Research Article Received: 21 January 2014,

Revised: 16 February 2014,

Accepted: 18 February 2014

Published online in Wiley Online Library

(wileyonlinelibrary.com) DOI 10.1002/jat.3010

Evaluation of developmental toxicity using undifferentiated human embryonic stem cells Eui-Man Junga, Yeo-ul Choia, Hong-Seok Kanga, Hyun Yanga, Eui-Ju Honga, Beum-Soo Anb, Jun-young Yangc, Ki. Hwan Choic and Eui-Bae Jeunga* ABSTRACT: An embryonic stem cell test (EST) has been developed to evaluate the embryotoxic potential of chemicals with an in vitro system. In the present study, novel methods to screen toxic chemicals during the developmental process were evaluated using undifferentiated human embryonic stem (hES) cells. By using surface marker antigens (SSEA-4, TRA-1-60 and TRA-1-81), we confirmed undifferentiated conditions of the used hES cells by immunocytochemistry. We assessed the developmental toxicity of embryotoxic chemicals, 5-fluorouracil, indomethacin and non-embryotoxic penicillin G in different concentrations for up to 7 days. While expressions of the surface markers were not significantly affected, the embryotoxic chemicals influenced their response to pluripotent ES cell markers, such as OCT-4, NANOG, endothelin receptor type B (EDNRB), secreted frizzled related protein 2 (SFRP2), teratocarcinoma-derived growth factor 1 (TDGF1), and phosphatase and tensin homolog (PTEN). Most of the pluripotent ES cell markers were down-regulated in a dose-dependent manner after treatment with embryotoxic chemicals. After treatment with 5-fluorouracil, indomethacin and penicillin G, we observed a remarkable convergence in the degree of up-regulation of development, cell cycle and apoptosis-related genes by gene expression profiles using an Affymetrix GeneChips. Taken together, these results suggest that embryotoxic chemicals have cytotoxic effects, and modulate the expression of ES cell markers as well as development-, cell cycle- and apoptosis-related genes that have pivotal roles in undifferentiated hES cells. Therefore, we suggest that hES cells may be useful for testing the toxic effects of chemicals that could impact the embryonic developmental stage. Copyright © 2014 John Wiley & Sons, Ltd. Keywords: human embryonic stem cells; developmental toxicant; cell toxicity; differentiation; microarray

Introduction In vivo studies for chemical risk assessment require large numbers of animals and are associated with ethical issues. Recently, a variety of alternative animal-free methods for evaluating the toxicity of chemicals have been developed. The embryonic stem cell test (EST) is one of these animal-free methods used to assess the embryotoxic potential of reagents in vitro (Scholz et al., 1999a; Buesen et al., 2004; Paquette et al., 2008). Advantages of the EST include reduced procedure time, costs and the need for experimental animals. Initially, EST employed mouse embryonic stem (mES) cells (Heuer et al., 1993). Mouse ES cells are derived from the inner cell mass of pre-implantation mouse embryos (Martin, 1981). These pluripotent cells have the potential to differentiate into various tissue types derived from the three germ layers: ectoderm, mesoderm and endoderm (Trounson, 2002; Yamanaka et al., 2008). EST is based on the formation of embryonic bodies (EBs) when mES cells are cultured in the absence of murine leukemia inhibitory factor using the hanging-drop method (Taha et al., 2012). Consequently, the EB model with mES cells would be used for assessing development toxicity in a heterogeneous population of cells from various lineages. Application of mES cells for evaluating the embryotoxic potential is already well established (Genschow et al., 1999; Spielmann et al., 2001; Seiler and Spielmann, 2011) and has been validated by the European Centre for Validation of Alternative Methods (ECVAM). EST methods are based on the assessment of toxicological endpoints such as 50% inhibition of cell viability (IC50) or 50% inhibition of ES cell differentiation (ID50) values (Heuer et al., 1993; Scholz et al., 1999b). These endpoints are used to divide chemicals

J. Appl. Toxicol. 2014

into three categories: non-embryotoxic, weakly embryotoxic and strongly embryotoxic (Genschow et al., 2000, 2004). However, not all embryotoxic chemicals have been correctly classified according to EST endpoints. Recently, the EST methods have been modified and novel endpoints were proposed. For example, reporter gene constructs controlled by cardiac-specific promoters were used to test embryotoxic chemicals (Suzuki et al., 2011a, 2011b). The expression of differentiation makers in the ectoderm, mesoderm and endoderm was also analyzed (Mehta et al., 2008; Flora and Mehta, 2009). Furthermore, several studies have improved EST by including new morphological and molecular endpoints (Bremer et al., 2001; Seiler et al., 2004; Buesen et al., 2009). However, these methods need relatively long periods (from 7 to 32 days) owing to the use of differentiated ES cells. Therefore, EST needs to be improved by identifying novel molecular

*Correspondence to: Dr Eui-Bae Jeung, PhD, Laboratory of Veterinary Biochemistry and Molecular Biology, College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, 361-763, Republic of Korea. Email: [email protected] a Laboratory of Veterinary Biochemistry and Molecular Biology, College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk, 361-763, Republic of Korea b Department of Biomaterials Science, College of Natural Resources and Life Science, Pusan National University, Miryang, Republic of Korea c Toxicological Screening and Testing Division, National Institute of Food and Drug Safety Evaluation, Ministry of Food and Drug Safety, Cheongwon-gun, Chungbuk, Republic of Korea

Copyright © 2014 John Wiley & Sons, Ltd.

E.-M. Jung et al. endpoints and developing report-based techniques that can be completed within a short time. In addition, the establishment of new ESTs with human ES (hES) cells is required. Human ES cells may be suitable for evaluating the embryotoxic potential of chemicals. These cells can differentiate into three germ layers (Gepstein, 2002; Chavez et al., 2008) and the unique feature of cells from each layer has provided good insight into understanding human developmental biology in vitro (Trounson, 2002; Lee et al., 2005). In this context, hES models can be used for toxicological studies to test the effects of man-made chemicals, drugs and xenobiotics. Recent studies have reported the sensitive detection of developmental toxicity of known chemicals using hES cells (Jensen et al., 2009; Krtolica and Giritharan, 2010; Krug et al., 2013). In addition to providing accurate results, the use of hES cells would avoid problems associated with animal ethics. Diversity related genetic factors, DNA methylation and DNA repair processes between experimental animals and humans have been reported in the development stage (Krtolica et al., 2009). Although EST using mES cells has routinely been used to evaluate embryotoxic chemicals (Spielmann et al., 2001; Suzuki et al., 2012), it has limits in incorrect classification of embryotoxic chemicals owing to species-specific differences between humans and animals (Ginis et al., 2004). The objective of this study was the evaluation for embryotoxicity of various chemicals using an in vitro system featuring undifferentiated hES cells. We assessed the potencies of the chemicals by measuring IC50 values and the expression of embryonic specific markers. In this study, the impact of predicting a developmental toxic chemical was therefore investigated in an aspect of interspecies difference and in differentiation-related genes in pluripotent ES cell markers.

Materials and Methods Chemicals 5-fluorouracil, indomethacin and penicillin G were purchased from Sigma-Aldrich (St. Louis, MO, USA). Penicillin G were dissolved in phosphate-buffered saline (PBS) at a concentration of 0.1 M and stored in 100-μl aliquots at –20°C. 5-fluorouracil and indomethacin were dissolved in dimethyl sulfoxide (DMSO) at a concentration of 0.1 M. 5-fluorouracil was stored in 100-μl aliquots at 4 °C. Indomethacin was stored in 100-μl aliquots at –20°C. hES Cell Culturing hES H9 cells were obtained from the WiCell Research Institute, Inc. (Madison, WI, USA) and cultured according to the manufacturer’s protocol. For all experiments in this study, the hES cells were used between passage numbers 25 to 32. The cells were cultured on mouse embryonic fibroblast (mEF) cells in hES cell medium composed of Dulbecco’s Modified Eagle Medium (DMEM)/F12 (Invitrogen, Carlsbad, CA, USA) supplemented with 20% defined fetal bovine serum (FBS) (Thermo Scientific HyClone, Logan, UT, USA), 1% Minimum Essential Medium (MEM) nonessential amino acids (Invitrogen), 0.1 mM β-mercaptoethanol (Sigma-Aldrich), 2 mM L-glutamine (Invitrogen), 50 U/ml penicillin/streptomycin (Invitrogen) and 4 ng ml–1 human recombinant basic fibroblast growth factor (bFGF; Invitrogen). The mEF cells were obtained from E12.5 ICR mouse embryos that had been mitotic inactivated with 10 μg ml–1 mitomycin C (Sigma-Aldrich) for 3 h, plated at a density of 1.6 × 106 cells per ml on 6-well plates

wileyonlinelibrary.com/journal/jat

(Nunclon™ Surface; NUNC, Wiesbaden, Germany) and cultured overnight. The cells were cultured at 37 °C in a 5% CO2 humidified tissue culture incubator (Sanyo, San Diego, CA, USA). Mechanical passaging of the undifferentiated hES cell colonies was performed by dividing the colonies into small clumps of about 100–200 cells using the sharp edge of a flame-pulled Pasteur pipette. Care was taken so that the areas containing differentiated hES cells were eliminated during passaging. The hES cells were subcultured once a week. Immunostaining The hES cells were cultured on plates (NUNC) coated with Matrigel (BD Biosciences, San Diego, CA, USA). For identification, the cells were stained using an ES Cell Characterization Kit (Chemicon, Hampshire, UK). For the staining procedure, the hES cells were fixed in 4% paraformaldehyde/PBS for 20 min at room temperature and then washed twice for 5 min with TBST [20 mM Tris–HCl (pH 7.4), 0.15 M NaCl, and 0.05% Tween-20; Sigma-Aldrich]. The cells were then permeabilized with 0.1% Triton X-100 (Sigma-Aldrich) in PBS (Invitrogen) for 10 min at room temperature and washed twice for 5 min with TBST. Afterwards, the cells were incubated for 30 min in a blocking solution (4% normal goat serum in PBS; Invitrogen) at room temperature. The primary antibodies against SSEA-4 (Chemicon), TRA-1-60(Chemicon) and TRA-1-81(Chemicon) were diluted 1: 50 in the blocking solution. After incubating with the primary antibodies for 1 h at room temperature, the cells were washed three times for 5 min with TBST and then incubated with FITClabeled goat anti-mouse IgM (diluted 1: 200 in 1× PBS) for 30 min at room temperature. Cells were then washed three times for 5 min with TBST and incubated with 4′, 6-diamidino-2phenylindole dihydrochloride (DAPI, 100 ng ml–1) to stain the nuclei at 37 °C in the dark. Images of the cells were obtained using a fluorescence microscope (IX71 inverted microscope; Olympus, Tokyo, Japan). Cytotoxicity Assay The hES cells were treated with 1 mg ml–1 collagenase type IV (Invitrogen) for 5–10 min and gently scraped. Next, 10,000 hES cells were plated into each well of a Matrigel-coated 96-well tissue culture plate (NUNC). The cells were treated with or without the indicated chemicals for 1, 3, 5 or 7 days. At the end of the treatment period, the cells were incubated with a Cell Counting Kit-8 solution (Dojindo Laboratories, Tokyo, Japan) in the dark for 4 h. The absorbance of each well was read at 450 nm using a microtiter plate reader (Molecular Devices, Sunnyvale, CA, USA). The percentage of cell viability was based on the fluorescence of each well relative to the fluorescence of the control (untreated) cells that was set at 100%, and ID50 values were calculated according to the concentration–response curve. The IC50 values were analyzed with GraphPad Prism 5.01 (GraphPad Prism Software, Inc., San Diego, CA, USA). Real-time PCR hES stem cell total RNA was extracted using Trizol reagent (Invitrogen) according to the manufacturer’s methods, and the total RNA concentration was determined by measuring the absorbance at 260 nm. First-strand complementary DNA (cDNA) was prepared by performing reverse transcription using 1 μg

Copyright © 2014 John Wiley & Sons, Ltd.

J. Appl. Toxicol. 2014

Embryotoxic chemicals on human ES cells total RNA, Moloney Murine Leukemia Virus (mMLV) reverse transcriptase (Invitrogen) and random primers (9-mers; TaKaRa Bio Inc., Otsu, Shiga, Japan). Real-time PCR was performed with 1 μl of the cDNA template added to 10 μl of 2× SYBR Premix Ex Taq (TaKaRa Bio Inc.) and specific primers (10 pM each). Sequences of the primers are presented in Table 1. Real-time PCR (Applied Biosystems, Foster City, CA, USA) was carried out for 40 cycles of denaturation at 95 °C for 15 s, annealing at 58 °C for 15 s and extension at 72 °C for 30 s. Fluorescence intensity was measured at the end of the extension phase of each cycle. The threshold value for fluorescence intensity of all the samples was set manually. The cycle at which fluorescence intensity of the PCR products exceeded this threshold during the exponential phase of PCR amplification was identified as the threshold cycle (CT). Target gene expression was quantified relative to that of the internal control gene (GAPDH) based on the comparison of CTs at constant fluorescence intensity. The amount of transcript was inversely related to the observed CT and the CT was expected to increase by 1 for every two-fold dilution of the transcript. Relative expression (R) was calculated using the equation R = 2-[ΔCT sample-ΔCT control]. All data were normalized relative to GAPDH as well as to the respective controls. Gene Expression Profiling Total RNA from the cultured cells was obtained 5 days after the embryotoxic or non-embryotoxic chemicals treatment using RNeasy Mini Kit columns (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. RNA quality was assessed with an Agilent 2100 bioanalyser using an RNA 6000 Nano Chip (Agilent Technologies, Amstelveen, the Netherlands), and RNA quantity was measured by a ND-1000 spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE, USA).

Table 1. Primers for real-time PCR Gene

Primer sequence (5′ → 3′)

Accession No.

OCT-4

F: acatcaaagctctgcagaaagaact R: ctgaataccttcccaaatagaaccc F: accttccaatgtggagcaac R: gaatttggctggaactgcat F: acctaaagcagagacgggaagt R: tcagtgaagccatgttgatacc F: aggacaacgacctttgcatc R: ttgctcttggtctccaggat F: cagtaaggagctaaacagaa R: tacacagggaacacttctt F: agttccctcagccgttacct R: tctgcacgctctatactgcaa F: aaccaggcagtcaccttgag R: tccatttcctggatctgagc F: catcctgaaggtgtccatga R: ttcttcttcttccgcagcat F: tgcgcagaactgtcgtaaac R: ttgactggcctaccttggtc F: agcggtttaccgacatcct R: acaggtggtttccgtagctc F: agttccgcaggaatgagaga R: gcccctcgtgtaaacaacat

NM_001173531

NANOG EDNRB SFRP2 TDGF1 PTEN HDAC9 DLK1 NFE2L3 LHX1 PRRX1

J. Appl. Toxicol. 2014

We performed global gene expression analyzes using an Affymetrix GeneChip® PrimeView™ Human Gene Expression Array (Affymetrix, Santa Clara, CA, USA). Sample preparation was performed according to the manufacturer’s instructions and recommendations. Briefly, 6 μg of total RNA from each sample was converted into double-strand cDNA after amplification and biotin-labeling (IVT labeling kit; Affymetrix). The amplified RNA was fragmented using 8 μl of 5× fragmentation buffer (Sample Cleanup Module; Affymetrix). Fragmentation was confirmed in a 1% agarose gel stained with ethidium bromide. The RNA was then hybridized to the array containing over 39,000 transcripts according to the protocol described in the Gene Chip Expression Analysis Technical Manual (Affymetrix). After hybridization, the chips were stained and washed in a Genechip Fluidics Station 450 (Affymetrix), and scanned with a Genechip Array scanner 3000 7G (Affymetrix). After the final wash and staining step, the Affymetrix GeneChip® PrimeView™ Human Gene Expression Array was performed using an Affymetrix Model 3000 G7 scanner, and the data were extracted with Affymetrix Commnad Console software version 1.1. The raw file generated using this procedure was subsequently analyzed. Statistical Analysis All experiments were performed in triplicate. Data are presented as the mean ± standard error of the mean (SEM), and were analyzed with a one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test. P-values < 0.05 were considered to be statistically significant. Array data were generated by Affymetrix Expression Console software version 1.1. The Robust Multichip Average (RMA) algorithm of Affymetrix Expression Console software was used for normalization. To reduce noise for the significance analysis, probe sets that were not called Main by the RMA detection call were filtered out. The web-based Database for Annotation, Visualization and Integrated Discovery (DAVID; http://david.abcc. ncifcrf.gov/) was used to interpret the meanings of differentially expressed genes. The genes were then classified based on gene function information derived from the Gene ontology, Panther ontology database (http://david.abcc.ncifcrf.gov/home.jsp; http://www.pantherdb.org/).

NM_024865 NM_000115

Results Expression of hES Cell Surface Markers

NM_003013 NM_003212 NM_000314 NM_014707 NM_003836

As the surface markers SSEA-4, TRA-1-60 and TRA-1-81 are strongly correlated with the expression levels of several embryonic stem (ES) cell markers [including octamer-binding transcription factor 4 (OCT-4) and nanog homeobox NANOG] in undifferentiated hES cells (Rosner et al., 1990; Chambers et al., 2003; Wright and Andrews, 2009), we measured the expression of SSEA-4, TRA-1-60 and TRA-1-81 in hES H9 cells by immunestaining. As shown in Fig. 1, the stem cell colonies showed typical patterns of hES cell surface marker expression.

NM_004289 Evaluation of Embryotoxicity Using hES Cells NM_005568 NM_006902

The cytotoxic effects of well-known embryotoxic chemicals were measured with hES cells using a cell counting kit. IC50 values relative to the untreated control were calculated using GraphPad Prism software. Penicillin G was used as a negative

Copyright © 2014 John Wiley & Sons, Ltd.

wileyonlinelibrary.com/journal/jat

E.-M. Jung et al. Gene Profiles of hES Cells After Exposure to Embryotoxic Chemicals

Figure 1. Expression of surface markers in undifferentiated human embryonic stem (hES) cells. Immunofluorescent staining of hES cells (H9) with cell surface stage-specific embryonic antigens (SSEA-4) and Keratan sulphate-associated antigens (TRA-1-60 and TRA-1-81) antibodys. Photographs were taken using a fluorescence microscope.

control and showed undetectable IC50 values in the tested concentrations from 10–4 to 104 μM during 1, 3, 5 and 7 days. No IC50 values were obtained for any of the embryotoxic chemicals after 1 day of treatment. After 3 days of exposure, IC50 values were 302.38 ± 25.34 μM for 5-fluorouracil and 216.99 ± 15.64 μM for indomethacin. After 5 days of treatment, the IC50 values were 10.81 ± 3.41 μM for 5-fluorouracil and 208.83 ± 10.72 μM for indomethacin. Finally, the IC50 values were 4.21 ± 0.85 μM for 5-fluorouracil and 85.96 ± 10.57 μM for indomethacin after 7 days of exposure. The rate of cell death was found to increase in a dose-dependent manner (Fig. 2 and Table 2). After 5 and 7 days, IC50 values for indomethacin were higher than those of 5-fluorouracil as an embryotoxic chemical. The cytotoxicity of 5-fluorouracil was higher than that of indomethacin. Effect of Embyotoxic Chemicals on the Expression of hES Cell Markers When we selected three log doses for each chemical, the high dose was greater than the IC50 value and the middle and low doses were ones associated with cell viabilities of 60% or more. In order to examine the toxicity of embryotoxic chemicals, hES cells were grown on Matrigel-coated plates without feeder cells. We evaluated hES cell marker genes indicative of the undifferentiated state. The expression of OCT-4, NANOG, endothelin receptor type B (EDNRB) secreted frizzled related protein 2 (SFRP2), teratocarcinoma-derived growth factor 1 (TDGF1) and phosphatase and tensin homolog (PTEN) was analyzed using real-time PCR (Fig. 3). A significant decrease in OCT-4, NANOG, EDNRB, SFRP2 and TDGF1 gene expression was also observed after treatment with 5-fluorouracil (50 μM). Indomethacin significantly decreased NANOG expression at concentrations of 30 and 300 μM. In contrast, 50-μM 5-fluorouracil treatment significantly increased expression of the PTEN gene. No significant differences in gene expression were observed in cells treated with penicillin G. These results indicated that expression of all the tested genes was altered by 5-fluorouracil. And only one marker gene was significantly affected by indomethacin.

wileyonlinelibrary.com/journal/jat

The gene expression profiles of hES cells after being exposed to penicillin G (100 and 1000 μM), 5-fluorouracil (0.5 and 50 μM) or indomethacin (3 and 300 μM) for 5 days were compared with the control by fold ratios > 2. Comparison of the gene expression profiles relative to the dose-matched controls revealed significant differences. In general, we observed that the expression of genes was altered by concentration and embryotoxic activity of the tested chemicals. This time point was chosen because it represents the point at which the change of the undifferentiated genes in hES cells is present during chemical exposure in an undifferentiated condition. In this experiment, we observed a remarkable convergence in the degree of up- or down-regulation of most chemical-responsive genes after the hES cells were treated with 5-fluorouracil or indomethacin or penicillin G. Most of these genes included metabolism, cellular processes, cell communication, developmental process, transport, the cell cycle, the immune system, system process, cellular component organization, and responses to stimuli, cell adhesion, apoptosis, and reproduction. A significant change of biological processes was observed in the developmental process, cell cycle and apoptosis was observed in cells treated with 50 μM of 5-fluorouracil (Fig. 4A). As shown in Fig. 4B, genes associated with the developmental process, cell cycle and apoptosis were highly up- or down-regulated in the hES cells treated with 5-fluorouracil, indomethacin or penicillin G. Some of these genes were selected as markers of embryotoxic activity (Tables 3 and 4), and histone deacetylase 9 (HDAC9), delta-like 1 homolog (DLK1), nuclear factor (erythroid-derived 2)-like 3 (NFE2L3), LIM homeobox 1 (LHX1) and paired related homeobox 1 (PRRX1) were chosen to validate the microarray results by real-time PCR (Fig. 5). Results of the real-time PCR assay were highly correlated with the microarray data. The findings from these analyzes suggest that the genes we selected may be useful as markers for assessing developmental toxicity in hES cells. In addition, we also revealed the total number of transcripts whose levels were changed after embryotoxic-chemical treatment by > two-fold in Table 5. The most effective chemical was 5-fluorouracil that altered the expression patterns of 623 genes at 0.50 μM and 8570 genes at 50 μM. The expression of a relatively high number of genes was changed after exposure to indomethacin (199 genes with 3 μM and 498 genes with 300 μM). In addition, the expression of small number of genes was altered after exposure to the non-embryotoxic penicillin G (36 genes with 100 μM and 231 genes with 1000 μM), as shown in Table 5. Among these developmental toxicants-regulated genes, common genes were sorted by > two-fold by both treatment groups (Table 5).

Discussion Although undifferentiated mES cells have been used as ESTs in previous studies, a more recent study tested the reported embryotoxic chemicals in the cellular context of humans (Kameoka et al., 2014). However, they used the hES cells under conditions of monolayer directed differentiation, and the latter might promote spontaneous and uncontrollable differentiation because this stem cell has a characteristic that spontaneously differentiates to various cell types (Tabar and Studer, 2014). In this study, we maintained the hES cell with the undifferentiated condition and exposed the developmental toxicants to perform gene expression profiling. In order to define embryotoxic

Copyright © 2014 John Wiley & Sons, Ltd.

J. Appl. Toxicol. 2014

Embryotoxic chemicals on human ES cells

Figure 2. Concentration–response curves for the developmental toxicants after exposure for 1, 3, 5 and 7 days. The experiments were performed with human embryonic stem (hES) cells in three independent runs (n = 3).

Table 2. Cytotoxicity (IC50) on the human embryonic stem cells Embrytoxic chemicals Penicillin G 5-fluorouracil Indomethacin

Day 1 day

3 days

5 days

7 days

-

302.38 ± 25.34 μM 216.99 ± 15.64 μM

10.81 ± 3.41 μM 208.83 ± 10.72 μM

4.21 ± 0. 85 μM 85.96 ± 10.57 μM

Data are presented as mean IC50 values of three independent determinations.

J. Appl. Toxicol. 2014

Copyright © 2014 John Wiley & Sons, Ltd.

wileyonlinelibrary.com/journal/jat

E.-M. Jung et al.

Figure 3. Effects of developmental toxicants on undifferentiated hES cells marker genes. The cells were incubated for 5 days in the presence of developmental toxicants with increasing concentrations. The expression of OCT-4, NANOG, EDNRB, SFRP2, TDGF1 and PTEN was measured using quantitative real-time PCR from total RNA. Expression of each genes was normalized to GAPDH expression and was shown as percentage to the control group. Bar graphs summarize the experimental data (mean ± SEM) from three experiments in triplicate. *P < 0.05 versus control.

chemicals in undifferentiated hES cells, we measured cell viability and embryonic-specific genes in hES cells. It was shown that 5-fluorouracil increasingly induces the malformation of rat embryos with higher doses and longer exposure periods. More recent studies have demonstrated that 5-fluorouracil exerts developmental toxic effects on pregnant rodents (Shah and Wong, 1980; Shuey et al., 1994; Lau et al., 2001). Indomethacin (weakly embryotoxic) has many effects on cerebral, mesenteric and renal hemodynamics (Gleason, 1987; Meyers et al., 1991) as well as renal tubular function in fetuses (Rudolph and Heymann, 1978). The standard EST has been useful for evaluating the embryotoxic potential of chemicals using mES cells. However, these methods have only used differentiated ES cells. A recent study showed that a luciferase reporter gene assay with constructs containing the heart and neural crest derivatives expressed transcript 1 (Hand1) and cardiomyopathy associated 1 (Cmya1) promoter could be performed within 6 days on mES cells (Suzuki et al., 2011a). Additionally, the various genes during differentiation were used to identify potential chemical effects by quantitative PCR within 8 to 32 days on mES cells (zur Nieden et al., 2004). Recently, new endpoints of differentiation have been established EST by antibodies against sarcometric alpha-MHC using quantitative flow cytometry in 7 days on mES cells. A flow cytometrybased EST was successfully used to assess developmental toxicity (Buesen et al., 2009). However, hanging-drop methods involving differentiated EBs are expensive and time-consuming. Also, the use of mES cells has limits owing to interspecies distinction (Ginis

wileyonlinelibrary.com/journal/jat

et al., 2004). Therefore, the present study evaluates embryotoxic chemicals in the vitro system using undifferentiated hES cells. Although standard EST methods using hES cells are useful, these techniques have several problems such as requiring more than 10 days to complete, which is a relatively long period for screening embryotoxic chemicals. To overcome this issue, we measured IC50 values of the different embryotoxic chemicals using hES cells after 1, 3, 5 and 7 days of exposure. The IC50 values calculated in our investigation were different from the ones measured in previous studies using hES cells (Adler et al., 2008a; Mehta et al., 2008). The reason for these differences may be because of variances in exposure times, cell lines or other experimental conditions. We measured IC50 values after a maximum 7 days of exposure to the embryotoxic chemicals whereas in other groups we determined the IC50 values after a maximum of 10 or 15 days. Additionally, different cell lines such as H1, SA002 and ReliCell hES1 were used for other investigations (Adler et al., 2008a, 2008b; Mehta et al., 2008). However, we observed the tendency that a IC50 value for 5-fluorouracil or indomethacin is similar to recent research by other groups using with mES and hES cells in ESTs methods (Genschow et al., 2004; Mehta et al., 2008; Suzuki et al., 2012). These results suggest that hES cells and the conditions of our experiments were appropriate for assessing the IC50 values of embryotoxic chemicals within a relatively short period. The results of our gene expression assays showed that penicillin G (non- embryotoxic) did not negatively affect undifferentiated hES cells. However, 5-fluorouracil and indomethacin were toxic.

Copyright © 2014 John Wiley & Sons, Ltd.

J. Appl. Toxicol. 2014

Embryotoxic chemicals on human ES cells

Figure 4. Gene expression profiles after exposure to embryotoxic chemicals. (A) Significantly over-represented gene ontology (GO) by biological process categories. The x-axis represents the GO term and the y-axis represents the number of genes associated with each GO term. (B) Hierarchical clustering plot of developmental process, cell cycle and apoptosis GO biological processes.

Specific ES cell marker genes (OCT-4, NANOG, EDNRB, SFRP2, TDGF1 and PTEN) are important for cellular pluripotency and pre-implantation development (Chambers et al., 2003; Kruger et al., 2003; Walsh and Andrews, 2003; Nichols et al., 1998; Jagtap et al., 2013). We observed down-regulated expression of specific ES cell markers in cells treated with the embryotoxic compounds. OCT-4 and NANOG genes have an essential role in early development. The loss of OCT-4 and NANOG expression in mouse embryos cause failure of the inner cell mass to develop (Nichols et al., 1998; Smith, 2001). Deletion of the Ednrb gene induces embryonic lethality and mutant embryos (Welsh and O’Brien, 2000). Loss of Sfrp2 function results in multiple defects in gonad morphology, reproductive tract maturation and gonad positioning in mice (Warr et al., 2009). Additionally, Tdgf1 is required for mouse embryonic development and Tdgf1 knockout mice have an abnormal anterior–posterior axis (Ding et al., 1998). PTEN expression was increased by higher doses of 5-fluorouracil. Loss of PTEN expression up-regulates Akt pathway signaling and prevents apoptosis in mES cells (Sun et al., 1999). Thus, increased expression of the PTEN gene by 5-fluorouracil may induce the apoptosis of hES cells. Therefore, these ES cell markers in undifferentiated hES cells can be used to evaluate developmental toxicity. In the present study, we used a microarray to observe differentially expressed genes in undifferentiated hES cells after exposure to embryotoxic chemicals and identify new molecular endpoints for ESTs. All the tested compounds in the present

J. Appl. Toxicol. 2014

study altered the expression of several genes. The negative control penicillin G changed the expression of a small number of genes. In contrast, the embryotoxic chemicals altered the levels of a high number of genes. In general, a number of genes related to metabolic process, cellular process and cell communication were regulated by embryotoxic chemicals because the chemicals affected cell survival and genes controlling the general life span of the cells. Interestingly, genes involved in embryonic development, cell cycle regulation and apoptosis were significantly affected. These results were similar to ones from previous microarray studies using mouse stem cells (van Dartel et al., 2010; Schulpen et al., 2012). Furthermore, we confirmed the correlation between the microarray data and real-time PCR results. Selected genes shown in Tables 3 and 4 (i.e. HDAC9, DLK1, NFE2L3, LHX1 and PRRX1) are involved in developmental processes. In the present study, the expression of HDAC9, DLK1 and NFE2L3 was significantly up-regulated by the embryotoxic chemicals. The HDAC9 gene is involved in neuronal, skeletal muscle and adipogenic differentiation (Chang et al., 2004; Mejat et al., 2005; Chatterjee et al., 2011; Aizawa et al., 2012). Transcription levels of histone deacetylase family members are changed during early ES cell differentiation in a tissue-specific manner, and epigenetic markers are modified (Kretsovali et al., 2012). Expression of the DLK1 gene is developmentally regulated during mammalian embryogenesis (da Rocha et al., 2007). DLK1 promotes the differentiation of

Copyright © 2014 John Wiley & Sons, Ltd.

wileyonlinelibrary.com/journal/jat

uridine phosphorylase 1 histone deacetylase 9 delta-like 1 homolog (Drosophila)

GPR87 THSD7A

SERPINI1

VGF NT5E

UPP1 HDAC9*

DLK1*

FAM84A EFEMP1

HGF

PLAU HAND2

CAV2

SHISA9 CYR61 TIMP3 MCF2

NM_023915 NM_015204

NM_001122752

wileyonlinelibrary.com/journal/jat

NM_003378 NM_002526

NM_003364 NM_014707

NM_003836

NM_145175 NM_001039348

NM_000601

NM_001145031 NM_021973

Copyright © 2014 John Wiley & Sons, Ltd.

NM_001233

NM_001145204 NM_001554 NM_000362 NM_001099855

GLI pathogenesis-related 1 zinc finger protein 42 homolog (mouse)

GLIPR1

ZFP42

NM_006851 Indomethacin NM_174900

caveolin 1, caveolae protein, 22kDa

CAV1

NM_001753

shisa homolog 9 (Xenopus laevis) cysteine-rich, angiogenic inducer, 61 TIMP metallopeptidase inhibitor 3 MCF.2 cell line derived transforming sequence

plasminogen activator, urokinase heart and neural crest derivatives expressed 2 caveolin 2

hepatocyte growth factor (hepapoietin A; scatter factor)

family with sequence similarity 84, member A EGF-containing fibulin-like extracellular matrix protein 1

2.20 3 μM 6.29

2.40

2.34 2.56 2.15 2.23

2.70

2.00 2.17

2.54

2.54 2.70

2.16

2.66 3.70

2.20 3.57

2.68

2.58 2.93

3.43 2.95 3.01

secretogranin II growth differentiation factor 15 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 G protein-coupled receptor 87 thrombospondin, type I, domain containing 7A serpin peptidase inhibitor, clade I (neuroserpin), member 1 VGF nerve growth factor inducible 5′-nucleotidase, ecto (CD73)

SCG2 GDF15 SPOCK1

2.28 300 μM 7.67

2.43

2.92 2.83 2.73 2.45

3.01

3.16 3.03

3.21

3.51 3.51

3.79

4.31 4.20

5.02 4.97

5.37

6.73 6.30

17.43 9.08 6.82

50 μM

Fold change (compared with control)

NM_003469 NM_004864 NM_004598

Gene name 0.5 μM

Gene symbol

5-fluorouracil

Transcript ID

Table 3. Overview of the up-regulated genes in a dose-dependent manner

transcription factor activity

structural molecule activity; small GTPase regulator activity Unknown growth factor activity metalloendopeptidase inhibitor activity receptor binding;small GTPase regulator activity; guanyl-nucleotide exchange factor activity structural molecule activity; small GTPase regulator activity Unknown

receptor binding phosphoric diester hydrolase activity; nucleotide phosphatase activity phosphorylase activity oxidoreductase activity; deacetylase activity; nucleic acid binding receptor activity; extracellular matrix structural constituent; receptor binding acyltransferase activity receptor activity;calcium ion binding; cal modulin binding; calcium-dependent phospholipid binding serine-type peptidase activity; calcium ion binding; hormone activity; growth factor activity serine-type peptidase activity transcription factor activity

serine-type endopeptidase inhibitor activity

neuropeptide hormone activity growth factor activity calcium ion binding; cysteine-type endopeptidase inhibitor activity G-protein coupled receptor activity Unknown

Gene function

E.-M. Jung et al.

J. Appl. Toxicol. 2014

J. Appl. Toxicol. 2014

CAPN6

SLC1A6

CXCL14 GDF6 EGFL6

DKK2 RHBDD1 VTCN1

RPL39L

LOC100131541 EPB41L4B

RUNX1 MYLK C13orf15 OBFC2A

TIMP3 NFE2L3*

RASGRP1

RASSF2

NM_014289

NM_005071

NM_004887 NM_001001557 NM_001167890

NM_014421 NM_001167608 NM_024626

NM_052969

XR_110905 NM_018424

NM_001001890 NM_053025 NM_014059 NM_001031716

NM_000362 NM_004289

NM_001128602

Copyright © 2014 John Wiley & Sons, Ltd.

NM_014737

Altered genes with fold changes of ≥ 2 are shown. * These altered genes were selected for verification by real-time PCR.

RAS guanyl releasing protein 1 (calcium and DAG-regulated) Ras association (RalGDS/AF-6) domain family member 2

hypothetical LOC100131541 erythrocyte membrane protein band 4.1 like 4B runt-related transcription factor 1 myosin light chain kinase chromosome 13 open reading frame 15 oligonucleotide/oligosaccharide-binding fold containing 2A TIMP metallopeptidase inhibitor 3 nuclear factor (erythroid-derived 2)-like 3

dickkopf homolog 2 (Xenopus laevis) rhomboid domain containing 1 V-set domain containing T cell activation inhibitor 1 ribosomal protein L39-like

solute carrier family 1 (high affinity aspartate/ glutamate transporter), member 6 chemokine (C-X-C motif) ligand 14 growth differentiation factor 6 EGF-like-domain, multiple 6

calpain 6

2.22

2.03

2.12 2.15

2.03 2.33 2.08 2.25

2.24 2.00

2.11

3.01 2.01 2.75

2.55 2.81 2.84

2.18

3.21

5.27 3.72 2.18

leukocyte cell derived chemotaxin 1 zinc finger protein 22 (KOX 15) ATP-binding cassette, sub-family A (ABC1), member 8

LECT1 ZNF22 ABCA8

2.03

2.04

2.24 2.19

2.42 2.36 2.33 2.32

2.66 2.47

2.81

3.02 2.85 2.83

3.56 3.37 3.12

3.70

4.24

6.68 6.63 5.02

50 μM

Fold change (compared with control)

NM_001011705 NM_006963 NM_007168

Gene name 0.5 μM

Gene symbol

5-fluorouracil

Transcript ID

Table 3. (Continued)

metalloendopeptidase inhibitor activity serine-type peptidase activity; structural constituent of cytoskeleton; transcription factor activity small GTPase regulator activity; guanyl-nucleotide exchange factor activity small GTPase regulator activity

transcription factor activity protein kinase activity Unknown nucleic acid binding

structural constituent of ribosome; nucleic acid binding Unknown Unknown

Unknown growth factor activity receptor activity; extracellular matrix structural constituent; transcription factor activity;receptor binding Unknown serine-type peptidase activity Unknown

Unknown transcription factor activity ATPase activity, coupled to transmembrane movement of substances; transmembrane transporter activity cysteine-type peptidase activity;calcium ion binding; calmodulin binding cation transmembrane transporter activity

Gene function

Embryotoxic chemicals on human ES cells

wileyonlinelibrary.com/journal/jat

wileyonlinelibrary.com/journal/jat

leucine-rich repeat-containing G protein-coupled receptor 5 LIM homeobox 1

DCN ANXA8

IGFBP5

LGR5

LHX1*

DNAH2

RPS6P6 HOXB3 ABHD12B COL2A1

MYL4

LEFTY2 FABP7 TYRP1 TNFRSF19

CER1

WNT8A

HOXA1

NM_001920 NM_001040084

NM_000599

NM_001134 5-fluorouracil NM_003667

NM_005568

NM_020877

NM_001080506 NM_002146 NM_181814 NM_001844

NM_001002841

NM_003240 NM_001446 NM_000550 NM_018647

NM_005454

NM_058244

NM_005522

AFP

insulin-like growth factor binding protein 5 alpha-fetoprotein

FRZB TTR IGF2

NM_001463 NM_000371 NM_000612

Copyright © 2014 John Wiley & Sons, Ltd.

left-right determination factor 2 fatty acid binding protein 7, brain tyrosinase-related protein 1 tumor necrosis factor receptor super family, member 19 cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) wingless-type MMTV integration site family, member 8A homeobox A1

myosin, light chain 4, alkali; atrial, embryonic

ribosomal protein S6 pseudogene 6 homeobox B3 abhydrolase domain containing 12B collagen, type II, alpha 1

dynein, axonemal, heavy chain 2

2.13

3.15

2.08

4.07 3.47 2.19 2.15

2.25

2.79 2.02 4.51 5.17

2.43

2.02

2.23 0.5 μM 2.26

2.42

2.31 2.62

2.81 4.06 2.12

2.37

matrix metallopeptidase 1 (interstitial collagenase) frizzled-related protein transthyretin insulin-like growth factor 2 (somatome din A) decorin annexin A8

MMP1

3.26

3.61

3.64

5.96 4.80 4.12 4.01

6.82

8.54 8.24 7.24 7.15

9.92

12.45

2.50 50 μM 25.73

3.09

3.37 3.32

4.66 4.21 3.82

5.25

1000 μM

Fold change (compared with the control)

NM_002421

Gene name 100 μM

Gene symbol

Penicillin G

Transcript ID

Table 4. Overview of the down-regulated genes in a dose-dependent manner

transcription factor activity

receptor binding

Unknown

structural constituent of cytoskeleton; transcription factor activity; RNA binding microtubule motor activity; hydrolase activity; structural constituent of cytoskeleton Unknown transcription factor activity Unknown receptor activity; extracellular matrix structural constituent; transmem brane transporter activity structural constituent of cytoskeleton; calcium ion binding; calmodulin binding growth factor activity lipid binding oxidoreductase activity Unknown

receptor activity

Unknown

receptor activity calcium ion binding; calcium-depen dent phospholipid binding Unknown

G-protein coupled receptor activity transmembrane transporter activity hormone activity; growth factor activity

metallopeptidase activity

Gene function

E.-M. Jung et al.

J. Appl. Toxicol. 2014

J. Appl. Toxicol. 2014

CDX2 HOXD1

COL2A1

HOXD4 ARMCX1 HOXD3 TTR HOXD1 NR4A2

LOC404266

NM_001265 NM_024501 Indomethacin NM_001844

NM_014621 NM_016608 NM_006898 NM_000371 NM_024501 NM_006186

NR_033201

Altered genes with fold changes of ≥ 2 are shown. * , These altered genes were selected for verification by real-time PCR.

homeobox D4 armadillo repeat containing, X-linked 1 homeobox D3 transthyretin homeobox D1 nuclear receptor subfamily 4, group A, member 2 hypothetical LOC404266

collagen, type II, alpha 1

MGMT

NM_002412

2.28

3.01 2.98 2.31 2.58 2.27 2.27

2.04 2.03 3 μM 5.03

2.02

2.74 2.74 2.00 2.11

SRY (sex determining region Y)-box 17 paired related homeobox 1 stomatin cadherin 6, type 2, K-cadherin (fetal kidney) O-6-methylguanine-DNA methyltransferase caudal type homeobox 2 homeobox D1

SOX17 PRRX1* STOM CDH6

2.31

3.14 3.13 3.10 2.89 2.71 2.64

2.07 2.03 300 μM 6.63

2.13

3.20 2.91 2.48 2.44

1000 μM

Fold change (compared with the control)

NM_022454 NM_006902 NM_004099 NM_004932

Gene name 100 μM

Gene symbol

Penicillin G

Transcript ID

Table 4. (Continued)

receptor activity;extracellular matrix structural constituent; transmembrane transporter activity growth factor activity Unknown transcription factor activity transmembrane transporter activity transcription factor activity ligand-dependent nuclear receptor activity; transcription factor activity Unknown

transcription factor activity transcription factor activity structural constituent of cytoskeleton G-protein coupled receptor activity; calcium ion binding DNA-methyltransferase activity; nucleic acid binding transcription factor activity transcription factor activity

Gene function

Embryotoxic chemicals on human ES cells

Copyright © 2014 John Wiley & Sons, Ltd.

wileyonlinelibrary.com/journal/jat

E.-M. Jung et al.

Figure 5. Confirmation of gene profiles by real-time PCR analysis. Relative values of expression of the altered genes quantified by real-time PCR are shown in the graphs, indicating the comparison of fold change determined by real-time PCR analysis. The expression of HDAC9, DLK1, NFE2L3, LHX1 and PRRX1 was measured and normalized to GAPDH expression. Bar graphs represent the experimental data (mean ± SEM) from three experiments in triplicate. *P < 0.05 versus the control.

Table 5. Number of significantly differentially expressed genes after non-embryotoxic or embryotoxic chemicals exposure Embryotoxic chemicals

Penicillin G 5-fluorouracil Indomethacin

Concentration

Differentially expressed genes after embryotoxic chemicals exposure (n)

100 μM 1000 μM 0.5 μM 50 μM 3 μM 300 μM

36 231 623 8570 199 498

Common genes differentially expressed in both embryotoxic chemicals exposed groups (n) Penicillin G

5-fluorouracil

Indomethacin

100 μM

1000 μM

0.5 μM

50 μM

3 μM

300 μM

17 18 27 21 15

27 141 34 21

214 86 250

107 156

61

-

A fold ratios ≥ two was used to select genes.

multipotent mesenchymal cells into a chondrogenic lineage but inhibits the transition into an adipocyte lineage (Wang and Sul, 2009). The NFE2L3 gene is linked to differentiation, inflammation and carcinogenesis (Chevillard and Blank, 2011). NFE2L3 mRNA levels are significantly increased in non-human primate pluripotent stem cells (Byrne et al., 2007; Ben-Yehudah et al., 2010). Thus, the NFE2L3 gene has been proposed to be a stem cell marker. We found that the embryotoxic chemicals significantly decreased expression of the LHX1 and PRRX1 genes. LHX1

wileyonlinelibrary.com/journal/jat

knock-out mice lack anterior head structures, and this factor plays an important role in stabilizing the intermediated mesoderm (Shawlot and Behringer, 1995; Pedersen et al., 2005). The PRRX1 gene potentially controls lung endothelial cell differentiation, and regulates the differentiation of mesenchymal cells into neural crest cells (Leussink et al., 1995; Ihida-Stansbury et al., 2004). Our data indicated that expression of LHX1 and PRRX1 was significantly changed after treatment with the embryotoxic chemicals. Therefore, these genes could serve as biomarkers for ESTs measuring developmental toxicity.

Copyright © 2014 John Wiley & Sons, Ltd.

J. Appl. Toxicol. 2014

Embryotoxic chemicals on human ES cells In conclusion, we developed an experimental method to test embryo toxicity using undifferentiated hES cells, and our system can be used as a model for assessing developmental toxicity of embryotoxic chemicals. Furthermore, findings from the present study may help elucidate drug-dependent alterations of ES cell-specific gene expression in undifferentiated hES cells. Our study may be particularly important for the assessment of new chemicals by evaluation of cell viability and ES cell-specific gene in undifferentiated hES cells. Acknowledgments This study was supported by a grant (12182KFDA638) from the Korea Food and Drug Administration.

Conflict of Interest The Authors did not report any conflict of interest.

References Adler S, Lindqvist J, Uddenberg K, Hyllner J, Strehl R. 2008a. Testing potential developmental toxicants with a cytotoxicity assay based on human embryonic stem cells. Altern. Lab. Anim. 36: 129–140. Adler S, Pellizzer C, Hareng L, Hartung T, Bremer S. 2008b. First steps in establishing a developmental toxicity test method based on human embryonic stem cells. Toxicol. In Vitro 22: 200–211. Aizawa S, Teramoto K, Yamamuro Y. 2012. Histone deacetylase 9 as a negative regulator for choline acetyltransferase gene in NG108-15 neuronal cells. Neuroscience 205: 63–72. Ben-Yehudah A, Easley CAt, Hermann BP, Castro C, Simerly C, Orwig KE, Mitalipov S, Schatten G. 2010. Systems biology discoveries using non-human primate pluripotent stem and germ cells: novel gene and genomic imprinting interactions as well as unique expression patterns. Stem Cell Res. Ther. 1: 24. Bremer S, Worth AP, Paparella M, Bigot K, Kolossov E, Fleischmann BK, Hescheler J, Balls M. 2001. Establishment of an in vitro reporter gene assay for developmental cardiac toxicity. Toxicol. In Vitro 15: 215–223. Buesen R, Visan A, Genschow E, Slawik B, Spielmann H, Seiler A. 2004. Trends in improving the embryonic stem cell test (EST): an overview. ALTEX 21: 15–22. Buesen R, Genschow E, Slawik B, Visan A, Spielmann H, Luch A, Seiler A. 2009. Embryonic stem cell test remastered: comparison between the validated EST and the new molecular FACS-EST for assessing developmental toxicity in vitro. Toxicol. Sci. 108: 389–400. Byrne JA, Pedersen DA, Clepper LL, Nelson M, Sanger WG, Gokhale S, Wolf DP, Mitalipov SM. 2007. Producing primate embryonic stem cells by somatic cell nuclear transfer. Nature 450: 497–502. Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, Smith A. 2003. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 113: 643–655. Chang S, McKinsey TA, Zhang CL, Richardson JA, Hill JA, Olson EN. 2004. Histone deacetylases 5 and 9 govern responsiveness of the heart to a subset of stress signals and play redundant roles in heart development. Mol. Cell. Biol. 24: 8467–8476. Chatterjee TK, Idelman G, Blanco V, Blomkalns AL, Piegore MG Jr, Weintraub DS, Kumar S, Rajsheker S, Manka D, Rudich SM, Tang Y, Hui DY, Bassel-Duby R, Olson EN, Lingrel JB, Ho SM, Weintraub NL. 2011. Histone deacetylase 9 is a negative regulator of adipogenic differentiation. J. Biol. Chem. 286: 27836–27847. Chavez SL, Meneses JJ, Nguyen HN, Kim SK, Pera RA. 2008. Characterization of six new human embryonic stem cell lines (HSF7, -8, -9, 10, -12, and -13) derived under minimal-animal component conditions. Stem Cells Dev. 17: 535–546. Chevillard G, Blank V. 2011. NFE2L3 (NRF3): the Cinderella of the Cap’n’Collar transcription factors. Cell. Mol. Life Sci. 68: 3337–3348. van Dartel DA, Pennings JL, de la Fonteyne LJ, van Herwijnen MH, van Delft JH, van Schooten FJ, Piersma AH. 2010. Monitoring developmental toxicity in the embryonic stem cell test using differential gene expression of differentiation-related genes. Toxicol. Sci. 116: 130–139.

J. Appl. Toxicol. 2014

Ding J, Yang L, Yan YT, Chen A, Desai N, Wynshaw-Boris A, Shen MM. 1998. Cripto is required for correct orientation of the anteriorposterior axis in the mouse embryo. Nature 395: 702–707. Flora SJ, Mehta A. 2009. Monoisoamyl dimercaptosuccinic acid abrogates arsenic-induced developmental toxicity in human embryonic stem cell-derived embryoid bodies: comparison with in vivo studies. Biochem. Pharmacol. 78: 1340–1349. Genschow E, Scholz G, Brown NA, Piersma AH, Brady M, Clemann N, Huuskonen H, Paillard F, Bremer S, Spielmann H. 1999. Development of prediction models for three in vitro embryotoxicity tests which are evaluated in an ECVAM validation study. ALTEX 16: 73–83. Genschow E, Scholz G, Brown N, Piersma A, Brady M, Clemann N, Huuskonen H, Paillard F, Bremer S, Becker K, Spielmann H. 2000. Development of prediction models for three in vitro embryotoxicity tests in an ECVAM validation study. In Vitro Mol. Toxicol. 13: 51–66. Genschow E, Spielmann H, Scholz G, Pohl I, Seiler A, Clemann N, Bremer S, Becker K. 2004. Validation of the embryonic stem cell test in the international ECVAM validation study on three in vitro embryotoxicity tests. Altern. Lab. Anim. 32: 209–244. Gepstein L. 2002. Derivation and potential applications of human embryonic stem cells. Circ. Res. 91: 866–876. Ginis I, Luo Y, Miura T, Thies S, Brandenberger R, Gerecht-Nir S, Amit M, Hoke A, Carpenter MK, Itskovitz-Eldor J, Rao MS. 2004. Differences between human and mouse embryonic stem cells. Dev. Biol. 269: 360–380. Gleason CA. 1987. Prostaglandins and the developing kidney. Semin. Perinatol. 11: 12–21. Heuer J, Bremer S, Pohl I, Spielmann H. 1993. Development of an in vitro embryotoxicity test using murine embryonic stem cell cultures. Toxicol. In Vitro 7: 551–556. Ihida-Stansbury K, McKean DM, Gebb SA, Martin JF, Stevens T, Nemenoff R, Akeson A, Vaughn J, Jones PL. 2004. Paired-related homeobox gene Prx1 is required for pulmonary vascular development. Circ. Res. 94: 1507–1514. Jagtap S, Meganathan K, Wagh V, Natarajan K, Hescheler J, Sachinidis A. 2013. All-trans retinoic acid and basic fibroblast growth factor synergistically direct pluripotent human embryonic stem cells to extraembryonic lineages. Stem Cell Res. 10: 228–240. Jensen J, Hyllner J, Bjorquist P. 2009. Human embryonic stem cell technologies and drug discovery. J. Cell. Physiol. 219: 513–519. Kameoka S, Babiarz J, Kolaja K, Chiao E. 2014. A high-throughput screen for teratogens using human pluripotent stem cells. Toxicol. Sci. 137: 76–90. Kretsovali A, Hadjimichael C, Charmpilas N. 2012. Histone deacetylase inhibitors in cell pluripotency, differentiation, and reprogramming. Stem Cells Int. 2012: 184154. Krtolica A, Giritharan G. 2010. Use of human embryonic stem cell-based models for male reproductive toxicity screening. Syst. Biol. Reprod. Med. 56: 213–221. Krtolica A, Ilic D, Genbacev O, Miller RK. 2009. Human embryonic stem cells as a model for embryotoxicity screening. Regen. Med. 4: 449–459. Krug AK, Kolde R, Gaspar JA, Rempel E, Balmer NV, Meganathan K, Vojnits K, Baquie M, Waldmann T, Ensenat-Waser R, Jagtap S, Evans RM, Julien S, Peterson H, Zagoura D, Kadereit S, Gerhard D, Sotiriadou I, Heke M, Natarajan K, Henry M, Winkler J, Marchan R, Stoppini L, Bosgra S, Westerhout J, Verwei M, Vilo J, Kortenkamp A, Hescheler J, Hothorn L, Bremer S, van Thriel C, Krause KH, Hengstler JG, Rahnenfuhrer J, Leist M, Sachinidis A. 2013. Human embryonic stem cell-derived test systems for developmental neurotoxicity: a transcriptomics approach. Arch. Toxicol. 87: 123–143. Kruger GM, Mosher JT, Tsai YH, Yeager KJ, Iwashita T, Gariepy CE, Morrison SJ. 2003. Temporally distinct requirements for endothelin receptor B in the generation and migration of gut neural crest stem cells. Neuron 40: 917–929. Lau C, Mole ML, Copeland MF, Rogers JM, Kavlock RJ, Shuey DL, Cameron AM, Ellis DH, Logsdon TR, Merriman J, Setzer RW. 2001. Toward a biologically based dose-response model for developmental toxicity of 5-fluorouracil in the rat: acquisition of experimental data. Toxicol. Sci. 59: 37–48. Lee JB, Kim JM, Kim SJ, Park JH, Hong SH, Roh SI, Kim MK, Yoon HS. 2005. Comparative characteristics of three human embryonic stem cell lines. Mol. Cells 19: 31–38. Leussink B, Brouwer A, el Khattabi M, Poelmann RE, Gittenberger-de Groot AC, Meijlink F. 1995. Expression patterns of the paired-related homeobox genes MHox/Prx1 and S8/Prx2 suggest roles in development of the heart and the forebrain. Mech. Dev. 52: 51–64.

Copyright © 2014 John Wiley & Sons, Ltd.

wileyonlinelibrary.com/journal/jat

E.-M. Jung et al. Martin GR. 1981. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. U. S. A. 78: 7634–7638. Mehta A, Konala VB, Khanna A, Majumdar AS. 2008. Assessment of drug induced developmental toxicity using human embryonic stem cells. Cell Biol. Int. 32: 1412–1424. Mejat A, Ramond F, Bassel-Duby R, Khochbin S, Olson EN, Schaeffer L. 2005. Histone deacetylase 9 couples neuronal activity to muscle chromatin acetylation and gene expression. Nat. Neurosci. 8: 313–321. Meyers RL, Alpan G, Lin E, Clyman RI. 1991. Patent ductus arteriosus, indomethacin, and intestinal distension: effects on intestinal blood flow and oxygen consumption. Pediatr. Res. 29: 569–574. Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klewe-Nebenius D, Chambers I, Scholer H, Smith A. 1998. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 95: 379–391. Paquette JA, Kumpf SW, Streck RD, Thomson JJ, Chapin RE, Stedman DB. 2008. Assessment of the Embryonic Stem Cell Test and application and use in the pharmaceutical industry. Birth Defects Res. B Dev. Reprod. Toxicol. 83: 104–111. Pedersen A, Skjong C, Shawlot W. 2005. Lim 1 is required for nephric duct extension and ureteric bud morphogenesis. Dev. Biol. 288: 571–581. da Rocha ST, Tevendale M, Knowles E, Takada S, Watkins M, FergusonSmith AC 2007. Restricted co-expression of Dlk1 and the reciprocally imprinted non-coding RNA, Gtl2: implications for cis-acting control. Dev. Biol. 306: 810–823. Rosner MH, Vigano MA, Ozato K, Timmons PM, Poirier F, Rigby PW, Staudt LM. 1990. A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature 345: 686–692. Rudolph AM, Heymann MA. 1978. Hemodynamic changes induced by blockers of prostaglandin synthesis in the fetal lamb in utero. Adv. Prostaglandin Thromboxane Res. 4: 231–237. Scholz G, Genschow E, Pohl I, Bremer S, Paparella M, Raabe H, Southee J, Spielmann H. 1999a. Prevalidation of the Embryonic Stem Cell Test (EST)-A New In Vitro Embryotoxicity Test. Toxicol. In Vitro 13: 675–681. Scholz G, Pohl I, Genschow E, Klemm M, Spielmann H. 1999b. Embryotoxicity screening using embryonic stem cells in vitro: correlation to in vivo teratogenicity. Cells Tissues Organs 165: 203–211. Schulpen SH, Robinson JF, Pennings JL, van Dartel DA, Piersma AH. 2012. Dose response analysis of monophthalates in the murine embryonic stem cell test assessed by cardiomyocyte differentiation and gene expression. Reprod. Toxicol. 35: 81–88. Seiler AE, Spielmann H. 2011. The validated embryonic stem cell test to predict embryotoxicity in vitro. Nat. Protoc. 6: 961–978. Seiler A, Visan A, Buesen R, Genschow E, Spielmann H. 2004. Improvement of an in vitro stem cell assay for developmental toxicity: the use of molecular endpoints in the embryonic stem cell test. Reprod. Toxicol. 18: 231–240. Shah RM, Wong DT. 1980. Morphological study of cleft palate development in 5-fluorouracil-treated hamster fetuses. J. Embryol. Exp. Morphol. 57: 119–128. Shawlot W, Behringer RR. 1995. Requirement for Lim1 in head-organizer function. Nature 374: 425–430. Shuey DL, Lau C, Logsdon TR, Zucker RM, Elstein KH, Narotsky MG, Setzer RW, Kavlock RJ, Rogers JM. 1994. Biologically based dose-response

wileyonlinelibrary.com/journal/jat

modeling in developmental toxicology: biochemical and cellular sequelae of 5-fluorouracil exposure in the developing rat. Toxicol. Appl. Pharmacol. 126: 129–144. Smith AG. 2001. Embryo-derived stem cells: of mice and men. Annu. Rev. Cell Dev. Biol. 17: 435–462. Spielmann H, Genschow E, Scholz G, Brown NA, Piersma AH, Brady M, Clemann N, Huuskonen H, Paillard F, Bremer S, Becker K. 2001. Preliminary results of the ECVAM validation study on three in vitro embryotoxicity tests. Altern. Lab. Anim. 29: 301–303. Sun H, Lesche R, Li DM, Liliental J, Zhang H, Gao J, Gavrilova N, Mueller B, Liu X, Wu H. 1999. PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway. Proc. Natl. Acad. Sci. U. S. A. 96: 6199–6204. Suzuki N, Ando S, Sumida K, Horie N, Saito K. 2011a. Analysis of altered gene expression specific to embryotoxic chemical treatment during embryonic stem cell differentiation into myocardiac and neural cells. J. Toxicol. Sci. 36: 569–585. Suzuki N, Ando S, Yamashita N, Horie N, Saito K. 2011b. Evaluation of novel high-throughput embryonic stem cell tests with new molecular markers for screening embryotoxic chemicals in vitro. Toxicol. Sci. 124: 460–471. Suzuki N, Yamashita N, Koseki N, Yamada T, Kimura Y, Aiba S, Toyoizumi T, Watanabe M, Ohta R, Tanaka N, Saito K. 2012. Assessment of technical protocols for novel embryonic stem cell tests with molecular markers (Hand1- and Cmya1-ESTs): a preliminary cross-laboratory performance analysis. J. Toxicol. Sci. 37: 845–851. Tabar V, Studer L. 2014. Pluripotent stem cells in regenerative medicine: challenges and recent progress. Nat. Rev. Genet. 15: 82–92. Taha MF, Valojerdi MR, Hatami L, Javeri A. 2012. Electron microscopic study of mouse embryonic stem cell-derived cardiomyocytes. Cytotechnology 64: 197–202. Trounson A. 2002. Human embryonic stem cells: mother of all cell and tissue types. Reprod. Biomed. Online 4(Suppl 1): 58–63. Walsh J, Andrews PW. 2003. Expression of Wnt and Notch pathway genes in a pluripotent human embryonal carcinoma cell line and embryonic stem cell. APMIS 111: 197–210; discussion 210–291. Wang Y, Sul HS. 2009. Pref-1 regulates mesenchymal cell commitment and differentiation through Sox9. Cell Metab. 9: 287–302. Warr N, Siggers P, Bogani D, Brixey R, Pastorelli L, Yates L, Dean CH, Wells S, Satoh W, Shimono A, Greenfield A. 2009. Sfrp1 and Sfrp2 are required for normal male sexual development in mice. Dev. Biol. 326: 273–284. Welsh IC, O’Brien TP. 2000. Loss of late primitive streak mesoderm and interruption of left-right morphogenesis in the Ednrb(s-1Acrg) mutant mouse. Dev. Biol. 225: 151–168. Wright AJ, Andrews PW. 2009. Surface marker antigens in the characterization of human embryonic stem cells. Stem Cell Res. 3: 3–11. Yamanaka S, Li J, Kania G, Elliott S, Wersto RP, Van Eyk J, Wobus AM, Boheler KR. 2008. Pluripotency of embryonic stem cells. Cell Tissue Res. 331: 5–22. zur Nieden NI, Kempka G, Ahr HJ. 2004. Molecular multiple endpoint embryonic stem cell test--a possible approach to test for the teratogenic potential of compounds. Toxicol. Appl. Pharmacol. 194: 257–269.

Copyright © 2014 John Wiley & Sons, Ltd.

J. Appl. Toxicol. 2014