Chromosoma (1992) 101 :467M73
CHROMOSOMA 9 Springer-Verlag1992
Chromosoma Focus
Review: Eukaryotic DNA helicases: Essential enzymes for DNA transactions Pia Th6mmes* and Ulrich Hiibscher
D N A in its double-stranded form is energetically favoured and therefore very stable. However, D N A is involved in metabolic events and thus has a continuous dynamic. Processes such as D N A replication, D N A repair, D N A recombination and transcription require that D N A occurs transiently in a single-stranded form. This status can be achieved by enzymes called D N A helicases. These enzymes have the power to melt the hydrogen bonds between the base pairs by using nucleoside 5'-triphosphate hydrolysis as an energy source. A variety of different D N A helicases have recently been identified from eukaryotic viruses and cells. We focus on the current knowledge of these D N A helicases and their possible function in D N A transactions.
The extremely stable D N A molecule requires remarkable enzymes to open the double helix: D N A helicases DNA, the genetic material of many forms of life, generally occurs in a double-stranded form. The antiparallel strands of the double helix are held together by hydrogen Abbreviations." RF-A, replication factor A; SV40, simian virus 40; HSV, herpes simplex virus; BPV, bovine papilloma virus; AAV, adeno associated virus * Present address: Department of Biology, Imperial College, Prince Consort Road, London SW7 2BB, UK Department of Pharmacology and Biochemistry, University of Zurich-Irchel, Winterthurerstrasse 190, CH-8057 Zurich, Switzerland
bonds between the bases that can form pairs (A-T and G-C). D N A in this form is extremely stable to various kinds of influences, e.g. D N A damaging agents such as radiation, UV light, carcinogens, mutagens and other drugs that react more easily with single-stranded DNA. For many D N A transactions such as replication, repair, homologous recombination, site-specific recombination and transcription, the double-stranded structure has to be transiently brought into a single-stranded form. The " m o t t o " for this transient single-strandedness clearly has to be "only when absolutely required and as short as possible". Nature can perform this with a remarkable set of enzymes called D N A helicases. D N A helicases can transiently melt double-standed D N A by using the energy of ribonucleoside or deoxyribonucleoside 5'-triphosphate hydrolysis. The variety of different needs for the double-stranded D N A to be open appears to be the reason why a set of more than ten different D N A helicases has been found in a simple single cell organism like Escherichia coli (Matson 1991). For reasons discussed in the next paragraph progress in identifying D N A helicases in eukaryotes has lagged behind that in prokaryotes. The last 2 years, however, have indicated that in eukaryotic cells a similar number of enzymes can be found that can separate two D N A strands. During that period at least 15 more D N A helicases have been described from eukaryotic sources (compare Th6mmes and Hiibscher 1990a, Table 1 and this work, Table 1). This leads us to summarize the status quo of our knowledge about D N A helicases only shortly
468 after the appearance of the last compilation (Th6mmes and Hfibscher 1990 a). Not only double-stranded D N A but also R N A / D N A hybrids and double-stranded regions occurring in R N A molecules have to be melted temporarily. An example of an R N A and D N A helicase is the Dda protein from the E. coli bacteriophage T4. This helicase possesses the unique ability to push the replication fork past bound R N A polymerase molecules, whether the replication complex is colliding head-on or travelling in the same direction as the growing R N A chain (Alberts 1987). Such enzymes have been found in higher eukaryotes, for example the human p68 protein, which is an RNAdependent ATPase and R N A helicase (Iggo et al. 1991). This protein belongs to the so called D E A D - b o x proteins (Linder et al. 1989), which are ubiquitous in living organisms and are involved in many aspects of R N A metabolism, including splicing, translation and ribosome assembly. For example, R N A helicases are required for the release of m R N A from spliceosomes (Company et al. 1991). In this article we concentrate only on D N A helicases and their possible functional responsibilities in D N A transactions.
Cellular DNA helicases Several different strategies have led to the isolation o f a whole set of D N A helicases from different higher eukaryotes (Table 1). According to the assumption that " w h e n one encounters a DNA-dependent ATPase in vitro, a helicase function is a strong possibility" (Kornberg and Baker 1992) the first approaches involved the isolation of proteins with DNA-dependent ATPase activity (Hiibscher and Stalder 1985). Similarly, ATPase III from yeast (Sugino et al. 1986) and mouse ATPase B (Seki et al. 1988) were isolated and characterized as helicases. However there were several cases where DNA-dependent ATPases did not show any helicase activity or D N A helicases had only weak associated ATPase activity (P. Th6mmes, unpublished observations). A strand displacement assay first described for the characterization of the gene 4 D N A helicase of the E. coli bacteriophage T7 (Matson et al. 1983) brought rapid progress in the detection of eukaryotic and viral helicases. The substrate for this assay is a long singlestranded D N A containing a radioactively labelled double-stranded region o f varying length. For example this
A o
=.
+
Substrate
0
Displaced fragment
I J
Sma I
B " 5"-
GCCAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCCC 3"GCTGAGATCTCCTAGGGG
GGGCGAGCTCGAATTCACTC-C-CCGTCGTTTTACAACGTCGTGACTGGGAAAACCCT CCCGCTCGTGCTT.Z_AG - 5"
-
3"
3.#~->5.
> 5"-> 3"
Fig. 1A, B. DNA substrates to determine DNA helicase activity (A) and its direction of unwinding (B). A An oligonucleotide is radioactively labelled and annealed to a long single-stranded circular M 13 DNA. After the reaction the product is analysed by native polyacrylamide gel electrophoresis under conditions where the displaced fragment enters the gel, while the original substrate stays on top. Finally the gel is exposed to X-ray film. The figure shows a schematic picture of the corresponding autoradiograph. B The
oligonucleotide contains a restriction site (e.g. SmaI) that is digested. Then the resulting linear molecule can either be labelled at the 5' end (by polynucleotide kinase) or the 3' end (by Escheriehia eoli DNA polymerase I, Klenow fragment). The two substrates can then be tested side by side with the DNA helicase of choice, which will be able to displace only one of the labelled fragments according to its direction of movement
Human Hmnan, RIP 100 protein Human, helicase I Human, helicase IV
3 ' - > 5' 3 ' - > 5' 3'- > 5'
90-I 00
200, 170
130, 100
Calf thymus, copurifies with Calf thymus, nuclear D N A helicase I Calf thymus, nuclear D N A helicase II
5 ' - > 3'
5'->3' 5 ' - > 3' 5'- > 3'
58
100 40 100, 45
Calf thymus, helicase B Calf thymus, helicase C Calf thymus, helicase D
3 ' - > 5'
3'- > 5' 3'->5'
? 3 ' - > 5' 3'- > 5' 5'- > 3'
3 ' - > 5' 5'- > 3'
? 5 ' - > 3' ?
? 5'- > 3'
Calf thymus, copurifies with
47
Calf thymus, helicase A
72
? 100 65 100
Mouse, ATPase B
?
140 (75, 62) 58
Xenopus laevis
Human Human
134 97 ?
63 90
(92) 83 68 68
Yeast, Rad H Yeast, PIFI Lily
Yeast, ATPase III Yeast, Rad 3
Cell
3'- > 5' ? ?
120, 97, 70
Directionality
3'- > 5' 3 ' - > 5' 5 ' - > 3'
94 100
SV40, T-antigen Polyoma, T-antigen HSV-I, U L 5 / U L 8 / UL52 complex HSV-I, UL9 protein BPV-1, El protein AAV, Rep68 protein
Virus
Mr ( x 10 - 3)
Source
Table 1. Eukaryotic and viral D N A helicases
A = d A > all other
A=dA
A = dA
A > dA > C = U
A = d A > a l l other A = dA > > all other A = dA
A=dA>C>dC
A = dA > C > dC A=dA>C>dC
? A=dA A > dA A > dA
A=dA A > dA = d G = G
? A A
A > dA A
A = dA > C > dC ? A
A > dA > d T = U A = dA > C ~ U A>G>C=U
Nucleotide col'actor
S t a h l e t al. (1986) Seki et al. (1990) Crute et al. (1989); Calder and Stow (1990) Bruckner et al. (1991) Yang et al. (1991) Im and Muzyczka (1990)
Interacts with D N A polymerase c~
Roberts and d'Urso (/988) Dailey et al. (1990) Tuteja et al. (i990) Tuteja et al. (1991), N. Tuteja, personal communication Seo et al. (1991) S. Yoshida personal communication
Origin unwinding activity Interacts with RIP60 ori binding protein
Downey et ak (1990) Bambara and Jessee (1991) Zhang and Grosse (1991)
Strand-displacement factor for pol 6
Dependent ot2 unspecific ssb Stimulated by 150 m M NaC1
Zhang Grosse (1991)
Th6mmes et al. (1992) Th6mmes et al. (1992) Th6mmes et al. (1992)
YhSmmes et al. (1992) Binds to ds D N A Stimulated by 100 m M KC1 on short substrates Forms large aggregates in low salt
Dependent on homologous R F - A on long substrates
Dependent on RF-A, releases fully duplex D N A Resembles calf thymus heliease A
Substrate for cdc2 kinase
ThSmmes and H iibscher (1990b);
Poll and Benbow (1988) Seki et al. (1988)
Not processive
Only sequence known Single-strand dependent ATPase, mitochondrial
Sugino et al. (1986) Harosh et al. (1989), Naegeli et al. (1992) Aboussekhra et al. (1989) Lahaye et al. (1991) Hotta and Stern (1978)
Stimulates yeast pol c~ Functions in excision repair, inhibited by D N A damage
Ori binding protein Ori binding protein, which is stimulated by E2 protein site- and strand-specific endonuclease
UL5 and UL52 required for helicase-primase activity
Reference
Remarks
470
Fig. 2. DNA helicase assay can be masked by nucleasecontamination. The example given is from the purification of calf thymus DNA helicase B (Th6mmes et al. 1992). Lanes 1 and 2, DNA helicase fractions containing heavy nuclease contamination; lane 3, DNA helicasefractioncontainingslightnucleasecontamination; lanes 4 to 7, DNA helicasefractionscontainingno detectablenuclease contamination; S, substrate, no DNA helicase; SH, substrate, heated, no DNA helicase
can be achieved by hybridizing an oligonucleotide to single-stranded circular M13 DNA (Fig. 1A). While some DNA helicases are able to work on fully basepaired substrates, others like the HSV-1 helicase-primase require a certain length of an unpaired tail to start unwinding (J.J. Crute, personal communication). If the double-stranded region contains a restriction site the digested substrate can in addition be used to determine the directionality of enzyme movement (Fig. 1 B). In the presence of magnesium and a nucleoside 5'-triphosphate (usually ATP) the helicase is able to perform strand displacement. The enzyme first binds to the DNA, usually at the long single-stranded region. By translocation along this strand in one direction the enzyme displaces the complementary oligonucleotide. The direction of unwinding in relation to the strand to which the DNA helicase is bound is either 5' > 3' or 3'- > 5' (Fig. 1 B). This strand displacement assay was used to isolate a DNA helicase from Xenopus laevis (Poll and Benbow 1988), which is stimulated by salt concentrations where nucleases are inhibited. The same strategy was systematically employed for the isolation of several DNA hellcases from human cells, which so far has resulted in the characterization of the human helicases I and IV (Tuteja et al. 1990, 1991). These two enzymes differ in their molecular weight and the direction of movement. DNA helicase IV can be phosphorylated by the cdc2 protein kinase (N. Tuteja, personal communication). The major difficulty in measuring helicase activity in crude extracts of eukaryotic cells is the abundance of nucleases that destroy the labelled substrate (Fig. 2). It was found that this could be avoided if a crude calf thymus extract was prefractionated during the purification of DNA polymerases thus decreasing the presence of nucleases (Th6mmes and Hiibscher 1990b). Subsequently, several DNA helicases have been described that copurify with different DNA polymerases during the first steps of purification. For example, from a preparation of DNA polymerase 6 that was able to perform strand displacement synthesis, a DNA helicase could be separated, that confers this property to the DNA polymerase (Downey et al. 1990). Similarly DNA helicases
have been found to copurify initially with DNA polymerases c~(Th6mmes and Hfibscher 1990b) and e (Bambara and Jessee 1991). With refined isolation schemes for the simultaneous purification of calf thymus DNA polymerases c~, 6, and e (Weiser et al. 1991) four different DNA helicases, A, B, C, and D, were eventually described (Th6mmes et al. 1992). These four enzymes differ in molecular weight, DNA binding properties, nucleotide requirements, direction of movement and their response to the presence of the single-stranded DNA binding protein RF-A, which has been shown to be involved in replication, recombination and repair. By concentrating on enzymes present in the nuclear fraction of a calf thymus extract, two additional DNA helicases could be distinguished, which again are different in molecular weight and nucleotide requirements (Zhang and Grosse 1991). They seem to be different from the cytosolic enzymes mentioned above. In all at least eight different DNA helicases from calf thymus have been described so far. The interaction with the single-stranded DNA binding protein RF-A was chosen to screen for another human DNA helicase (Seo et al. 1991). This enzyme is completely dependent on this auxiliary protein for its strand displacement activity. As an alternative to the biochemical approach for isolation of DNA helicases, searches for certain cellular functions may also lead to the eventual description of DNA helicases. Two searches were aimed at the isolation of enzymes involved in the initiation of replication. First, when looking at proteins from human cell extracts binding to the dihydrofolate reductase origin of replication, a protein of Mr 100,000 called RIP100 was found to contain DNA helicase activity (Dailey et al. 1990). This interacts with another origin binding protein (RIP60) and is assumed to play a role during the initial opening of the double helix. Second, when searching for S-phase specific factors Roberts and D'Urso (1988) succeeded in the isolation of an unwinding activity that is involved in the origin specific unwinding by SV40 T-antigen (see below). In the yeast Saccharomyces cerevisiae, which can be manipulated and analysed genetically, several genes have been found to be essential for excision repair after UV irradiation. The product of the Rad3 gene has been further investigated and found to be a DNA helicase as well as a DNA-RNA helicase (Harosh et al. 1989; Bailly et al. 1991). Finally, by looking into repair processes in UV-irradiated human cells a gene encoding a putative helicase was identified (Weeda et al. 1990). The human gene called ERCC-3 was isolated and characterized by its ability to complement a type of Xeroderma pigmentosum, a severe skin disease due to a DNA repair defect. It codes for a protein of Mr 89,000, which is speculated to be a DNA helicase. Viral D N A helicases
Eukaryotic DNA viruses are popular model systems for studying the different steps of DNA replication (Chall-
471 berg and Kelly 1989; Stillman 1989). While most of the viruses are at least partly dependent on host enzymes for their DNA replication they encode parts of their replication machinery themselves. In several cases these include the DNA helicases involved in initiation and elongation. The best characterized viral DNA helicase so far is the large T-antigen of SV40. This protein has many different functions during the infection of the cell by the virus. Besides its inherent catalytic functions it has a strong influence by virtue of its interaction with various components of the host cell replication machinery. Tantigen binds specifically to and unwinds the minimal origin of replication of the SV40 genome. It has an intrinsic ATPase and DNA and RNA helicase activity (Stahl et al. 1986; Scheffner etal. 1991). The helicase moves 3'-> 5' on the DNA strand to which it is bound indicating an association with the leading strand template (Goetz et al. 1988; Wiekowski et al. 1988). By its direct interaction with the host DNA polymerase e/primase (Smale and Tjian 1986; Dornreiter et al. 1990) Tantigen is probably also involved in the elongation process during the movement of the replication fork. Polyoma large T-antigen seems to be the equivalent of the SV40 T-antigen and contains a helicase activity with comparable properties (Seki et al. 1990). In contrast to SV40, HSV-1 most likely encodes all proteins required for replication of its own DNA. This includes two proteins that show DNA helicase activity. UL9 has been identified as an origin-binding protein of Mr 83,000 with DNA helicase activity that moves 3' >5' on the DNA strand to which it is bound (Bruckner et al. 1991). Thus this protein is able to fulfil origin unwinding functions. In addition HSV-1 contains a three subunit complex of the UL5, UL8 and UL52 proteins, which has helicase and primase activity. Although in vivo the complex consists of all three tightly associated polypeptides, double infection of insect cells with recombinant baculovirus containing only UL5 and UL52 has led to the isolation of an active dimeric protein (Dodson and Lehman 1991). Sequence analysis showed a helicase motif within the UL5 coding region suggesting that the active site resides within this polypeptide (Gorbalenya et al. 1989). ATPase and GTPase activity can be found in association with the helicase activity. Recently it has been shown that there are two different sites responsible for either the hydrolysis of ATP or that of ATP and GTP (Crute et al. 1991). The UL52 protein is assumed to mediate the interaction between the enzyme and the DNA. It binds radiolabelled Zn 2 § Ni 2 § and Cd 2§ which was predicted by the conserved "zincfinger" motif in the sequence of its gene (J.J. Crute, personal communication). In conclusion, it appears that the helicase functions of SV40 T-antigen during initiation and elongation of DNA replication are shared in HSV1 by the UL9 origin binding protein and the helicase-primase complex. Like the viruses discussed above BPV-1 also encodes an origin binding protein with putative DNA helicase activity (Yang et al. 1991). The E1 protein binds to the origin of replication and is stimulated to activate replication by the transcription factor E2.
What do we know about the physiological functions of eukaryotic DNA helicases? In fact very little is known about the in vivo roles of the 27 different DNA helicases described in Table 1. Since in viral model systems the functions of the genes can be studied, we have some idea of the in vivo functions of viral DNA helicases. The SV40 T-antigen helicase is the best characterized example (reviewed in Borowiec et al. 1990). The T-antigen binds to the core origin of replication (site II) in the presence of ATP and induces local unwinding in its vicinity (e.g. at the early palindromic element). The T-antigen oligomerizes in the presence of ATP to two hexamers. DNA unwinding now starts in the presence of ATP and RF-A. The dodecamer appears to be the active DNA helicase at the origin. The DNA is threaded through the dodecamer complex with extrusion of single-stranded loops permitting bidirectional unwinding from the origin (Wessel et al. 1992). The genes coding for the UL9 and UL5/UL8/UL52 DNA helicase of HSV-1 belong to a set of genes that are essential for DNA replication. The two helicases are assumed to act in a sequential fashion. First two UL9 DNA helicase dimer molecules bind to two sites at the origin of replication, dimerize again to a tetramer and thus loop the A-T rich region independently of the DNA topology. This looping distorts the A-T rich region, thus allowing the assembly of a replication initiation complex to occur (Koff et al. 1991, see Fig. 6 therein as a model). At the active replication fork another DNA helicase is required. In HSV-I this enzyme exists as a heterotrimeric protein (UL5, UL8 and UL52) that has the two enzymatic activities of primase and helicase. The interesting notion is that the respective single subunits have neither primase nor helicase activities. A heterodimer at least of UL5 and UL52 has to be formed in order for the enzyme to be active as helicase and primase (Calder and Stow 1991 ; Dodson and Lehman 1991). While in SV40 we find an origin unwinding and a replicative DNA helicase activity in one molecule these tasks are shared between two proteins in HSV-1. However, in this case the elongating helicase is associated with primase activity, which is on a separate molecule (probably the DNA polymerase e/primase complex of the host cell) in SV40. The Rad3 protein of S. cerevisiae is an enzyme with likely function in excision repair (Harosh et al. 1989). UV irradiation damage appears to block the translocation of Rad3 helicase through the lesion resulting in the formation of a stable Rad3 protein-UV irradiated DNA complex (Naegeli et al. 1992), thus providing a potential mechanism for damage screening and recognition. In contrast to viral and yeast systems it is more difficult to assess the importance of enzymes isolated from higher eukaryotes owing to the lack of genetics. In the case of the ERCC-3 gene, the way it was identified suggests a function for the protein during UV repair processes. Similarly, the RIP100 protein from Hela cells was found to interact with the RIP60 protein, an origin dependent DNA binding activity suggesting an important role in initiation of DNA replication (Dailey et al. 1990). It is even more difficult to speculate on the possible
472 functions of the various D N A helicases from the biochemical data. For example, D N A helicase A f r o m calf thymus (Th6mmes and Htibscher 1990b) as well as the R F - A dependent D N A helicase f r o m h u m a n cells (Seo et al. 1991) are stimulated by R F - A to unwind long stretches of D N A . In the case of the calf thymus enzyme this stimulation is only evident with h o m o l o g o u s R F - A but not with the corresponding proteins f r o m prokaryotes and h u m a n (Th6mmes et al. 1992). However, although R F - A was originally found to be an essential auxiliary protein during the replication of SV40 D N A it was subsequently also found to play a role during recombination and repair processes so that both helicases could still be involved in either function. D N A helicase B f r o m calf thymus (Th6mmes et al. 1992) shows as a distinctive feature the ability to bind to double-stranded D N A , which would make it a possible candidate for an origin unwinding D N A helicase.
Perspectives As in E. coli, D N A helicases are now being identified in eukaryotes in increasing number. Their biochemical properties suggest roles in D N A metabolism. However, we must k n o w the corresponding genes in order to learn: (i) how they are organized, (ii) whether they are essential for the viability of the cell, (iii) whether they are regulated t h r o u g h o u t the cell cycle, and (iv) whether they are induced u p o n stimulation of D N A repair. Much of our future knowledge about the possible functions of D N A helicases will also depend on in vitro systems. The current model systems for D N A replication like SV40, BPV-1, A A V and HSV-1 are not necessarily sufficient to understand the functional mechanisms of cellular D N A helicases. These systems encode at least one of their replicative D N A helicases, which m a y have to fulfil a different function f r o m any cellular D N A helicase. In addition the basic components of the replication machinery are now k n o w n and purified f r o m various tissues. They include D N A polymerases e, 6, and e and their auxiliary proteins replication factor A, replication factor C and proliferating cell nuclear antigen (reviewed in T h 6 m m e s and Hfibscher 1990c). Artificial replication forks might provide information a b o u t the possible interaction of D N A helicases with other components of the replication machinery. In vitro systems might also be useful to elucidate the involvement of certain D N A helicases in repair processes (see e.g. Hansson et al. 1991 and citations therein). As mentioned above a D N A helicase is p r o b a b l y involved in the complementation of a repair defect in X e r o d e r m a pigmentosum cells (Tanaka et al. 1990). Similarly, other repair deficiencies might be complemented by D N A helicases. The third process, in which D N A helicases are m o s t likely to be involved is D N A recombination. Recently an in vitro recombination system has been developed (Jessberger and Berg 1991), which might be useful in testing the participation of the various D N A helicases during this process.
It has become increasingly clear that the basic processes of D N A metabolism are extremely conserved in eukaryotes f r o m yeast to mammals. The combination of genetics in the yeasts S. cerevisiae and Schizosaccharomyces pombe together with in vitro systems and biochemical characterization will help to clarify the in vivo roles of the various D N A helicases.
Acknowledgements. Work carried out in the authors' laboratory has been supported by the Swiss National Science Foundation (Grant 31.28592.90), by the Bonizzi-Theler Stiftung and by the Kanton of Ziirich. We thank Bettina Strack and Thomas Pauls for critically reading the manuscript.
References Aboussekhra A, Chanet R, Zgaga Z, Cassier-Chauvat C, Heude M, Fabre F (1989) RAD H, a gene of Saccharomyces cerevisiae encoding a putative helicase involved in DNA repair. Characteristics of rad H mutants and sequence of the gene. Nucleic Acids Res 17: 7211-7219 Alberts BM (1987) Prokaryotic DNA replication mechanisms. Philos Trans R Soc Lond [Biol] 317:395-420 Bailly V, Sung P, Prakash L, Prakash S (1991) DNA/RNA helicase activity of RAD3 protein of Saccharomyces cerevisiae. Proc Natl Acad Sci USA 88:9212-9216 Bambara RA, Jessee CB (1991) Properties of DNA polymerases 6 and e, and their roles in eukaryotic DNA replication. Biochim Biophys Acta 1088:11-24 Borowiec JA, Dean FB, Bullock PA, Hurwitz J (1990) Binding and unwinding - how T antigen engages the SV40 origin of DNA replication. Cell 60:181-184 Bruckner RC, Crute JJ, Dodson MS, Lehman IR (1991) The herpes simplex virus 1 origin binding protein: a DNA helicase. J Biol Chem 266: 2669-2674 Calder JM, Stow ND (1990) Herpes simplex virus helicase-primase: the UL8 protein is not required for DNA-dependent ATPase and DNA helicase activities. Nucleic Acids Res 18:3573-3578 Challberg MD, Kelly TJ (1989) Animal virus DNA replication. Annu Rev Biochem 58 : 671-717 Company M, Arenas J, Abelson J (1991) Requirement of the RNA helicase-like protein PRP22 for release of messenger RNA from spliceosomes. Nature 349:487-493 Crute JJ, Tsurumi T, Zhu L, Weller SK, Olivo PD, Challberg MD, Mocarski ES, Lehman IR (1989) Herpes simplex virus-I helicase-primase: A complex of three herpes-encoded gene products. Proc Natl Acad Sci USA 86: 2186-2189 Crute JJ, Bruckner RC, Dodson MS, Lehman IR (1991) Herpes simplex-1 helicase-primase : identification of two nucleoside triphosphatase sites that promote DNA helicase action. J Biol Chem 266:21252-21256 Dailey L, Caddle MS, Heintz N, Heintz NH (1990) Purification of RIP60 and RIP100, mammalian proteins with origin-specific DNA-binding and ATP-dependent DNA helicase activities. Mol Cell Biol 10:6225-6235 Dodson MS, Lehman IR (1991) Association of DNA helicase and primase activities with a subassembly of the herpes simplex virus 1 helicase-primase composed of the UL5 and UL52 gene products. Proc Natl Acad Sci USA 88 : 1105-1109 Dornreiter I, H6ss A, Arthur AK, Fanning E (1990) SV40 T antigen binds directly to the large subunit of purified DNA polymerase alpha. EMBO J 9:3329-3336 Downey KM, Andrews DM, Li X, Castillo C, Tan CK, So AG (1990) Effects of accessory proteins on the functional properties of DNA polymerase delta. In: Richardson CC, Lehman IR (eds) Molecular mechanisms of DNA replication and recombination. (UCLA symposium on molecular and cellular biology, new series, vol 127). Liss, New York, pp 141-152
473 Goetz GS, Dean FB, Hurwitz J, Matson SW (1988) The unwinding of duplex regions in DNA by the simian virus 40 large tumor antigen-associated DNA helicase activity. J Biol Chem 263 : 383 392 Gorbalenya AE, Koonin EV, Donchenko AP, Blinov VM (1989) A conserved NTP-motif in putative helicases. Nature 333: 22 Hansson J, Keyse SM, Lindahl T, Wood RD (1991) DNA excision repair in cell extracts from human cells exhibiting hypersensitivity to DNA damaging agents. Cancer Res 51 : 3384-3390 Harosh I, Naumovski L, Friedberg EC (1989) Purification and characterization of Rad3 ATPase/DNA helicase from Saccharomyces cerevisiae. J Biol Chem 264:2053~20539 Hotta Y, Stern H (1978) DNA unwinding protein from meiotic protein from Lilium. Biochemistry 17:1872-1880 Hfibscher U, Stalder HP (1985) Mammalian DNA helicase. Nucleic Acids Res 13 : 5471-5483 Iggo RD, Jamieson DJ, MacNeill SA, Southgate J, McPheat J, Lane DP (1991) p68 RNA helicase: Identification of a nucleolar form and cloning of related genes containing a conserved intron in yeast. Mol Cell Biol 11:1326-1333 Im D-S, Muzyczka N (1990) The AAV origin binding protein Rep68 is an ATP-dependent site-specific endonuclease with DNA helicase activity. Cell 61:447-457 Jessberger R, Berg P (1991) Repair of deletions and double-strand gaps by homologous recombination in a mammalian in vitro system. Mol Cell Biol 11 :445-457 Koff A, Schwedes JF, Tegtmeyer P (1991) Herpes simplex virus origin-binding protein (UL9) loops and distorts the viral replication origin. J Virol 65:3284-3292 Kornberg A, Baker TA (1992) DNA replication. W.H. Freeman, New York Lahaye A, Stahl H, Thines-Sempoux D, Foury F (1991) PIFI: a DNA helicase in yeast mitochondria. EMBO J 10:997-1007 Linder P, Lasko PF, Ashburner M, Leroy P, Nielsen P J, Nishi K, Schnier J, Slonimski PP (1989) Birth of the DEAD box. Nature 337:121-122 Matson SW (1991) DNA helicases of Escherichia coli. Prog Nucleic Acid Res Mol Biol 40 :282-326 Matson SW, Tabor S, Richardson CC (1983) The gene 4 protein of bacteriophage T7. Characterization of helicase activity. J Biol Chem 258:14017-14024 Naegeli H, Bardwell L, Friedberg EC (1992) The DNA helicase and adenosine triphosphatase activities of yeast Rad3 protein are inhibited by DNA damage. A potential mechanism for damage-specific recognition. J Biol Chem 267:392-398 Poll EHA, Benbow RM (1988) A DNA helicase from Xenopus laevis ovaries. Biochemistry 27 : 8701-8706 Roberts JM, D'Urso G (1988) An origin unwinding activity regulates initiation of DNA replication during mammalian cell cycle. Science 241 : 1486-1489 Scheffner M, Knippers R, Stahl H (1991) Simian virus 40 large T antigen catalyzed DNA and RNA unwinding reactions. Eur J Biochem 195:49-54 Seki M, Enomoto T, Yanagisawa J, Hanaoka F, Ui M (1988) Further characterization of DNA helicase activity of mouse DNA-dependent adenosinetriphosphatase B (DNA helicase B). Biochemistry 27 : 1766-1771 Seki M, Enomoto T, Eki T, Miyajima A, Murakami Y, Hanaoka F, Ui M (1990) DNA helicase and nucleoside-5'-triphosphatase activities of polyoma virus large tumor antigen. Biochemistry 29:1003-1009
Seo Y-S, Lee S-H, Hurwitz J (1991) Isolation of a DNA helicase from HeLa cells requiring the multisubunit human singlestranded DNA-binding protein for activity. J Biol Chem 266:13161-13170 Smale ST, Tjian R (1986) T-antigen-DNA polymerase c~complex implicated in simian virus 40 DNA replication. Mol Cell Biol 6:4077-4087 Stahl H, Dr6ge P, Knippers R (1986) DNA helicase activity of SV40 large tumor antigen. EMBO J 5:1939-1944 Stillman B (1989) Initiation of eukaryotic DNA replication in vitro. Annu Rev Cell Biol 5:197-245 Sugino A, Ryu BH, Sugino T, Naumovski L, Friedberg EC (1986) A new DNA-dependent ATPase which stimulates yeast DNA polymerase I and has DNA-unwinding activity. J Biol Chem 261 : 1t744-11750 Tanaka K, Miura N, Satokata I, Miyamoto K, Yoshida MC, Satoh Y, Kondo S, Yasui A, Okayama H, Okada Y (1990) Analysis of a human DNA excision repair gene involved in group A Xeroderma pigmentosum and containing a zinc-finger domain. Nature 348 : 73-76 Th6mmes P, Hiibscher U (1990a) Eukaryotic DNA helicases. FEBS Lett 268 : 325-328 Th6mmes P, Hfibscher U (1990 b) DNA helicase from calf thymus. Purification to apparent homogeneity and biochemical characterization of the enzyme. J Biol Chem 265:14347-14354 Th6mmes P, Hiibscher U (1990c) Eukaryotic DNA replication. Enzymes and proteins acting at the fork. Eur J Biochem 194:699-712 Th6mmes P, Ferrari E, Jessberger R, Hiibscher U (1992) Four different DNA helicases from calf thymus. J Biol Chem 267:6063-6073 Tuteja N, Tuteja R, Rahman K, Kang LY, Falaschi A (1990) A DNA helicase from human cells. Nucleic Acids Res 18:67856792 Tuteja N, Rahman K, Tuteja R, Falaschi A (1991) DNA helicase IV from HeLa cells. Nucleic Acids Res 19:3613-3618 Weeda G, van Ham HRC, Vermeulen W, Bootsma D, van der Eb AJ, Hoeijmakers JH (1990) A presumed DNA helicase encoded by ERCC-3 is involved in the human repair disorders Xeroderma pigmentosum and Cockayne's syndrome. Cell 62 : 777-791 Weiser T, Gassmann M, Th6mmes P, Ferrari E, Hafkemeyer P, Hfibscher U (1991) Biochemical and functional characterization of DNA polymerases a, 6 and ~ from calf thymus. J Biol Chem 266:10420-10428 Wessel R, Schweizer J, Stahl H (1992) Simian virus 40 T-antigen DNA helicase is a hexamer which forms a binary complex during bidirectional unwinding from the viral origin of replication. J Virol 66:804-815 Wiekowski M, Schwarz MW, Stahl H (1988) Simian virus 40 large T-antigen DNA helicase. Characterization of the ATPase-dependent DNA unwinding activity and its substrate requirements. J Biol Chem 263:436-442 Yang L, Li R, Mohr IJ, Clark R, Botchan MR (1991) Activation of BPV-1 replication in vitro by the transcription factor E2. Nature 353 : 628-632 Zhang S, Grosse F (1991) Purification and characterization of two DNA helicases from calf thymus nuclei. J Biol Chem 266: 20483-20490
CHROMOSOMA 9 Springer-Verlag1992
Chromosoma Focus
Review: Eukaryotic DNA helicases: Essential enzymes for DNA transactions Pia Th6mmes* and Ulrich Hiibscher
D N A in its double-stranded form is energetically favoured and therefore very stable. However, D N A is involved in metabolic events and thus has a continuous dynamic. Processes such as D N A replication, D N A repair, D N A recombination and transcription require that D N A occurs transiently in a single-stranded form. This status can be achieved by enzymes called D N A helicases. These enzymes have the power to melt the hydrogen bonds between the base pairs by using nucleoside 5'-triphosphate hydrolysis as an energy source. A variety of different D N A helicases have recently been identified from eukaryotic viruses and cells. We focus on the current knowledge of these D N A helicases and their possible function in D N A transactions.
The extremely stable D N A molecule requires remarkable enzymes to open the double helix: D N A helicases DNA, the genetic material of many forms of life, generally occurs in a double-stranded form. The antiparallel strands of the double helix are held together by hydrogen Abbreviations." RF-A, replication factor A; SV40, simian virus 40; HSV, herpes simplex virus; BPV, bovine papilloma virus; AAV, adeno associated virus * Present address: Department of Biology, Imperial College, Prince Consort Road, London SW7 2BB, UK Department of Pharmacology and Biochemistry, University of Zurich-Irchel, Winterthurerstrasse 190, CH-8057 Zurich, Switzerland
bonds between the bases that can form pairs (A-T and G-C). D N A in this form is extremely stable to various kinds of influences, e.g. D N A damaging agents such as radiation, UV light, carcinogens, mutagens and other drugs that react more easily with single-stranded DNA. For many D N A transactions such as replication, repair, homologous recombination, site-specific recombination and transcription, the double-stranded structure has to be transiently brought into a single-stranded form. The " m o t t o " for this transient single-strandedness clearly has to be "only when absolutely required and as short as possible". Nature can perform this with a remarkable set of enzymes called D N A helicases. D N A helicases can transiently melt double-standed D N A by using the energy of ribonucleoside or deoxyribonucleoside 5'-triphosphate hydrolysis. The variety of different needs for the double-stranded D N A to be open appears to be the reason why a set of more than ten different D N A helicases has been found in a simple single cell organism like Escherichia coli (Matson 1991). For reasons discussed in the next paragraph progress in identifying D N A helicases in eukaryotes has lagged behind that in prokaryotes. The last 2 years, however, have indicated that in eukaryotic cells a similar number of enzymes can be found that can separate two D N A strands. During that period at least 15 more D N A helicases have been described from eukaryotic sources (compare Th6mmes and Hiibscher 1990a, Table 1 and this work, Table 1). This leads us to summarize the status quo of our knowledge about D N A helicases only shortly
468 after the appearance of the last compilation (Th6mmes and Hfibscher 1990 a). Not only double-stranded D N A but also R N A / D N A hybrids and double-stranded regions occurring in R N A molecules have to be melted temporarily. An example of an R N A and D N A helicase is the Dda protein from the E. coli bacteriophage T4. This helicase possesses the unique ability to push the replication fork past bound R N A polymerase molecules, whether the replication complex is colliding head-on or travelling in the same direction as the growing R N A chain (Alberts 1987). Such enzymes have been found in higher eukaryotes, for example the human p68 protein, which is an RNAdependent ATPase and R N A helicase (Iggo et al. 1991). This protein belongs to the so called D E A D - b o x proteins (Linder et al. 1989), which are ubiquitous in living organisms and are involved in many aspects of R N A metabolism, including splicing, translation and ribosome assembly. For example, R N A helicases are required for the release of m R N A from spliceosomes (Company et al. 1991). In this article we concentrate only on D N A helicases and their possible functional responsibilities in D N A transactions.
Cellular DNA helicases Several different strategies have led to the isolation o f a whole set of D N A helicases from different higher eukaryotes (Table 1). According to the assumption that " w h e n one encounters a DNA-dependent ATPase in vitro, a helicase function is a strong possibility" (Kornberg and Baker 1992) the first approaches involved the isolation of proteins with DNA-dependent ATPase activity (Hiibscher and Stalder 1985). Similarly, ATPase III from yeast (Sugino et al. 1986) and mouse ATPase B (Seki et al. 1988) were isolated and characterized as helicases. However there were several cases where DNA-dependent ATPases did not show any helicase activity or D N A helicases had only weak associated ATPase activity (P. Th6mmes, unpublished observations). A strand displacement assay first described for the characterization of the gene 4 D N A helicase of the E. coli bacteriophage T7 (Matson et al. 1983) brought rapid progress in the detection of eukaryotic and viral helicases. The substrate for this assay is a long singlestranded D N A containing a radioactively labelled double-stranded region o f varying length. For example this
A o
=.
+
Substrate
0
Displaced fragment
I J
Sma I
B " 5"-
GCCAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCCC 3"GCTGAGATCTCCTAGGGG
GGGCGAGCTCGAATTCACTC-C-CCGTCGTTTTACAACGTCGTGACTGGGAAAACCCT CCCGCTCGTGCTT.Z_AG - 5"
-
3"
3.#~->5.
> 5"-> 3"
Fig. 1A, B. DNA substrates to determine DNA helicase activity (A) and its direction of unwinding (B). A An oligonucleotide is radioactively labelled and annealed to a long single-stranded circular M 13 DNA. After the reaction the product is analysed by native polyacrylamide gel electrophoresis under conditions where the displaced fragment enters the gel, while the original substrate stays on top. Finally the gel is exposed to X-ray film. The figure shows a schematic picture of the corresponding autoradiograph. B The
oligonucleotide contains a restriction site (e.g. SmaI) that is digested. Then the resulting linear molecule can either be labelled at the 5' end (by polynucleotide kinase) or the 3' end (by Escheriehia eoli DNA polymerase I, Klenow fragment). The two substrates can then be tested side by side with the DNA helicase of choice, which will be able to displace only one of the labelled fragments according to its direction of movement
Human Hmnan, RIP 100 protein Human, helicase I Human, helicase IV
3 ' - > 5' 3 ' - > 5' 3'- > 5'
90-I 00
200, 170
130, 100
Calf thymus, copurifies with Calf thymus, nuclear D N A helicase I Calf thymus, nuclear D N A helicase II
5 ' - > 3'
5'->3' 5 ' - > 3' 5'- > 3'
58
100 40 100, 45
Calf thymus, helicase B Calf thymus, helicase C Calf thymus, helicase D
3 ' - > 5'
3'- > 5' 3'->5'
? 3 ' - > 5' 3'- > 5' 5'- > 3'
3 ' - > 5' 5'- > 3'
? 5 ' - > 3' ?
? 5'- > 3'
Calf thymus, copurifies with
47
Calf thymus, helicase A
72
? 100 65 100
Mouse, ATPase B
?
140 (75, 62) 58
Xenopus laevis
Human Human
134 97 ?
63 90
(92) 83 68 68
Yeast, Rad H Yeast, PIFI Lily
Yeast, ATPase III Yeast, Rad 3
Cell
3'- > 5' ? ?
120, 97, 70
Directionality
3'- > 5' 3 ' - > 5' 5 ' - > 3'
94 100
SV40, T-antigen Polyoma, T-antigen HSV-I, U L 5 / U L 8 / UL52 complex HSV-I, UL9 protein BPV-1, El protein AAV, Rep68 protein
Virus
Mr ( x 10 - 3)
Source
Table 1. Eukaryotic and viral D N A helicases
A = d A > all other
A=dA
A = dA
A > dA > C = U
A = d A > a l l other A = dA > > all other A = dA
A=dA>C>dC
A = dA > C > dC A=dA>C>dC
? A=dA A > dA A > dA
A=dA A > dA = d G = G
? A A
A > dA A
A = dA > C > dC ? A
A > dA > d T = U A = dA > C ~ U A>G>C=U
Nucleotide col'actor
S t a h l e t al. (1986) Seki et al. (1990) Crute et al. (1989); Calder and Stow (1990) Bruckner et al. (1991) Yang et al. (1991) Im and Muzyczka (1990)
Interacts with D N A polymerase c~
Roberts and d'Urso (/988) Dailey et al. (1990) Tuteja et al. (i990) Tuteja et al. (1991), N. Tuteja, personal communication Seo et al. (1991) S. Yoshida personal communication
Origin unwinding activity Interacts with RIP60 ori binding protein
Downey et ak (1990) Bambara and Jessee (1991) Zhang and Grosse (1991)
Strand-displacement factor for pol 6
Dependent ot2 unspecific ssb Stimulated by 150 m M NaC1
Zhang Grosse (1991)
Th6mmes et al. (1992) Th6mmes et al. (1992) Th6mmes et al. (1992)
YhSmmes et al. (1992) Binds to ds D N A Stimulated by 100 m M KC1 on short substrates Forms large aggregates in low salt
Dependent on homologous R F - A on long substrates
Dependent on RF-A, releases fully duplex D N A Resembles calf thymus heliease A
Substrate for cdc2 kinase
ThSmmes and H iibscher (1990b);
Poll and Benbow (1988) Seki et al. (1988)
Not processive
Only sequence known Single-strand dependent ATPase, mitochondrial
Sugino et al. (1986) Harosh et al. (1989), Naegeli et al. (1992) Aboussekhra et al. (1989) Lahaye et al. (1991) Hotta and Stern (1978)
Stimulates yeast pol c~ Functions in excision repair, inhibited by D N A damage
Ori binding protein Ori binding protein, which is stimulated by E2 protein site- and strand-specific endonuclease
UL5 and UL52 required for helicase-primase activity
Reference
Remarks
470
Fig. 2. DNA helicase assay can be masked by nucleasecontamination. The example given is from the purification of calf thymus DNA helicase B (Th6mmes et al. 1992). Lanes 1 and 2, DNA helicase fractions containing heavy nuclease contamination; lane 3, DNA helicasefractioncontainingslightnucleasecontamination; lanes 4 to 7, DNA helicasefractionscontainingno detectablenuclease contamination; S, substrate, no DNA helicase; SH, substrate, heated, no DNA helicase
can be achieved by hybridizing an oligonucleotide to single-stranded circular M13 DNA (Fig. 1A). While some DNA helicases are able to work on fully basepaired substrates, others like the HSV-1 helicase-primase require a certain length of an unpaired tail to start unwinding (J.J. Crute, personal communication). If the double-stranded region contains a restriction site the digested substrate can in addition be used to determine the directionality of enzyme movement (Fig. 1 B). In the presence of magnesium and a nucleoside 5'-triphosphate (usually ATP) the helicase is able to perform strand displacement. The enzyme first binds to the DNA, usually at the long single-stranded region. By translocation along this strand in one direction the enzyme displaces the complementary oligonucleotide. The direction of unwinding in relation to the strand to which the DNA helicase is bound is either 5' > 3' or 3'- > 5' (Fig. 1 B). This strand displacement assay was used to isolate a DNA helicase from Xenopus laevis (Poll and Benbow 1988), which is stimulated by salt concentrations where nucleases are inhibited. The same strategy was systematically employed for the isolation of several DNA hellcases from human cells, which so far has resulted in the characterization of the human helicases I and IV (Tuteja et al. 1990, 1991). These two enzymes differ in their molecular weight and the direction of movement. DNA helicase IV can be phosphorylated by the cdc2 protein kinase (N. Tuteja, personal communication). The major difficulty in measuring helicase activity in crude extracts of eukaryotic cells is the abundance of nucleases that destroy the labelled substrate (Fig. 2). It was found that this could be avoided if a crude calf thymus extract was prefractionated during the purification of DNA polymerases thus decreasing the presence of nucleases (Th6mmes and Hiibscher 1990b). Subsequently, several DNA helicases have been described that copurify with different DNA polymerases during the first steps of purification. For example, from a preparation of DNA polymerase 6 that was able to perform strand displacement synthesis, a DNA helicase could be separated, that confers this property to the DNA polymerase (Downey et al. 1990). Similarly DNA helicases
have been found to copurify initially with DNA polymerases c~(Th6mmes and Hfibscher 1990b) and e (Bambara and Jessee 1991). With refined isolation schemes for the simultaneous purification of calf thymus DNA polymerases c~, 6, and e (Weiser et al. 1991) four different DNA helicases, A, B, C, and D, were eventually described (Th6mmes et al. 1992). These four enzymes differ in molecular weight, DNA binding properties, nucleotide requirements, direction of movement and their response to the presence of the single-stranded DNA binding protein RF-A, which has been shown to be involved in replication, recombination and repair. By concentrating on enzymes present in the nuclear fraction of a calf thymus extract, two additional DNA helicases could be distinguished, which again are different in molecular weight and nucleotide requirements (Zhang and Grosse 1991). They seem to be different from the cytosolic enzymes mentioned above. In all at least eight different DNA helicases from calf thymus have been described so far. The interaction with the single-stranded DNA binding protein RF-A was chosen to screen for another human DNA helicase (Seo et al. 1991). This enzyme is completely dependent on this auxiliary protein for its strand displacement activity. As an alternative to the biochemical approach for isolation of DNA helicases, searches for certain cellular functions may also lead to the eventual description of DNA helicases. Two searches were aimed at the isolation of enzymes involved in the initiation of replication. First, when looking at proteins from human cell extracts binding to the dihydrofolate reductase origin of replication, a protein of Mr 100,000 called RIP100 was found to contain DNA helicase activity (Dailey et al. 1990). This interacts with another origin binding protein (RIP60) and is assumed to play a role during the initial opening of the double helix. Second, when searching for S-phase specific factors Roberts and D'Urso (1988) succeeded in the isolation of an unwinding activity that is involved in the origin specific unwinding by SV40 T-antigen (see below). In the yeast Saccharomyces cerevisiae, which can be manipulated and analysed genetically, several genes have been found to be essential for excision repair after UV irradiation. The product of the Rad3 gene has been further investigated and found to be a DNA helicase as well as a DNA-RNA helicase (Harosh et al. 1989; Bailly et al. 1991). Finally, by looking into repair processes in UV-irradiated human cells a gene encoding a putative helicase was identified (Weeda et al. 1990). The human gene called ERCC-3 was isolated and characterized by its ability to complement a type of Xeroderma pigmentosum, a severe skin disease due to a DNA repair defect. It codes for a protein of Mr 89,000, which is speculated to be a DNA helicase. Viral D N A helicases
Eukaryotic DNA viruses are popular model systems for studying the different steps of DNA replication (Chall-
471 berg and Kelly 1989; Stillman 1989). While most of the viruses are at least partly dependent on host enzymes for their DNA replication they encode parts of their replication machinery themselves. In several cases these include the DNA helicases involved in initiation and elongation. The best characterized viral DNA helicase so far is the large T-antigen of SV40. This protein has many different functions during the infection of the cell by the virus. Besides its inherent catalytic functions it has a strong influence by virtue of its interaction with various components of the host cell replication machinery. Tantigen binds specifically to and unwinds the minimal origin of replication of the SV40 genome. It has an intrinsic ATPase and DNA and RNA helicase activity (Stahl et al. 1986; Scheffner etal. 1991). The helicase moves 3'-> 5' on the DNA strand to which it is bound indicating an association with the leading strand template (Goetz et al. 1988; Wiekowski et al. 1988). By its direct interaction with the host DNA polymerase e/primase (Smale and Tjian 1986; Dornreiter et al. 1990) Tantigen is probably also involved in the elongation process during the movement of the replication fork. Polyoma large T-antigen seems to be the equivalent of the SV40 T-antigen and contains a helicase activity with comparable properties (Seki et al. 1990). In contrast to SV40, HSV-1 most likely encodes all proteins required for replication of its own DNA. This includes two proteins that show DNA helicase activity. UL9 has been identified as an origin-binding protein of Mr 83,000 with DNA helicase activity that moves 3' >5' on the DNA strand to which it is bound (Bruckner et al. 1991). Thus this protein is able to fulfil origin unwinding functions. In addition HSV-1 contains a three subunit complex of the UL5, UL8 and UL52 proteins, which has helicase and primase activity. Although in vivo the complex consists of all three tightly associated polypeptides, double infection of insect cells with recombinant baculovirus containing only UL5 and UL52 has led to the isolation of an active dimeric protein (Dodson and Lehman 1991). Sequence analysis showed a helicase motif within the UL5 coding region suggesting that the active site resides within this polypeptide (Gorbalenya et al. 1989). ATPase and GTPase activity can be found in association with the helicase activity. Recently it has been shown that there are two different sites responsible for either the hydrolysis of ATP or that of ATP and GTP (Crute et al. 1991). The UL52 protein is assumed to mediate the interaction between the enzyme and the DNA. It binds radiolabelled Zn 2 § Ni 2 § and Cd 2§ which was predicted by the conserved "zincfinger" motif in the sequence of its gene (J.J. Crute, personal communication). In conclusion, it appears that the helicase functions of SV40 T-antigen during initiation and elongation of DNA replication are shared in HSV1 by the UL9 origin binding protein and the helicase-primase complex. Like the viruses discussed above BPV-1 also encodes an origin binding protein with putative DNA helicase activity (Yang et al. 1991). The E1 protein binds to the origin of replication and is stimulated to activate replication by the transcription factor E2.
What do we know about the physiological functions of eukaryotic DNA helicases? In fact very little is known about the in vivo roles of the 27 different DNA helicases described in Table 1. Since in viral model systems the functions of the genes can be studied, we have some idea of the in vivo functions of viral DNA helicases. The SV40 T-antigen helicase is the best characterized example (reviewed in Borowiec et al. 1990). The T-antigen binds to the core origin of replication (site II) in the presence of ATP and induces local unwinding in its vicinity (e.g. at the early palindromic element). The T-antigen oligomerizes in the presence of ATP to two hexamers. DNA unwinding now starts in the presence of ATP and RF-A. The dodecamer appears to be the active DNA helicase at the origin. The DNA is threaded through the dodecamer complex with extrusion of single-stranded loops permitting bidirectional unwinding from the origin (Wessel et al. 1992). The genes coding for the UL9 and UL5/UL8/UL52 DNA helicase of HSV-1 belong to a set of genes that are essential for DNA replication. The two helicases are assumed to act in a sequential fashion. First two UL9 DNA helicase dimer molecules bind to two sites at the origin of replication, dimerize again to a tetramer and thus loop the A-T rich region independently of the DNA topology. This looping distorts the A-T rich region, thus allowing the assembly of a replication initiation complex to occur (Koff et al. 1991, see Fig. 6 therein as a model). At the active replication fork another DNA helicase is required. In HSV-I this enzyme exists as a heterotrimeric protein (UL5, UL8 and UL52) that has the two enzymatic activities of primase and helicase. The interesting notion is that the respective single subunits have neither primase nor helicase activities. A heterodimer at least of UL5 and UL52 has to be formed in order for the enzyme to be active as helicase and primase (Calder and Stow 1991 ; Dodson and Lehman 1991). While in SV40 we find an origin unwinding and a replicative DNA helicase activity in one molecule these tasks are shared between two proteins in HSV-1. However, in this case the elongating helicase is associated with primase activity, which is on a separate molecule (probably the DNA polymerase e/primase complex of the host cell) in SV40. The Rad3 protein of S. cerevisiae is an enzyme with likely function in excision repair (Harosh et al. 1989). UV irradiation damage appears to block the translocation of Rad3 helicase through the lesion resulting in the formation of a stable Rad3 protein-UV irradiated DNA complex (Naegeli et al. 1992), thus providing a potential mechanism for damage screening and recognition. In contrast to viral and yeast systems it is more difficult to assess the importance of enzymes isolated from higher eukaryotes owing to the lack of genetics. In the case of the ERCC-3 gene, the way it was identified suggests a function for the protein during UV repair processes. Similarly, the RIP100 protein from Hela cells was found to interact with the RIP60 protein, an origin dependent DNA binding activity suggesting an important role in initiation of DNA replication (Dailey et al. 1990). It is even more difficult to speculate on the possible
472 functions of the various D N A helicases from the biochemical data. For example, D N A helicase A f r o m calf thymus (Th6mmes and Htibscher 1990b) as well as the R F - A dependent D N A helicase f r o m h u m a n cells (Seo et al. 1991) are stimulated by R F - A to unwind long stretches of D N A . In the case of the calf thymus enzyme this stimulation is only evident with h o m o l o g o u s R F - A but not with the corresponding proteins f r o m prokaryotes and h u m a n (Th6mmes et al. 1992). However, although R F - A was originally found to be an essential auxiliary protein during the replication of SV40 D N A it was subsequently also found to play a role during recombination and repair processes so that both helicases could still be involved in either function. D N A helicase B f r o m calf thymus (Th6mmes et al. 1992) shows as a distinctive feature the ability to bind to double-stranded D N A , which would make it a possible candidate for an origin unwinding D N A helicase.
Perspectives As in E. coli, D N A helicases are now being identified in eukaryotes in increasing number. Their biochemical properties suggest roles in D N A metabolism. However, we must k n o w the corresponding genes in order to learn: (i) how they are organized, (ii) whether they are essential for the viability of the cell, (iii) whether they are regulated t h r o u g h o u t the cell cycle, and (iv) whether they are induced u p o n stimulation of D N A repair. Much of our future knowledge about the possible functions of D N A helicases will also depend on in vitro systems. The current model systems for D N A replication like SV40, BPV-1, A A V and HSV-1 are not necessarily sufficient to understand the functional mechanisms of cellular D N A helicases. These systems encode at least one of their replicative D N A helicases, which m a y have to fulfil a different function f r o m any cellular D N A helicase. In addition the basic components of the replication machinery are now k n o w n and purified f r o m various tissues. They include D N A polymerases e, 6, and e and their auxiliary proteins replication factor A, replication factor C and proliferating cell nuclear antigen (reviewed in T h 6 m m e s and Hfibscher 1990c). Artificial replication forks might provide information a b o u t the possible interaction of D N A helicases with other components of the replication machinery. In vitro systems might also be useful to elucidate the involvement of certain D N A helicases in repair processes (see e.g. Hansson et al. 1991 and citations therein). As mentioned above a D N A helicase is p r o b a b l y involved in the complementation of a repair defect in X e r o d e r m a pigmentosum cells (Tanaka et al. 1990). Similarly, other repair deficiencies might be complemented by D N A helicases. The third process, in which D N A helicases are m o s t likely to be involved is D N A recombination. Recently an in vitro recombination system has been developed (Jessberger and Berg 1991), which might be useful in testing the participation of the various D N A helicases during this process.
It has become increasingly clear that the basic processes of D N A metabolism are extremely conserved in eukaryotes f r o m yeast to mammals. The combination of genetics in the yeasts S. cerevisiae and Schizosaccharomyces pombe together with in vitro systems and biochemical characterization will help to clarify the in vivo roles of the various D N A helicases.
Acknowledgements. Work carried out in the authors' laboratory has been supported by the Swiss National Science Foundation (Grant 31.28592.90), by the Bonizzi-Theler Stiftung and by the Kanton of Ziirich. We thank Bettina Strack and Thomas Pauls for critically reading the manuscript.
References Aboussekhra A, Chanet R, Zgaga Z, Cassier-Chauvat C, Heude M, Fabre F (1989) RAD H, a gene of Saccharomyces cerevisiae encoding a putative helicase involved in DNA repair. Characteristics of rad H mutants and sequence of the gene. Nucleic Acids Res 17: 7211-7219 Alberts BM (1987) Prokaryotic DNA replication mechanisms. Philos Trans R Soc Lond [Biol] 317:395-420 Bailly V, Sung P, Prakash L, Prakash S (1991) DNA/RNA helicase activity of RAD3 protein of Saccharomyces cerevisiae. Proc Natl Acad Sci USA 88:9212-9216 Bambara RA, Jessee CB (1991) Properties of DNA polymerases 6 and e, and their roles in eukaryotic DNA replication. Biochim Biophys Acta 1088:11-24 Borowiec JA, Dean FB, Bullock PA, Hurwitz J (1990) Binding and unwinding - how T antigen engages the SV40 origin of DNA replication. Cell 60:181-184 Bruckner RC, Crute JJ, Dodson MS, Lehman IR (1991) The herpes simplex virus 1 origin binding protein: a DNA helicase. J Biol Chem 266: 2669-2674 Calder JM, Stow ND (1990) Herpes simplex virus helicase-primase: the UL8 protein is not required for DNA-dependent ATPase and DNA helicase activities. Nucleic Acids Res 18:3573-3578 Challberg MD, Kelly TJ (1989) Animal virus DNA replication. Annu Rev Biochem 58 : 671-717 Company M, Arenas J, Abelson J (1991) Requirement of the RNA helicase-like protein PRP22 for release of messenger RNA from spliceosomes. Nature 349:487-493 Crute JJ, Tsurumi T, Zhu L, Weller SK, Olivo PD, Challberg MD, Mocarski ES, Lehman IR (1989) Herpes simplex virus-I helicase-primase: A complex of three herpes-encoded gene products. Proc Natl Acad Sci USA 86: 2186-2189 Crute JJ, Bruckner RC, Dodson MS, Lehman IR (1991) Herpes simplex-1 helicase-primase : identification of two nucleoside triphosphatase sites that promote DNA helicase action. J Biol Chem 266:21252-21256 Dailey L, Caddle MS, Heintz N, Heintz NH (1990) Purification of RIP60 and RIP100, mammalian proteins with origin-specific DNA-binding and ATP-dependent DNA helicase activities. Mol Cell Biol 10:6225-6235 Dodson MS, Lehman IR (1991) Association of DNA helicase and primase activities with a subassembly of the herpes simplex virus 1 helicase-primase composed of the UL5 and UL52 gene products. Proc Natl Acad Sci USA 88 : 1105-1109 Dornreiter I, H6ss A, Arthur AK, Fanning E (1990) SV40 T antigen binds directly to the large subunit of purified DNA polymerase alpha. EMBO J 9:3329-3336 Downey KM, Andrews DM, Li X, Castillo C, Tan CK, So AG (1990) Effects of accessory proteins on the functional properties of DNA polymerase delta. In: Richardson CC, Lehman IR (eds) Molecular mechanisms of DNA replication and recombination. (UCLA symposium on molecular and cellular biology, new series, vol 127). Liss, New York, pp 141-152
473 Goetz GS, Dean FB, Hurwitz J, Matson SW (1988) The unwinding of duplex regions in DNA by the simian virus 40 large tumor antigen-associated DNA helicase activity. J Biol Chem 263 : 383 392 Gorbalenya AE, Koonin EV, Donchenko AP, Blinov VM (1989) A conserved NTP-motif in putative helicases. Nature 333: 22 Hansson J, Keyse SM, Lindahl T, Wood RD (1991) DNA excision repair in cell extracts from human cells exhibiting hypersensitivity to DNA damaging agents. Cancer Res 51 : 3384-3390 Harosh I, Naumovski L, Friedberg EC (1989) Purification and characterization of Rad3 ATPase/DNA helicase from Saccharomyces cerevisiae. J Biol Chem 264:2053~20539 Hotta Y, Stern H (1978) DNA unwinding protein from meiotic protein from Lilium. Biochemistry 17:1872-1880 Hfibscher U, Stalder HP (1985) Mammalian DNA helicase. Nucleic Acids Res 13 : 5471-5483 Iggo RD, Jamieson DJ, MacNeill SA, Southgate J, McPheat J, Lane DP (1991) p68 RNA helicase: Identification of a nucleolar form and cloning of related genes containing a conserved intron in yeast. Mol Cell Biol 11:1326-1333 Im D-S, Muzyczka N (1990) The AAV origin binding protein Rep68 is an ATP-dependent site-specific endonuclease with DNA helicase activity. Cell 61:447-457 Jessberger R, Berg P (1991) Repair of deletions and double-strand gaps by homologous recombination in a mammalian in vitro system. Mol Cell Biol 11 :445-457 Koff A, Schwedes JF, Tegtmeyer P (1991) Herpes simplex virus origin-binding protein (UL9) loops and distorts the viral replication origin. J Virol 65:3284-3292 Kornberg A, Baker TA (1992) DNA replication. W.H. Freeman, New York Lahaye A, Stahl H, Thines-Sempoux D, Foury F (1991) PIFI: a DNA helicase in yeast mitochondria. EMBO J 10:997-1007 Linder P, Lasko PF, Ashburner M, Leroy P, Nielsen P J, Nishi K, Schnier J, Slonimski PP (1989) Birth of the DEAD box. Nature 337:121-122 Matson SW (1991) DNA helicases of Escherichia coli. Prog Nucleic Acid Res Mol Biol 40 :282-326 Matson SW, Tabor S, Richardson CC (1983) The gene 4 protein of bacteriophage T7. Characterization of helicase activity. J Biol Chem 258:14017-14024 Naegeli H, Bardwell L, Friedberg EC (1992) The DNA helicase and adenosine triphosphatase activities of yeast Rad3 protein are inhibited by DNA damage. A potential mechanism for damage-specific recognition. J Biol Chem 267:392-398 Poll EHA, Benbow RM (1988) A DNA helicase from Xenopus laevis ovaries. Biochemistry 27 : 8701-8706 Roberts JM, D'Urso G (1988) An origin unwinding activity regulates initiation of DNA replication during mammalian cell cycle. Science 241 : 1486-1489 Scheffner M, Knippers R, Stahl H (1991) Simian virus 40 large T antigen catalyzed DNA and RNA unwinding reactions. Eur J Biochem 195:49-54 Seki M, Enomoto T, Yanagisawa J, Hanaoka F, Ui M (1988) Further characterization of DNA helicase activity of mouse DNA-dependent adenosinetriphosphatase B (DNA helicase B). Biochemistry 27 : 1766-1771 Seki M, Enomoto T, Eki T, Miyajima A, Murakami Y, Hanaoka F, Ui M (1990) DNA helicase and nucleoside-5'-triphosphatase activities of polyoma virus large tumor antigen. Biochemistry 29:1003-1009
Seo Y-S, Lee S-H, Hurwitz J (1991) Isolation of a DNA helicase from HeLa cells requiring the multisubunit human singlestranded DNA-binding protein for activity. J Biol Chem 266:13161-13170 Smale ST, Tjian R (1986) T-antigen-DNA polymerase c~complex implicated in simian virus 40 DNA replication. Mol Cell Biol 6:4077-4087 Stahl H, Dr6ge P, Knippers R (1986) DNA helicase activity of SV40 large tumor antigen. EMBO J 5:1939-1944 Stillman B (1989) Initiation of eukaryotic DNA replication in vitro. Annu Rev Cell Biol 5:197-245 Sugino A, Ryu BH, Sugino T, Naumovski L, Friedberg EC (1986) A new DNA-dependent ATPase which stimulates yeast DNA polymerase I and has DNA-unwinding activity. J Biol Chem 261 : 1t744-11750 Tanaka K, Miura N, Satokata I, Miyamoto K, Yoshida MC, Satoh Y, Kondo S, Yasui A, Okayama H, Okada Y (1990) Analysis of a human DNA excision repair gene involved in group A Xeroderma pigmentosum and containing a zinc-finger domain. Nature 348 : 73-76 Th6mmes P, Hiibscher U (1990a) Eukaryotic DNA helicases. FEBS Lett 268 : 325-328 Th6mmes P, Hfibscher U (1990 b) DNA helicase from calf thymus. Purification to apparent homogeneity and biochemical characterization of the enzyme. J Biol Chem 265:14347-14354 Th6mmes P, Hiibscher U (1990c) Eukaryotic DNA replication. Enzymes and proteins acting at the fork. Eur J Biochem 194:699-712 Th6mmes P, Ferrari E, Jessberger R, Hiibscher U (1992) Four different DNA helicases from calf thymus. J Biol Chem 267:6063-6073 Tuteja N, Tuteja R, Rahman K, Kang LY, Falaschi A (1990) A DNA helicase from human cells. Nucleic Acids Res 18:67856792 Tuteja N, Rahman K, Tuteja R, Falaschi A (1991) DNA helicase IV from HeLa cells. Nucleic Acids Res 19:3613-3618 Weeda G, van Ham HRC, Vermeulen W, Bootsma D, van der Eb AJ, Hoeijmakers JH (1990) A presumed DNA helicase encoded by ERCC-3 is involved in the human repair disorders Xeroderma pigmentosum and Cockayne's syndrome. Cell 62 : 777-791 Weiser T, Gassmann M, Th6mmes P, Ferrari E, Hafkemeyer P, Hfibscher U (1991) Biochemical and functional characterization of DNA polymerases a, 6 and ~ from calf thymus. J Biol Chem 266:10420-10428 Wessel R, Schweizer J, Stahl H (1992) Simian virus 40 T-antigen DNA helicase is a hexamer which forms a binary complex during bidirectional unwinding from the viral origin of replication. J Virol 66:804-815 Wiekowski M, Schwarz MW, Stahl H (1988) Simian virus 40 large T-antigen DNA helicase. Characterization of the ATPase-dependent DNA unwinding activity and its substrate requirements. J Biol Chem 263:436-442 Yang L, Li R, Mohr IJ, Clark R, Botchan MR (1991) Activation of BPV-1 replication in vitro by the transcription factor E2. Nature 353 : 628-632 Zhang S, Grosse F (1991) Purification and characterization of two DNA helicases from calf thymus nuclei. J Biol Chem 266: 20483-20490
