Cellular Immunology 289 (2014) 76–85

Contents lists available at ScienceDirect

Cellular Immunology journal homepage: www.elsevier.com/locate/ycimm

Evaluation of Leishmania donovani disulfide isomerase as a potential target of cellular immunity against visceral leishmaniasis Ajay Amit, Rajesh Chaudhary, Anupam Yadav, Shashi S. Suman, Shyam Narayan, V.N.R. Das, K. Pandey, S.K. Singh, Bipin K. Singh, Vahab Ali, Pradeep Das, Sanjiva Bimal ⇑ Rajendra Memorial Research Institute of Medical Sciences (Indian Council of Medical Research), Patna, India

a r t i c l e

i n f o

Article history: Received 26 March 2013 Accepted 24 March 2014 Available online 3 April 2014 Keywords: Visceral leishmaniasis Leishmania donovani Protein disulfide isomerase Interleukin-10 Lactate dehydrogenase Inducible nitric oxide Interferon-gamma

a b s t r a c t In Leishmania species, protein disulfide isomerase (PDI) – a redox chaperone is primarily associated with virulence and survival. The precise mechanism, especially in relation to redox changes and its effects on immunological responses in visceral leishmaniasis (VL) is not completely understood as yet. Therefore, we purified a recombinant PDI from Leishmania donovani (r-LdPDI) which was of 15 kDa molecular size and examined its effects on immunological responses in peripheral blood (PBMC) of human VL cases. For these studies, alanine was tested as an inhibitor and was used in parallel to all experiments. This protein was identified to have a direct correlation with parasite growth which significantly increased number of promastigotes as well as axenic amastigotes after 96 h of culture. Our experiments examining the immunological response against r-LdPDI also indicate the activation of pro-L. donovani dictated immunological responses in VL. The stimulation of PBMC with r-LdPDI induced lactate dehydrogenase (LDH) activities and up regulated interleukin-10 (IL-10) production but not the HLA-DR expression, Nitric oxide (NO) release and IFN-c production indicating a pivoted role for r-LdPDI in causing a strong immunosuppression in a susceptible host. Further, we observed that an addition of alanine in L. donovani culture offers a significant inhibition in growth of parasite and helps in reconstitution of protective immune response in VL cases. Therefore, we demonstrate a future cross talk on use of alanine which can reduce the activities of PDI of L. donovani, eliminating the parasite induced immunosuppression and inducing collateral host protective response in VL. Ó 2014 Elsevier Inc. All rights reserved.

1. Introduction Visceral leishmaniasis (VL) commonly known as Kala-Azar is caused by Leishmania donovani and Leishmania infantum in the old world and Leishmania chagassi in the new world. Most of the infected individuals develop symptomatic disease due to spread of parasites in the spleen, liver, lymph node and other organs and becomes fatal without specific chemotherapy [14,12,46,35]. Previous studies have shown that the suppression of the specific Th1 kind of immune response as shown by decreasing production of IFN-c and IL-12 in the patients promotes disease susceptibility and this suppression is critically regulated by interleukin (IL)-10, a pleiotropic cytokine secreted from different cell types including the macrophages [9]. Recombinant IL-10 was reported to have inhibitory effect towards nitric oxide (NO) mediated killing of Leishmania in ⇑ Corresponding author. Address: Div. of Immunology, Rajendra Memorial Research Institute of Medical Sciences, Indian Council of Medical Research, Agamkuan, Patna 800007, India. Fax: +91 612 2634379. E-mail address: [email protected] (S. Bimal). http://dx.doi.org/10.1016/j.cellimm.2014.03.011 0008-8749/Ó 2014 Elsevier Inc. All rights reserved.

human macrophages [49]. In the endemic areas, many individuals do not manifest clinical symptoms but show elevated Th-1 like immune response. This may be due to stimulation of protective immune response in them by Leishmania antigens [9]. Therefore, any intervention that helps the shift of immune response from Th-2 type towards Th-1 will have a major role in cure and prevention of VL. Such goal can be achieved through identifying the immunological mechanisms which the Leishmanial antigens may target during the metabolic pathways particularly those that underlie T cell unresponsiveness and accompanies the disease. Such a unique enzyme target present in Leishmania can be protein disulfide isomerase (PDI) which remains highly abundant in the lumen of the endoplasmic reticulum [18]. It belongs to a member of the thioredoxin superfamily which can catalyse thiol disulfide interchange ensuring the proper folding and conformation of newly synthesized proteins and preventing cell toxicity due to ER stress [20,16,27,50,25]. In addition to its redox/isomerise activities, PDI was observed with chaperone activity which can increase the refolding of denatured lysozyme [40] and acid phospholipase A2 [51]. A typical PDI protein is composed of four

A. Amit et al. / Cellular Immunology 289 (2014) 76–85

consecutive thioredoxin-like domains (a–b–b0 –a0 ) of which only two, a and a0 contain the characteristic CXXC active site motif [17] with two cysteine residues regulating the redox potential of the enzyme and its function as a thiol-disulfide reductase, oxidase or isomerise [16]. The domains of PDI are enveloped by an N-terminal signal peptide which helps in translocation of the protein into the ER and a C-terminus c domain that is rich in acidic amino acids and contains the KEDL retention signal [17]. The PDI of L. donovani is in contrast to other reported PDI because it lacks the ER retention signal KEDL and have only one active thioredoxin site instead of two. The PDIs plays a pivoted role in a number of process involved in cell function and development during infectious diseases [23]. PDI proteins have been reported to help in accumulation of misfolded proteins triggered by oxidative stress in neurodegenerating disease [48]. In parasites such as Chlamydia, an obligate intracellular bacterial pathogen of eukaryotic cells, native PDI is required for effective attachment on the cell surface [11]. Likewise, it was reported to be involved in the adhesion of Neospora caninum techyzoites to host cells [37]. In addition, this protein is possibly involved in defence against protozoan parasites [31]. To date, little is known about the role of PDI in lower eukaryotes such as protozoan parasite, L. donovani and its relevance to host parasite interaction during visceral leishmaniasis. The precise mechanism, especially in relation to redox changes and its effects on immunological responses is also not completely understood [43,34,33,44]. The characterisation of PDIs obviously has important implication for the design of new drug or vaccine against Leishmania parasites. Two groups have reported a 15kDa atypical PDI with only one catalysing site ‘‘CGHC’’ [38] and a 55-kDa PDI [25] in L. donovani. In this study, we expressed the enzyme encoding 15-kDa PDI protein of L. donovani and the potential function of recombinant LdPDI (r-LdPDI) on infection and immune response was assessed by growth analysis, Lactate dehydrogenase (LDH) and acid phosphatase (ACP) release, nitric oxide (NO) production, HLA-DR expression and cytokine interleukin-10 (IL-10) and IFN-gamma (IFN-c) estimation in infected Leishmania patient. We show that protein of PDI promotes L. donovani infection, rendering macrophages more toxic which up regulates immunosuppressive factors such as IL-10 and causes retardation of anti-Leishmania activity of macrophage and that it also interrupts in the induction of protective T-cell response in VL patients. Moreover we also identify alanine as PDI modifying agent which can be a future strategy for the treatment of Kala-Azar (KA) cases.

77

2.2. Parasite cultures L. donovani parasites (AG83) were used in this study. The promastigote stains were maintained in Tobies biphasic medium and mass-cultured in RPMI-1640 medium (GIBCO, Invitrogen, USA) containing 20% heat inactivated foetal bovine serum (FBS; GIBCO, Invitrogen, USA) and 25 mM HEPES buffer (pH 7.2–7.4), 100 units/ml penicillin and 100 lg/ml streptomycin. Culture was set up at 2  106 parasites/ml and grown at 24 ± 1 °C in BOD incubator for 4–5 days before sub culturing (late log phase) which was harvested by centrifugation as described previously [13]. Axenic amastigote of L. donovani parasites (AG83) were generated from the promastigote forms at 37 °C in a CO2 incubator using the media described above at pH 5.5 [8,45]. Cultures were maintained through serial sub-culturing for further studies. 2.3. PCR amplification and cloning of PDI from L. donovani The LdPDI ORF was amplified from first strand cDNA (2 ll) with a sense (50 GCGGAATTCGGAGATTGTCGAGCTCAACC30 ) and an antisense (50 CGCCTCGAGCTGCTTGTTGGCCGC30 ) primers, where the EcoRI and xhol-sites are underlined and the translational initiation codons are italicised. These primers (Sigma, St. Louis, MO, USA) were designed to clone LdPDI in vector pET22 b (+) plasmid with a histidine tag at the amino terminus. PCR was performed in a 50 ll reaction mixture containing 0.2 mM each dNTPs, 2.0 mM MgCl2, 1.0 lM each primer, 1 lg L. donovani (Ag83) cDNA and 1.0 pfu DNA polymerase and 2 U Taq DNA polymerase with a Taq buffer (+NH2SO4). The conditions used for PCR was start at 95 °C for 5 min, denaturation at 95 °C for 30 s, annealing at 56 °C for 30 s, elongation at 72 °C for 2.5 min and subjected to 40 cycles with a final extension for 2 min at 72 °C. A 380 bp PCR product was observed on 1% agarose gel electrophoresis. This PCR product was double digested with EcoRI and xhol, purified with gel extraction kit (Qiagen, Germany), and cloned into pET22 b (+) (Novagen Madison, WI, USA) in the same orientation as the T7 promoter. The ligation mixture was transformed in competent DH5a cells (Novagen) which produced the pET22 b–LdPDI plasmid. The pET22 b–LdPDI construct was transformed into competent Escherichia coli BL21 DE 3 (Novagen, Madison, WI, USA) cells by heat shock at 42 °C for 45 s and the cells were grown at 37 °C on Luria Bertani (LB) agar medium in the presence of ampicillin (25 lg/ml) and Kanamycin (100 lg/ml) overnight at 37 °C under 200 rpm in shaker incubator for 4–5 h till the optical density reached (0.4). 2.4. Expression and purification of recombinant LdPDI protein

2. Materials and methods 2.1. Samples from VL patients and control A total of 20 subjects (aged between 17 and 40 years) of both sexes were studied after obtaining their informed consent. It included 10 patients with acute VL from endemic areas and 10 apparently healthy individuals who represented an endemic area. The study was conducted between September 2011 and March 2012. Measurement of body temperature, body weight, liver and spleen size, total and differential WBC count, haemoglobin, blood sugar, serum createnine and prothrombin, ECG and chest X-ray were performed in all cases. All the cases in VL group presented characteristic sign and symptom of VL infection and diagnosis was confirmed by presence of L. donovani in the Giesma stained spleen aspirate and by positive serology test (DAT and rk39). The healthy individuals in control group were negative for all disease symptoms and matched the patient group by sex and age (±2 years).

The recombinant protein was subsequently induced by 1.0 mM isopropyl-b-thiogalactoside (IPTG) overnight in shaker incubator at 22 °C and 200 rpm. The 5 ml overnight culture was inoculated into 500 ml fresh LB medium and cultured in shaker incubator at 22 °C and 200 rpm. Once the A600 reached between 0.5 and 0.6, 1 mM IPTG was added to induce expression of protein which followed further continuation of culture for 24 h at 22 °C. The bacterial cells were pelleted after harvesting of the cultured cells by centrifugation for 10 min at 5000 rpm and 4 °C and were then lysed in 30 ml cell lysing solution (50 mM Tris–HCl, pH 8.0, 300 mM NaCl, and 0.1% Triton X-100), 100 lg/ml lysozyme, and 1 mM phenylmethylsulfonyl fluoride (PMSF) for 30 min at 4 °C and further lysed by ultra-sonication at 85% amplitude and 0.5 s pulse for 5 min. The lysed cells were centrifuged at 14,000 rpm at 4 °C, and antigen recovered from supernatant was stored after addition of a cocktail of protease inhibitors (1 ll/ml). For purification, supernatant was added to 1.5 ml slurry of nickel-nitrilotriacetic acid (Ni-NTA) and incubated for 3 h at 4 °C with gentle shaking. The resin was divided into three 10 ml disposable

78

A. Amit et al. / Cellular Immunology 289 (2014) 76–85

columns, washed with 5–8 column volumes of lysis buffer containing 250 mM imidazole. The purity of the r-LdPDI protein was checked by 12.5% SDS–PAGE analysis and Coomassie Brilliant Blue R-250 staining. The eluted fractions were combined and dialysed twice against a 300 fold volume of 50 mM Tris–Cl (pH 8.0), 150 mM NaCl supplemented with 10% glycerol, overnight at 4 °C. The concentration of dialyzed protein was spectroscopically determined by Bradford method using bovine serum albumin (BSA) as standard. The protein was stored at 30 °C in 10% glycerol in aliquots until used. 2.5. PDI enzymatic assays Since the PDIs can reduce scrambled bovine pancreatic RNase type III-A to native RNase, the thiol isomerise activity of the purified recombinant Ld PDI was detected according to the PDI standard assay [21]. In brief, 8 lM scrambled RNAse was treated with 2.8 lM purified PDI protein in a buffer solution which contained 4.5 mM cytidine 200 ,300 cyclic monophosphate (cCMP), 1 mM reduced glutathione, 0.2 mM oxidised glutathione, 2 mM EDTA and 100 mM Tris–HCl, pH 8.0. RNase activity was assessed by active RNase mediated reduction of cCMP into CMP change in rate of absorbance at 296 nm for 20 min in a spectrophotometer. 2.6. Macrophage culture Peripheral-blood mononuclear cells (PBMCs) were obtained from buffy coats from VL patients and healthy donors. Monocytes were purified using Ficoll-Hypaque™ (Sigma) density gradient centrifugation at 800g, 15 min at 20 °C . Cells were suspended in RPMI-1640 medium (Gibco, USA) with 10% FCS, dispensed into tissue-culture grade-Petri dishes (Tarsons, India) and incubated at 37 °C in a humidified, 5% CO2, 95% air, for 3 h. Non-adherent cells were then removed by washing, twice with, pre-warmed HBSS. Fresh pre-warmed RPMI-1640 with 10% FCS was added to each dish before the adherent cells were incubated in the presence or absence of stimulators, 10 lg/ml PDI proteins or soluble Leishmania antigen (SLA) or 10 lg/ml PDI protein along with alanine (10 lg/ml) for another 72 h incubation at 37 °C in CO2 incubator. The 72 h adhered and stimulated cultured cells were then gently scrapped off and re-suspended in fresh media. As, morphologically almost all (92%) of the cells left in the dishes appeared to be macrophages. Cells were gently scrapped off and transferred to a 5 ml tube. Monoclonal anti-human-CD14 antibody (BD-USA) was added to each sample of macrophage at 5 ll (5 lg) per tube to identify the purity of monocytes purified by PBMCs by flow cytometry. 2.7. Acid phosphatase assay Acid phosphatase released from macrophages was investigated as follows: 1  106 monocytes were incubated with 10 lg/ml PDI protein either used alone or with alanine (10 lg/ml) and SLA and kept for 72 h incubation at 37 °C in CO2 incubator (5% CO2 and 95% RH). Acid phosphatase production was measured by the acid phosphatase Assay kit (Sigma, USA). This method is based on the binding of phenol with 4-amino antipyrine which gives yellow colour to indicate the presence of ACP which was monitored at 405 nm in a microplate.

macrophage culture were dispensed in each well of a 96 well microtiter plate which followed incubation with 100 ll of Griess reagent to each well at room temperature for 20 min. The optical density of the coloured product formed was measured on an ELISA reader (BIO-RAD) at 540 nm. The amount of nitric oxide formed in M/106 cells was calculated by comparing the standard sodium nitrite concentration curve. The lower limit of sensitivity of the nitrite assay was 0.08 lM/ml. 2.9. Detection of cytotoxicity and anti cytotoxicity effect by lactate dehydrogenase assay Changes in membrane integrity of infected macrophages were examined by determining level of lactate dehydrogenase and in this way cytotoxicity induced by PDI was checked by the LDH assay kit (Sigma Aldrich, USA). Briefly, macrophages (unstimulated/stimulated) were pre-treated with lysis buffer (45 min in CO2 incubator) and then co-cultured with LDH substrate and LDH assay dye in presence of cofactor for 30 min. This method is based on reduction of NAD as NADH which converts tetrazolium dye which was monitored at 490 nm and indicated inhibition of cell growth due to the presence of LDH. 2.10. GST assay The effect of PDI against cytotoxicity was also studied with measurement of enzyme glutathione S-transferase (GST) activity in the macrophage culture using GST assay Kit (Sigma Aldrich, USA). This enzyme is known to protect cells against toxicants and its activity was also shown in mammalian tissues, especially in the liver, which plays a key role in detoxification [42,47]. Briefly, 20 ll samples were pre-treated in a 96 well plate with 180 ll of substrate solution comprising of 10 ll of 1-chloro-2,4-dinitrobenzene (CDNB) and 10 ll of 200 mM L-glutathione reduced and 980 ll of Dulbecco phosphate buffered saline for a few seconds. The GST enzyme activities were detected by reading the absorbance in the plate reader at 340 nm. The increase in absorbance was considered directly proportional to the GST activity. The change in absorbance was calculated in the linear range of the plot for the sample and for the blank as per manufacturer’s instruction. 2.11. Flow cytometry based HLA-DR analysis Cultured macrophage cells both were harvested using ice-cold PBS plus azide and stained with directly labelled mouse anti-human HLA-DR antibodies (clone 557938, BD Biosciences, USA) for 30 min at room temperature according to manufacturer’s instructions. Cells were washed twice with wash buffer (PBS containing 2% FCS, pH 7.2). Then, each sample was re-suspended in 450 ll stain buffer (buffered lysing solution containing less than 50% diethylene glycol and less than 15% formaldehyde, Beckton & Dickinson, San Diego, USA). Flow data on HLA-DR from the gated monocyte population were evaluated using cell quest software on 4colour FACS calibur. FITC- and PE-labelled immunoglobulin containing antibodies and a control of un-stimulated-PBMCs were included in all experiments. 2.12. Cytokine detection

2.8. Measurement of NO Alternations in nitric oxide generated in stimulated and unstimulated macrophage was monitored by Griess reagent as described previously [36]. This method is based on colorimetric detection of nitrite (oxidation product of nitric oxide) as an azo dye product of the Griess reaction. Briefly, 100 ll of culture supernatants from

PBMCs (1  106/ml) from VL patients and control were cultured in 96-well culture plates and rLdPDI or alanine was added in triplicate wells at a concentration of 10 lg/ml. Control panels with un stimulated culture (ex vivo) or with PHA were run in parallel to all experiments. The quantitative yield of IFN-c and IL-10 was determined by enzyme-linked immunosorbant assay (ELISA) (Thermo

A. Amit et al. / Cellular Immunology 289 (2014) 76–85

79

Scientific, USA) after 5 days of incubation using supernatant. The detection limit for IFN-c was