malignant human mammary epithelial cells when the Wnt/ b-catenin pathway is blocked. Moreover, we clearly demonstrate that when cells are treated with XAV-939, both the E2-mediated increase in estrogen signaling observed in TERT-siSFRP1 cells and the reciprocal E2Cell Biol Int 39 (2015) 873–879 © 2015 International Federation for Cell Biology
mediated decrease in MCF7-SFRP1 cells no longer occurs (Figure 3A). Finally, similar to our findings with Control mouse explant cultures treated with estrogen, SFRP1 mRNA levels are elevated in response to estrogen in 76N TERT cells (data not shown) revealing the negative feedback loop between estrogen signaling and SFRP1 expression in human mammary epithelial cells. Taken together, these data show that SFRP1 levels modulate estrogen signaling in the mammary epithelium through its control of the canonical Wnt/b-catenin pathway. 877
Estrogen signaling and Sfrp1 expression
K. J. Gregory and S. S. Schneider
Figure 3 SFRP1 expression levels alter estrogen-mediated transcription in human mammary epithelial cells. (A) Twenty-four hours after TERTpSUPER, TERT-siSFRP1, MCF7-PCDNA and MCF7-SFRP1 cells were treated with either vehicle or E2 (n ¼ 3/treatment group), total RNA was isolated for real-time PCR analysis. The level of PGR mRNA was normalized to amplification of b-actin mRNA, which was performed in parallel wells for each treatment. (B) The cell lines depicted were transfected with the ERE-Luciferase and CMV-Renilla Luciferase reporter vectors and relative luciferase activity was measured after an overnight incubation in the presence or absence of the E2 and/or XAV-939 (n ¼ 6/treatment group). Bars represent mean SEM of relative luciferase activity (firefly luciferase activity/renilla luciferase activity) normalized to the relative luciferase activity in Control cells treated with vehicle. (*P < 0.05, **P < 0.01, ***P < 0.001, significantly different mean using Bonferroni’s t-test)
Conclusions Loss of Sfrp1 expression in the mouse mammary gland has been linked to precocious lobuloalveologenesis, enhanced proliferation and resistance to apoptosis (Gauger et al., 2012, 2014; Gauger and Schneider, 2014). Work in human mammary epithelial cells and breast tissue has shown that loss of SFRP1 expression is associated with early changes in human premalignant breast lesions (Dumont et al., 2009) and is also associated with poor overall survival in patients with early stage breast cancer (Klopocki et al., 2004). Moreover, SFRP1 expression is further reduced in ER positive breast cancers when compared with ER negative breast cancers (Bernemann et al., 2014). In this manuscript we sought to determine whether different levels of SFRP1 could modulate estrogen signaling in mouse as well as human breast epithelium. We found that a targeted deletion or partial knockdown of SFRP1 enhanced ER signaling and that rescue of SFRP1 expression in breast cancer cell lines suppressed ER signaling. Furthermore, we were able to show that this modulation was through a mechanism dependent upon b-catenin activity. These data are in agreement with 878
several recent studies showing that estrogen can induce the Wnt/b-catenin pathway in human mammary epithelial cells to enhance progenitor activity (Arendt et al., 2014) and that knockdown of b-catenin can inhibit ER signaling in breast cancer cell lines (Gupta et al., 2014). Finally, we show that in non-cancerous human and mouse mammary epithelial cell lines, estrogen induces SFRP1 expression. This is important because it suggests an important control mechanism by which estrogen signaling is tempered in normal cells and indicates why loss of SFRP1 in early lesions might be a causal change leading to enhanced estrogen-mediated proliferation. Acknowledgment and funding We would like to thank the members of the Schneider laboratory for their continued support. This work was funded by The Rays of Hope Foundation. Conflicts of interest: The authors do not have any financial or personal relationships with other people or organizations that could inappropriately influence the work described in this manuscript. Cell Biol Int 39 (2015) 873–879 © 2015 International Federation for Cell Biology
K. J. Gregory and S. S. Schneider
REFERENCES Arendt LM, St Laurent J, Wronski A, Caballero S, Lyle SR, Naber SP, Kuperwasser C (2014) Human breast progenitor cell numbers are regulated by WNT and T BX3. PloS ONE 9(10): e11442. Bernemann C, Hulsewig C, Ruckert C, Schafer S, Blumel L, Hempel G, Gotte M, Greve B, Barth PJ, Kiesel L, Liedtke C (2014) Influence of secreted frizzled receptor protein 1 (SFRP1) on neoadjuvant chemotherapy in triple negative breast cancer does not rely on WNT signaling. Mol Cancer 13: 174. Brennan KR, Brown AM (2004) Wnt proteins in mammary development and cancer. J Mammary Gland Biol Neoplasia 9(2): 119–31. Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162(1): 156–9. Clemons M, Goss P (2001) Estrogen and the risk of breast cancer. N Engl J Med 344(4): 276–85. Couse JF, Korach KS (1999) Estrogen receptor null mice: what have we learned and where will they lead us?. Endocr Rev 20(3): 358–417. Dumont N, Crawford YG, Sigaroudinia M, Nagrani SS, Wilson MB, Buehring GC, Turashvili G, Aparicio S, Gauthier ML, Fordyce CA, McDermott KM, Tlsty TD (2009) Human mammary cancer progression model recapitulates methylation events associated with breast premalignancy. Breast Cancer Res 11(6): R87. Estrella JS, Ma LT, Milton DR, Yao JC, Wang H, Rashid A, Broaddus RR (2014) Expression of estrogen-induced genes and estrogen receptor beta in pancreatic neuroendocrine tumors: implications for targeted therapy. Pancreas 43(7): 996–1002. Finch PW, He X, Kelley MJ, Uren A, Schaudies RP, Popescu NC, Rudikoff S, Aaronson SA, Varmus HE, Rubin JS (1997) Purification and molecular cloning of a secreted, Frizzledrelated antagonist of Wnt action. Proc Natl Acad Sci U S A 94(13): 6770–5. Gauger KJ, Bassa LM, Henchey EM, Wyman J, Ser-Dolansky J, Shimono A, Schneider SS (2014) The effects of diet induced obesity on breast cancer associated pathways in mice deficient in SFRP1. Mol Cancer 13(1): 117. Gauger KJ, Chenausky KL, Murray ME, Schneider SS (2011) SFRP1 reduction results in an increased sensitivity to TGF-beta signaling. BMC Cancer 11: 59. Gauger KJ, Hugh JM, Troester MA, Schneider SS (2009) Downregulation of sfrp1 in a mammary epithelial cell line promotes the development of a cd44high/cd24low population which is invasive and resistant to anoikis. Cancer Cell Int 9: 11. Gauger KJ, Schneider SS (2014) The tumor supressor sectrete frizzled related protein 1 regulates p53-mediated apoptosis. Cell Biol Int 38(1): 124–30. Gauger KJ, Shimono A, Crisi GM, Schneider SS (2012) Loss of SFRP1 promotes ductal branching in the murine mammary gland. BMC Dev Biol 12: 25.
Cell Biol Int 39 (2015) 873–879 © 2015 International Federation for Cell Biology
Estrogen signaling and Sfrp1 expression
Gupta N, Schmitt F, Grebhardt S, Mayer, D (2014) Beta-Catenin is a positive regulator of estrogen receptor-alpha function in breast cancer cells. Cancers 3(3): 2990–3001. Hanahan D, Weinberg RA (2000) The hallmarks of cancer. Cell 100(1): 57–70. Hofseth LJ, Raafat AM, Osuch JR, Pathak DR, Slomski CA, Haslam SZ (1999) Hormone replacement therapy with estrogen or estrogen plus medroxyprogesterone acetate is associated with increased epithelial proliferation in the normal postmenopausal breast. J Clin Endocrinol Metab 84(12): 4559–65. Hollingsworth AB, Lerner MR, Lightfoot SA, Wilkerson KB, Hanas JS, McCay PB, Brackett DJ (1998) Prevention of DMBA-induced rat mammary carcinomas comparing leuprolide, oophorectomy, and tamoxifen. Breast Cancer Res Treat 47(1): 63–70. Karim R, Tse G, Putti T, Scolyer R, Lee S (2004) The significance of the Wnt pathway in the pathology of human cancers. Pathology 36(2): 120–8. Klopocki E, Kristiansen G, Wild PJ, Klaman I, Castanos-Velez E, Singer G, Stohr R, Simon R, Sauter G, Leibiger H, Essers L, Weber B, Hermann K, Rosenthal A, Hartmann A, Dahl E (2004) Loss of SFRP1 is associated with breast cancer progression and poor prognosis in early stage tumors. Int J Oncol 25(3): 641–9. Kraus WL, Montano MM, Katzenellenbogen BS (1994) Identification of multiple, widely spaced estrogen-responsive regions in the rat progesterone receptor gene. Mol Endocrinol 8(8): 952–69. Polakis P (2000) Wnt signaling and cancer. Genes 14(15): 1837– 51. Shyamala G (1997) Roles of estrogen and progesterone in normal mammary gland development insights from progesterone receptor null mutant mice and in situ localization of receptor. Trends Endocrinol Metab 8(1): 34–9. Wong SC, Lo SF, Lee KC, Yam JW, Chan JK, Wendy Hsiao WL (2002) Expression of frizzled-related protein and Wntsignalling molecules in invasive human breast tumours. J Pathol 196(2): 145–53. Yokota T, Oritani K, Garrett KP, Kouro T, Nishida M, Takahashi I, Ichii M, Satoh Y, Kincade PW, Kanakura Y (2008) Soluble frizzled-related protein 1 is estrogen inducible in bone marrow stromal cells and suppresses the earliest events in lymphopoiesis. J Immunol 181(9): 6061–72. Zhou Z, Wang J, Han X, Zhou J, Linder S (1998) Up-regulation of human secreted frizzled homolog in apoptosis and its downregulation in breast tumors. Int J Cancer 78(1): 95–9. Zumoff B (1998) Does postmenopausal estrogen administration increase the risk of breast cancer? Contributions of animal, biochemical, and clinical investigative studies to a resolution of the controversy. Proc Soc Exp Biol Med 217(1): 30–7. Received 19 February 2015; accepted 26 February 2015. Final version published online 5 May 2015.
879
