Environ Sci Pollut Res DOI 10.1007/s11356-015-4624-2

RESEARCH ARTICLE

Evaluating the efficacy of bioremediating a diesel-contaminated soil using ecotoxicological and bacterial community indices Leadin Salah Khudur 1 & Esmaeil Shahsavari 1 & Ana F. Miranda 1 & Paul D. Morrison 1 & Dayanthi Nugegoda 1 & Andrew S. Ball 1

Received: 23 October 2014 / Accepted: 27 April 2015 # Springer-Verlag Berlin Heidelberg 2015

Abstract Diesel represents a common environmental contaminant as a result of operation, storage, and transportation accidents. The bioremediation of diesel in a contaminated soil is seen as an environmentally safe approach to treat contaminated land. The effectiveness of the remediation process is usually assessed by the degradation of the total petroleum hydrocarbon (TPH) concentration, without considering ecotoxicological effects. The aim of this study was to assess the efficacy of two bioremediation strategies in terms of reduction in TPH concentration together with ecotoxicity indices and changes in the bacterial diversity assessed using PCRdenaturing gradient gel electrophoresis (DGGE). The biostimulation strategy resulted in a 90 % reduction in the TPH concentration versus 78 % reduction from the natural attenuation strategy over 12 weeks incubation in a laboratory mesocosmcontaining diesel-contaminated soil. In contrast, the reduction in the ecotoxicity resulting from the natural attenuation treatment using the Microtox and earthworm toxicity assays was more than double the reduction resulting from the biostimulation treatment (45 and 20 % reduction, respectively). The biostimulated treatment involved the addition of nitrogen and phosphorus in order to stimulate the microorganisms by creating an optimal C:N:P molar ratio. An increased concentration of ammonium and phosphate was detected in the biostimulated soil compared with the naturally attenuated samples before and after the remediation process. Responsible editor: Cinta Porte * Andrew S. Ball [email protected] 1

Centre for Environmental Sustainability and Remediation, School of Applied Sciences, RMIT University, Melbourne, VIC 3083, Australia

Furthermore, through PCR-DGGE, significant changes in the bacterial community were observed as a consequence of adding the nutrients together with the diesel (biostimulation), resulting in the formation of distinctly different bacterial communities in the soil subjected to the two strategies used in this study. These findings indicate the suitability of both bioremediation approaches in treating hydrocarbon-contaminated soil, particularly biostimulation. Although biostimulation represents a commercially viable bioremediation technology for use in diesel-contaminated soils, further research is required to determine the ecotoxicological impacts of the intervention. Keywords Diesel . Bioremediation . Natural attenuation . Biostimulation . Ecotoxicity . DGGE

Introduction Oil is the main source of energy, representing approximately 40 % of global energy usage (Mos et al. 2008). However, the economic advantages and social benefits of oil as the primary power source must be balanced by the negative outcomes of spills associated with petroleum hydrocarbons on terrestrial and aquatic ecosystems (Mos et al. 2008). Many ecological side effects are associated with the exploitation and transportation of oil and gas; for example, oil spills, fires and contaminated land and water together with incidents of air pollution have all been observed at different times and locations. Globally, the annual amount of oil that seeps into the environment has been estimated to be 4.5 million barrels per year (Kvenvolden and Cooper 2003). As a result of industrialization over the last century, vast areas have been left contaminated with high concentrations of a range of hydrocarbons (Sanders et al. 1993).

Environ Sci Pollut Res

Over the last few decades, there has been increased economic and environmental interest in remediating land contaminated with toxic chemicals, with increased demand for reusing these lands with the expansion of cities throughout the world and through the increased requirement for any pristine land available for agriculture (Davies et al. 2003). The byproducts of remediation and any remnant pollutants in soil that might be toxic to living communities are generally poorly assessed, because most analyses focus on the level of the original contaminant remaining. For example, the concentration of total petroleum hydrocarbon (TPH) in soil is usually used as criteria to assess the efficiency of the soil clean-up treatment from oil contamination (Tadesse et al. 1994). Diesel oil has often been reported as one of the major hydrocarbon pollutants, as a result of spill incidents, storage tanks and leaking pipelines (Gallego et al. 2001). It consists of many components including aromatic hydrocarbons (23.9 %), cycloalkanes (33.4 %) and n-alkanes (42.7 %). Within diesel, the n-alkanes and aromatic hydrocarbons, which both have a relatively low molecular weight, have been reported to be easily degraded through microbial action (Kang and Park 2010). The typical carbon number in the complex mixture of diesel oil is C8–C26 (Adam and Duncan 1999). Various approaches can be used to treat soil contaminated with petroleum hydrocarbons, such as incineration, soil washing, soil vapor extraction and solidification. These approaches are relatively expensive due to operational costs and further treatment of the contaminant and the treated soil which is often required (Xu and Lu 2010). Therefore, a simple, environmentally safe and cost-effective approach to restore contaminated soil into its original or almost original status is required; bioremediation, which can be defined as a biotechnological technique using microorganisms to breakdown or neutralize a contaminant from a polluted area, represents one such approach. Many strategies of bioremediation can be applied in term of soil waste treatment (Iwamoto and Nasu 2001). These include natural attenuation in which the natural degradation of the pollutant takes place by the soil microflora without any human involvement in the degradation process with the exception of monitoring the remediation process (Mills et al. 2003). This strategy has an advantage of not disturbing sensitive ecological habitats. However, the degradation rate of the contaminant might be very slow due to the low population size of the normal flora with the ability to breakdown the contaminant (Yu et al. 2005). A second strategy is biostimulation, which is an accelerated degradation process undertaken through the addition of nutrients to the soil to enhance the growth of the indigenous microorganisms and their metabolic activity. Although the addition of nutrients might lead to the acceleration of the contaminant degradation rate, the high concentration of the added substances might cause an imbalance in the natural microbial growth in the soil (Yerushalmi et al. 2003).

Although the ability of many microorganisms to remediate various organic compounds, including diesel oil, has been proved by many researchers relatively high toxicity of the resulting products has been reported in the presence of aromatic hydrocarbons due to their lipophilic property, which affect the cell membrane (Kang and Park 2010). Traditional chemical analyses are the usual way to evaluate the degradation of pollutants in contaminated sites. However, these techniques are not effective in evaluating the bioavailability or toxicity of the remediation products and thus the effects of the process on the ecology of the treated sites (MolinaBarahona et al. 2005). A reduction in the concentration of contaminants does not necessarily mean a reduction in their toxicity, because the toxicity of the intermediate metabolites resulting from an incomplete degradation of a chemical could be much higher in comparison to the original contaminant (Phillips et al. 2000). Therefore, integration between chemical analytical data, ecotoxicological assessments and the evaluation of the microbial community is required, though seldomly carried out to evaluate the efficacy of the approach used to treat the contaminated area and the environmental outcomes in terms of its effects on ecological communities. To examine the impact of chemicals on the ecological community, a variety of toxicity test methods and procedures has been proposed (Dutka and Kwan 1981). For example, testing samples using inhibition of natural bacterial bioluminescence (the Microtox test), which is based on measuring the inhibition in light emitted by a marine bacterial species Vibrio fischeri (formerly known as Photobacterium phosphoreum) (Kamlet et al. 1986). The endpoint of this test is the determination of the concentration of a contaminant that causes a reduction in the emitted light of 50 % after a certain time, usually 5 and 10 min. This is referred to as effective concentration 50 (EC50) (Kamlet et al. 1986). The earthworm acute toxicity test is another universal ecotoxicological test used to examine the toxicity of a pollutant in contaminated soil (Callaham et al. 2002; Mooney et al. 2013). The recommendation for the use of this species and the test standards were developed by the BInternational Organization for Standardization^ (ISO) and the BOrganization for Economic Cooperation and Development^ (OECD), and the test end point is the lethal concentration 50 (LC50) which can be defined as the median lethal concentration or the concentration of the test substance which kills 50 % of the test animals within the test period (Callaham et al. 2002; ISO 2008; OECD 1984). The earthworms readily come into contact with the chemicals in the soil during their movement. The uptake of the chemical fractions which are environmentally bioavailable occurs either via dermal absorption, ingestion, or both (Lanno et al. 2004). Although many studies have reported the successful bioremediation of diesel-contaminated soil, the ecotoxicological outcomes of bioremediation have rarely been assessed. This

Environ Sci Pollut Res

study aims to address this important gap in knowledge through the following: (i) the evaluation of the effectiveness of two bioremediation strategies, biostimulation, and natural attenuation in remediating diesel in a 4 % diesel-contaminated soil; (ii) evaluating whether the remediation of diesel from the two strategies is reflected in a reduction in the toxicity of the soil.

Materials and methods Experiment preparation Clean pasture land soil from Whittlesea, Melbourne, Australia, was collected and sieved using a 6-mm sieve. The soil had a pH 7.6 (in water), an initial moisture content of 20 %, total carbon 2.23 %, total nitrogen 0.22 %, and total phosphorus 313 mg/kg. Three treatments were organized in three replicates incubated for 12 weeks. The treatments were the following: (i) Natural attenuation. In this treatment, a diesel concentration of 40 mL/kg (v/w) was added to the soil and mixed manually. (ii) Biostimulation. In this treatment, the same concentration of diesel (40 mL/kg) (v/w) was added to the soil and mixed manually. In addition, ammonium sulfate ((NH4)2SO4, 20.46 g/kg) was added as a source of nitrogen and monobasic potassium phosphate (KH2PO4; 4.896 g/kg) was added as a source of phosphorus, to make the molar ratio of C:N:P to 100:10:1. (iii) Control. The original clean soil was added to the pots without any other additions. All the containers were placed at room temperature, and the moisture content was maintained at 25 % (W/W) by adding the required amount of water as required. Samples were taken every 2 weeks for further analyses.

(Sigma-Aldrich) was used in different dilutions (1:5, 1:10, 1:15, 1:20, and 1:25) to make the standard calibration curve in a Microsoft excel worksheet using the total concentration of C8–C26 as provided by the supplier. The concentration of TPH was calculated using the equation obtained from the standard calibration curve by integration with the total peak heights from each chromatogram. The diesel was extracted from the soil samples by adding 15 mL of dichloromethane (DCM) into 5 g of soil in a 25mL glass tube fitted with a polytetrafluoroethylene (PTFE) cap; the tubes were placed in sonicator for 30 min. The extract-containing solvent was washed with DCM three times. The extracts were then placed unsealed in a fume cupboard overnight to allow evaporation to dryness. The dried diesel was then dissolved in 1 mL of DCM (Dąbrowska et al. 2003). The dissolved diesel with the solvent was transferred to 2mL clear glass vials with a screw cap prior to analysis by gas chromatography (Agilent Technologies). Bioluminescence inhibition testing: the Microtox test The acute Microtox reagent (MODERN WATER Microtox®) which is the freeze-dried marine bacteria V. fischeri and the reconstitution medium were supplied by JW Industrial Instruments Pty. Ltd. The bacteria were reconstituted and allowed to equilibrate to 4 °C in a Microtox® Model 500 Analyzer. The preparation of test samples was performed by adding 1 g of air-dried soil of each replicate into 9 mL of water, placed on a shaker overnight and then centrifuged twice at 4500 rpm for 5 min (Hubálek et al. 2007). The supernatant was taken and a dilution series prepared from each for the toxicity assessment. The diluent used was 2 % sodium chloride (NaCl), and the osmotic pressure was adjusted in all samples using 22 % NaCl as required for the Microtox assay. The luminescence of the sample supernatants was measured using the Microtox® Model 500 Analyzer, and the EC50 of each replicate sample was calculated, based on the loss of luminescence using the provided software (ASTM 2004).

Total petroleum hydrocarbon (TPH) determination

Earthworms’ acute toxicity test

The TPH concentration of the soil samples for the seven time points was determined using reverse fill-flush gas chromatography (RRF GC-GC). The instrument used was an Agilent 6890 GC with Agilent GC Chemstation-Rev B 04.01 software. The RRF GC-GC conditions were as follows: oven: 60 °C (0.2 min), 6 °C/min to 270 °C (9.8 min); carrier gas: hydrogen; sample amount: 1 μL, 50:1 split; column 1: DB5MS, 30 m × 250 μm, 0.25 μm, 0.8 mL/min; column 2: INNOWax, 4.95 m×250 μm, 0.25 μm, 21.4 mL/min; injector temperature: 300 °C; detector: FID, 270 °C; modulation period 2.5 s (flush 0.03 s), start 0.99 min; and data rate, −200 Hz. The SUPLECO C8–C40 alkanes’ calibration standard

Earthworms, Eisenia andrei, were obtained commercially (Bunnings, Melbourne). For the toxicity test, ten adult worms were selected, washed, weighed and placed in plastic containers which contained 200 g of soil with five different concentrations of the contaminated soil subject to each remediation process and mixed with natural clean soil. Pores were made in the container lids to allow respiration (Makadia et al. 2011). The containers were kept at room temperature. After 14 days, the number of earthworms surviving was recorded, and the LC50 value was calculated for each treatment using ToxRat Professional software. The test was repeated every 2 weeks throughout the remediation period using the

Environ Sci Pollut Res

appropriately remediated soil and an LC50 calculated at each timepoint.

Results The bioremediation of diesel

Nutrient concentration determination The concentration of key anion and cation nutrients in the soil samples, including nitrate (NO3−), nitrite (NO2−), ammonium (NH4+), and phosphate (PO43−) was determined using an ICS1100 Basic Integrated Ion Chromatography System supplied by Thermo Scientific according to the manufacture instructions. Microbial community analysis Soil DNA extraction was performed using a PowerSoil® DNA Isolation Kit (MO BIO laboratories, Inc. USA) according to the manufacturer’s protocol. The total soil bacterial community was evaluated by PCR using universal primers of 16S rRNA gene using the following primers: 341 F (5′ CCTACGGGAGGCAGCAG3′) with GC clamp (CGCCCG CCGCGCGCGGCGGGCGGGGCGGGGGCACGGGG GG) and 907R (5′ CCG TCAATTCMTTTGAGTTT3′). Each PCR tube contained forward primer (2 μL, 10 pmol/μL), reverse primer (2 μL, 10 pmol/μL), GoTaq Flexi buffer (10 μL, 5×), magnesium chloride (5 μL, 25 mM), dNTPs mixture (1 μL, 10 mM), Taq polymerase enzyme (0.25 μL, 5 U/μL) (all PCR reagents obtained from Promega, Australia), sterile nuclease-free water (27.75 μL), and DNA extract (2 μL). The thermocycling conditions were as follows: 1 cycle of 5 min at 95 °C; 30 cycles of 1 min at 94 °C, 1 min at 52 °C, 1 min at 72 °C, and a final extension at 72 °C for 10 min. Agarose gel electrophoresis was performed to confirm DNA amplification after performing PCR. Denaturing gel gradient electrophoresis (DGGE) analysis was performed using the Universal Mutation Detection System (BioRad) with a 6 % urea-formamide denaturant gradient polyacrylamide (40–60 % denaturing gradient). The gel was run at 60 °C and 60 V for 18 h, then silver stained (Simons et al. 2012), scanned using an Epson V700 scanner, and saved as TIFF format. The DGGE gel was analyzed with Phoretix 1D software to generate a dendrogram using the unweighted pair group method with mathematical averages (UPGMA).

The implementation of the two bioremediation strategies, biostimulation, and natural attenuation resulted in a significant reduction in the diesel concentration in the soil (Fig. 1). The effectiveness of the biostimulation approach, in terms of diesel remediation, was much higher than the natural attenuation approach. A TPH concentration of approximately 20 g/kg was detected on day 0 as the starting concentration in both treatments. In biostimulation, rapid degradation in TPH concentration was recorded, especially during the first 6 weeks of the experiment; following this period, the degradation rate reduced. Almost 17.5 g/kg of TPH was remediated during the 12 weeks using biostimulation, i.e., approximately 90 % of the starting diesel concentration. In contrast, a slower degradation rate was recorded in the natural attenuation treatment compared to biostimulation, but the reduction was still significant, especially in the first half of the experiment. The TPH concentration of 4.5 g/kg at the end of week 12 indicates that 78 % of the starting concentration had been reduced in the natural attenuation treatment. A very slow degradation was recorded in the last 6 weeks of incubation, similar to the biostimulation treatment. No hydrocarbon was detected in any of the control (uncontaminated) samples. Figure 2 shows a comparison between biostimulation and natural attenuation chromatograms at day 0, week 6 and week 12, obtained from GC-MS analysis of diesel. The peak heights represent the concentration of each carbon-containing fraction of diesel (from C8–C26), and the x-axis shows the retention time in minutes for each fraction. The chromatograms show almost the same concentration of each hydrocarbon fraction in the diesel samples in both treatments at time 0, confirming, as

Statistical analysis Data were subject to analysis of variance (ANOVA) or T test using IBM SPSS 22 (IBM SPSS Inc.), as appropriate. In ANOVA, the mean values were separated using Tukey’s test (P=0.05) where the F value was significant. Additionally, principal component analysis (PCA), based on bacterial 16S rDNA DGGE profiles, was carried out with SPSS 22 software.

Fig. 1 TPH concentration (g/kg) during the bioremediation of soil contaminated with diesel using biostimulation and natural attenuation over 12 weeks (mean±SE, n=3)

Environ Sci Pollut Res

Fig. 2 GC-GC chromatographs from day 0, week 6 and week 12 of soil samples comparing the TPH composition in biostimulation (BS) and natural attenuation (NA). The peak heights represent the concentration of specific carbon-containing fractions, and X axis represents retention time (min)

expected, that at time 0 both soils had similar starting TPH concentrations. The chromatograms obtained from the extraction and analysis of the TPH during soil treatment from week 6 and week 12 (Fig. 2) show a general reduction in the concentration of all the hydrocarbon fractions in comparison to day 0 chromatograms with both bioremediation treatments confirming that the TPH concentration was reduced over time. However, a comparison of these chromatograms confirmed significant differences between hydrocarbon profiles obtained in soil undergoing biostimulation and natural attenuation, in terms both of the concentration and composition of the TPH obtained at the same time point. Week 6 chromatograms show higher concentrations in natural attenuation samples of fractions with a high molecular weight (C > 19) which have retention times higher than 30 min (Fig. 2). In contrast, the biostimulation sample showed a reduced concentration of fractions with C>19 (Fig. 2). In this chromatogram however, a much higher abundance of several small hydrocarbon fractions, with retention time less than 30 min, can be observed in the biostimulation treatment compared with the natural attenuation treatment (Fig. 2). A similar set of observations was evident in week 12 chromatograms (Fig. 2) with a prevalence of larger molecular weight hydrocarbons in the natural attenuation sample and the presence of lower molecular weight hydrocarbons in the biostimulation sample (Fig. 2). However, there was a significant reduction in the total concentration across all fractions compared with week 6 chromatograms, based on the peak heights.

Ecotoxicological assessment The results of the two ecotoxicological tests performed in this study show that both bioremediation strategies, biostimulation and natural attenuation, were effective in reducing the toxicity of the contaminated soil (Fig. 3). However, the efficacy of natural attenuation in reducing the soil toxicity was significantly greater than with biostimulation. As expected, no toxicity was detected in the control samples over the experiment

Fig. 3 EC50 values of diesel (ppm) extracted from soil, causing inhibition in the bioluminescence rate in the Microtox test. Extractions were performed from soils during the bioremediation of diesel-contaminated soil using biostimulation and natural attenuation over 12 weeks (mean±SE, n=3)

Environ Sci Pollut Res

period when assayed with either the Microtox or the earthworm test, and no EC50 or LC50, respectively, was calculable for the control soil at any time point. In the Microtox test, as expected, similar toxicity levels were recorded on day 0, where the EC50 was approximately 2000 (μg diesel/kg) for both treatments (Fig. 3). This EC50 value, at the start time point, represented about 5 % of the initial diesel concentration in the soil, which was 40,000 (μg diesel/kg). All EC50 values are represented based on the original diesel concentration to demonstrate change in toxicity. A decrease in the toxicity was recorded during the remediation process in both treatments, the natural attenuation treatment was more effective in toxicity reduction. With natural attenuation, the EC50 value increased significantly during the experimental period, reaching a peak of about 17,400 (μg diesel/kg) at the end of week 12, approximately 43 % of the initial diesel concentration. In contrast, a gradual increase in the EC50 was recorded in the biostimulation treatment, reaching almost 8000 (μg diesel/kg) at the end of week 12, equivalent to approximately 20 % of the initial diesel concentration. Therefore, the efficiency of the natural attenuation treatment, in terms of a reduction of diesel toxicity, was more than double than the efficiency of biostimulation, based on the results of the Microtox test. Similarly, the earthworm acute toxicity test also showed a reduction in soil toxicity. The contaminated soil LC50 to earthworms increased over time for both treatments (Fig. 4). However, the natural attenuation strategy was more effective in reducing the toxicity of the diesel-contaminated soil. The initial LC50 at day 0 was a dilution containing 2.7 % of the contaminated soil mixed with 97.3 % clean soil, indicating the high toxicity of the contaminant (diesel) in the soil. A reduction in toxicity developed over the remediation time, and the LC50 at week 12 was recorded as 46.7 % contaminated soil

Fig. 4 The LC50 of diesel-contaminated soil (%) mixed with clean soil in a 14-day earthworm acute toxicity test in biostimulation and natural attenuation treatments over 12 weeks

mixed with 53.3 % clean soil. This was an indication that the toxicity of the contaminated soil was reduced by almost 45 % over the 12-week remediation time. The initial LC50 at day 0 of the biostimulation treatment soil was recorded as a dilution of 2.2 % contaminated soil mixed with 97.8 % clean soil, not significantly different from the day 0 LC50 for the natural attenuation. The survival of earthworms in this treatment also showed a gradual increase over the remediation period. The LC50 reached its maximum value during the last week of the remediation process in a dilution of 16.5 % of contaminated soil mixed with 83.5 % clean soil, reflecting only a 14.3 % reduction in soil toxicity over the 12 weeks of remediation with biostimulation. Overall, the efficacy of the natural attenuation was about 2.8 times higher than biostimulation, in term of diesel toxicity reduction. Bacterial community analysis In an effort to examine the impact of the contamination and the subsequent bioremediation process on the soil microbial community, PCR-DGGE was performed from soils exposed to the different bioremediation treatments at day 0, week 2, 4, 6, and 12, from both biostimulation and natural attenuation treatments. These time points were selected based on significant changes occurring in the TPH concentration (Fig. 1) at these time points. The resultant dendrogram shows the differences in the bacterial community between biostimulation (BS) and natural attenuation (NA) treatments (Fig. 5a). The bacterial banding pattern in the biostimulation treatment, especially at week 2 (BS2), week 4 (BS4), week 6 (BS6), and week 12 (BS12) varied from the banding pattern in natural attenuation and control soil (CS) treatments. The lowest similarity level (C22) fractions compared with low molecular weight petroleum hydrocarbons. Salanitro et al. (1997) argued that the uncharacterized, incompletely degraded, and low molecular weight residues of petroleum hydrocarbons were associated with high acute toxicity to earthworms. The ease of uptake was related to the high toxicity of lower molecular weight hydrocarbon compounds over higher molecular weight hydrocarbon compounds (Coulon et al. 2005). In this study, biostimulation may have resulted in faster reduction in the less toxic, higher molecular weight hydrocarbon fractions with a possible increase in the more available and more toxic low molecular weight fractions than the natural attenuation treatment. Thus, within the test period, the natural attenuation treatment could have yielded a less toxic soil at each sampling time. In this study, the identity of the intermediate metabolites was not investigated, and future research will focus on the identification of these intermediates and assessment of their individual toxicity. Changes in the soil bacterial diversity were observed at week 2 in the biostimulation and natural attenuation treatments and remained stable until week 12 (Fig. 5a). The addition of diesel as well as nutrients (N and P) led to a shift in the bacterial community in biostimulation treatments relative to

Environ Sci Pollut Res

all the day 0 samples and to the control soil samples. An explanation would be that the presence of nutrients would have enhanced the microbial abundance and activities (including hydrocarbon degraders) which may cause a change in bacterial community and accelerate diesel degradation. In contrast, the bacterial community of the naturally attenuated samples showed a similar bacterial community profile compared with the control soil and the day 0 samples (Fig. 5a). It is well documented that DGGE has some disadvantages and limitations. One of the main disadvantages of DGGE is PCR-DGGE artifacts which cause an error in the estimation of microbial communities (Nakatsu 2007). In addition, DGGE can only assess about 1 % of the dominant of species in the bacterial community. Therefore, new methods such as metagenomics and stable isotope probing (SIP) would provide more information about microbial communities. The shifts in bacterial community may represent another explanation for the significant differences between biostimulation and natural attenuation treatments, in terms of diesel degradation and toxicity reduction due to many possible factors. The first factor is the variety of enzymes produced by each species of the hydrocarbon-degrading bacteria. For example, a few species can produce alkane hydroxylase enzymes that break down the hydrocarbon fraction of C5–C16; some other bacterial oxygenase enzymes, which degrade fractions C10–C30, are produced by another species (van Beilen et al. 2003). In addition, fractions of C10–C44 can be utilized by another genus of bacteria (Di Cello et al. 1997). The second possible factor is the bioavailability of the diesel fractions and the degraded compounds to the organisms. An increase in bioavailability of the contaminant to the hydrocarbondegrading bacteria results in a greater reduction in the TPH concentration. However, when smaller hydrocarbons are more bioavailable to other organisms (in this case, the earthworms, V. fischeri, and non-hydrocarbon-degrading bacteria), an increase in toxicity may result. Many researchers argue that bioavailability of hydrocarbons varies between different organisms (Guerin and Boyd 1992; Reid et al. 2000; Semple et al. 2003). Moreover, Cornelissen et al. (1998) showed that increased bioavailability of the smaller molecular weight fractions resulted from the remediation of hydrocarbons. The addition of the nutrients to the diesel-contaminated soil seems to be the crucial step in terms of the interpretation of the results obtained in this study. Since these nutrients were added with the diesel-contaminated soil in order to achieve the desired C: N: P ratio (100:10:1 in this study), they caused a shift in the bacterial diversity in a different way compared to the bacterial shift that occurred with the addition of diesel only. Many previous studies showed that the added nutrients caused significant qualitative and quantitative changes in the microbial communities (Duarte et al. 2001; Evans et al. 2004; Xia et al. 2006). The consequences resulting from this alteration were significant differences between biostimulation and

natural attenuation treatments, in terms of bioremediation and ecotoxicology, as previously discussed. The high concentrations of the nutrient residues (e.g., ammonia and phosphate) might represent another possible reason for the increased toxicity observed in the biostimulation treatments over the natural attenuation. Ammonium ions may be more toxic to earthworms and some bacteria than nitrate. In addition, it may be possible that high nutrient concentrations increased the bioavailability of hydrocarbons, resulting in higher ecotoxicity of the biostimulated samples. Further studies are recommended to investigate the reasons for increased toxicity related to biostimulation compared to natural attenuation when contaminated soil is bioremediated.

Conclusion This study has shown the effectiveness of two bioremediation strategies, biostimulation and natural attenuation, in remediating diesel oil in a contaminated soil. The addition of the nutrient to stimulate the indigenous soil microorganism improved the remediation process, resulting in a 90 % reduction in the TPH concentration in the biostimulated samples compared with 78 % in the natural attenuated soil. Ecotoxicological assessments showed greater toxicity in soil which was treated by biostimulation compared with soil undergoing the natural attenuation treatment. These findings show that a reduction in the TPH concentration does not necessarily indicate a decrease in the toxicity associated with the bioremediation outcomes. A reliable evaluation of the bioremediation efficiency might not be provided by the chemical analysis, without ecotoxicological examinations. Overall, while biostimulation strategy could be considered as the recommended approach over natural attenuation in terms of bioremediation of a diesel-contaminated soil, toxicity related to addition of nutrient may limit the use of biostimulation. Therefore, it is important to optimize the amount of nutrient which needs to be used in this technology.

Acknowledgments This work was supported by the award of a grant from the Australian Research Council to AS Ball (Grant No. LP110201130). Compliance with ethical standards Ethical approval is not required for this research work. This study was performed in accordance with the PC2 Australian Standards at School of Applied Sciences, RMIT University.

References Adam G, Duncan HJ (1999) Effect of diesel fuel on growth of selected plant species. Environ Geochem Health 21:353–357

Environ Sci Pollut Res ASTM (2004) Standard test method for assessing the microbial detoxification of chemically contaminated water and soil using a toxicity test with a luminescent marine bacterium. Society for Testing and Materials Standard Guideline, American Atlas RM (1991) Microbial hydrocarbon degradation—bioremediation of oil spills. J Chem Technol Biotechnol 52:149–156 Bento FM, Camargo FAO, Okeke BC, Frankenberger WT (2005) Comparative bioremediation of soils contaminated with diesel oil by natural attenuation, biostimulation and bioaugmentation. Bioresour Technol 96:1049–1055 Callaham MA, Stewart AJ, Alarcon C, McMillen SJ (2002) Effects of earthworm (Eisenia fetida) and wheat (Triticum aestivum) straw additions on selected properties of petroleum-contaminated soils. Environ Toxicol Chem 21:1658–1663 Cornelissen G, Rigterink H, Ferdinandy MMA, Van Noort PCM (1998) Rapidly desorbing fractions of PAHs in contaminated sediments as a predictor of the extent of bioremediation. Environ Sci Technol 32: 966–970 Coulon F, Pelletier E, Gourhant L, Delille D (2005) Effects of nutrient and temperature on degradation of petroleum hydrocarbons in contaminated sub-Antarctic soil. Chemosphere 58:1439–1448 Dąbrowska H, Dąbrowski Ł, Biziuk M, Gaca J, Namieśnik J (2003) Solid-phase extraction clean-up of soil and sediment extracts for the determination of various types of pollutants in a single run. J Chromatogr A 1003:29–42 Davies NA, Hodson ME, Black S (2003) The influence of time on lead toxicity and bioaccumulation determined by the OECD earthworm toxicity test. Environ Pollut 121:55–61 Di Cello F, Pepi M, Baldi F, Fani R (1997) Molecular characterization of an n-alkane-degrading bacterial community and identification of a new species, Acinetobacter venetianus. Res Microbiol 148:237–249 Dorn PB, Salanitro JP (2000) Temporal ecological assessment of oil contaminated soils before and after bioremediation. Chemosphere 40:419–426 Duarte GF, Rosado AS, Seldin L, de Araujo W, van Elsas JD (2001) Analysis of bacterial community structure in sulfurous-oilcontaining soils and detection of species carrying dibenzothiophene desulfurization (dsz). Genes Appl Environ Microbiol 67:1052–1062 Dutka BJ, Kwan KK (1981) Comparison of three microbial toxicity screening tests with the Microtox test. Bull Environ Contam Toxicol 27:753–757 Evans FF et al (2004) Impact of oil contamination and biostimulation on the diversity of indigenous bacterial communities in soil microcosms. FEMS Microbiol Ecol 49:295–305 Gallego JLR, Loredo J, Llamas JF, Vázquez F, Sánchez J (2001) Bioremediation of diesel-contaminated soils: evaluation of potential in situ techniques by study of bacterial degradation. Biodegradation 12:325–335 Guerin WF, Boyd SA (1992) Differential bioavailability of soil-sorbed naphthalene to 2 bacterial species. Appl Environ Microbiol 58: 1142–1152 Hubálek T, Vosáhlová S, Matějů V, Kováčová N, Novotný Č (2007) Ecotoxicity monitoring of hydrocarbon-contaminated soil during bioremediation: a case study. Arch Environ Contam Toxicol 52:1–7 ISO (2008) Soil quality—avoidance test for determining the quality of soils and effects of chemicals on behaviour—part 1: test with earthworms (Eisenia fetida and Eisenia andrei). International Organization for Standardization, Paris-France Iwamoto T, Nasu M (2001) Current bioremediation practice and perspective. J Biosci Bioeng 92:1–8 Kamlet MJ, Doherty RM, Veith GD, Taft RW, Abraham MH (1986) Solubility properties in polymers and biological media. 7. An analysis of toxicant properties that influence inhibition of bioluminescence in Photobacterium phosphoreum (the Microtox test). Environ Sci Technol 20:690–695

Kang Y-S, Park W (2010) Protection against diesel oil toxicity by sodium chloride-induced exopolysaccharides in Acinetobacter sp. strain DR1. J Biosci Bioeng 109:118–123 Kvenvolden KA, Cooper CK (2003) Natural seepage of crude oil into the marine environment. Geo-Mar Lett 23:140–146 Lanno R, Wells J, Conder J, Bradham K, Basta N (2004) The bioavailability of chemicals in soil for earthworms. Ecotoxicol Environ Saf 57:39–47 Makadia TH, Adetutu EM, Simons KL, Jardine D, Sheppard PJ, Ball AS (2011) Re-use of remediated soils for the bioremediation of waste oil sludge. J Environ Manag 92:866–871 Mills MA, Bonner JS, McDonald TJ, Page CA, Autenrieth RL (2003) Intrinsic bioremediation of a petroleum-impacted wetland. Mar Pollut Bull 46:887–899 Mills SA, Frankenberger WT Jr (1994) Evaluation of phosphorus sources promoting bioremediation of diesel fuel in soil. Bull Environ Contam Toxicol 53:280–284 Molina-Barahona L, Vega-Loyo L, Guerrero M, Ramírez S, Romero I, Vega-Jarquín C, Albores A (2005) Ecotoxicological evaluation of diesel-contaminated soil before and after a bioremediation process. Environ Toxicol 20:100–109 Mooney TJ, King CK, Wasley J, Andrew NR (2013) Toxicity of diesel contaminated soils to the subantarctic earthworm Microscolex macquariensis. Environ Toxicol Chem 32:370–377 Mos L, Cooper GA, Serben K, Cameron M, Koop BF (2008) Effects of diesel on survival, growth, and gene expression in rainbow trout (Oncorhynchus mykiss). Fry Environm Sci Technol 42:2656–2662 Nakatsu C (2007) Soil microbial community analysis using denaturing gradient gel electrophoresis. Soil Sci Soc Am J 71:562–571 OECD (1984) OECD guideline for testing of chemicals BEarthworm, Acute Toxicity Tests^ vol 207. The Organisation for Economic Co-operation and Development Paris-France Phillips TM, Liu D, Seech AG, Lee H, Trevors JT (2000) Monitoring bioremediation in creosote-contaminated soils using chemical analysis and toxicity tests. J Ind Microbiol Biotech 24:132–139 Reid BJ, Jones KC, Semple KT (2000) Bioavailability of persistent organic pollutants in soils and sediments—a perspective on mechanisms, consequences and assessment. Environ Pollut 108:103–112 Salanitro JP et al (1997) Crude oil hydrocarbon bioremediation and soil ecotoxicity. Asses Environ Sci Technol 31:1769–1776 Sanders G, Jones KC, Hamilton-Taylor J, Dorr H (1993) Concentrations and deposition fluxes of polynuclear aromatic hydrocarbons and heavy metals in the dated sediments of a rural English lake. Environ Toxicol Chem 12:1567–1581 Seklemova E, Pavlova A, Kovacheva K (2001) Biostimulation-based bioremediation of diesel fuel: field demonstration. Biodegradation 12:311–316 Semple KT, Morriss AWJ, Paton GI (2003) Bioavailability of hydrophobic organic contaminants in soils: fundamental concepts and techniques for analysis. Eur J Soil Sci 54:809–818 Simons KL, Ansar A, Kadali K, Bueti A, Adetutu EM, Ball AS (2012) Investigating the effectiveness of economically sustainable carrier material complexes for marine oil remediation. Bioresour Technol 126:202–207 Straube WL, Nestler CC, Hansen LD, Ringleberg D, Pritchard PH, JonesMeehan J (2003) Remediation of polyaromatic hydrocarbons (PAHs) through landfarming with biostimulation and bioaugmentation. Acta Biotechnol 23:179–196 Tadesse B, Donaldson JD, Grimes SM (1994) Contaminated and polluted land: a general review of decontamination management and control. J Chem Technol Biotechnol 60:227–240

Environ Sci Pollut Res Tang J, Wang M, Wang F, Sun Q, Zhou Q (2011) Eco-toxicity of petroleum hydrocarbon contaminated soil. J Environ Sci 23: 845–851 van Beilen JB, Li Z, Duetz WA, Smits THM, Witholt B (2003) Diversity of alkane hydroxylase systems in the environment Diversité des systèmes alcane hydroxylase dans l'environnement 58: 427–440 Xia WX, Li JC, Zheng XL, Bi XJ, Shao JL (2006) Enhanced biodegradation of diesel oil in seawater supplemented with nutrients. Eng Life Sci 6:80–85

Xu Y, Lu M (2010) Bioremediation of crude oil-contaminated soil: comparison of different biostimulation and bioaugmentation treatments. J Hazard Mater 183:395–401 Yerushalmi L, Rocheleau S, Cimpoia R, Sarrazin M et al (2003) Enhanced biodegradation of petroleum hydrocarbons in contaminated soil. Bioremediation J 7:37 Yu KSH, Wong AHY, Yau KWY, Wong YS, Tam NFY (2005) Natural attenuation, biostimulation and bioaugmentation on biodegradation of polycyclic aromatic hydrocarbons (PAHs) in mangrove sediments. Mar Pollut Bull 51:1071–1077