BASIC INVESTIGATION
Evaluation of Possible Relationship Between COL4A4 Gene Polymorphisms and Risk of Keratoconus Ramin Saravani, PhD,*† Farzaneh Hasanian-Langroudi, MSc,† Mohammad-Hosein Validad, MD,‡ Davood Yari, MSc,† Gholamreza Bahari, MSc,† Mahmood Faramarzi, MSc,§ Mehdi Khateri, MSc,¶ and Somayeh Bahadoram, MSc#
Purpose: Keratoconus (KC) is a genetically heterogeneous corneal dystrophy with unknown etiology that causes loss of visual acuity. Evidence has shown that corneas from patients with KC contain reduced amounts of total collagen proteins, and collagen type IV has been suggested as a candidate gene in KC pathogenesis. This study aimed to evaluate the possible associations between collagen type IV alpha-4 chain (COL4A4) polymorphisms (rs2229813 G/A, M1327V and rs2228555 A/G, V1516V) and susceptibility to KC.
Methods: A total of 262 Iranian subjects including 112 patients with KC and 150 healthy individuals as controls were recruited in this case–control study. Diagnosis was based on clinical examination, electronic refractometry, and keratometry. Genotyping for the COL4A4 rs2229813 and rs2228555 variants was executed using allele-specific polymerase chain reaction and Tetra-ARMS polymerase chain reaction, respectively.
Results: A significant difference was found between the 2 groups regarding allelic and genotyping distribution of COL4A4 polymorphism at position rs2229813 G.A. The COL4A4 rs2229813 AA and GA+AA genotypes were risk factors for developing KC (odds ratio [OR] = 2.1, P = 0.036 and OR = 1.7, P = 0.042, for the AA and GA+AA genotypes, respectively). The COL4A4 rs2229813 A allele was also associated with an increased risk for KC (OR = 1.5, 95% confidence intervals: 1.1–2.2, P = 0.018). However, in our study, we found no association between COL4A4 rs2228555 polymorphism and the risk of KC.
Received for publication September 1, 2014; revision received November 19, 2014; accepted November 19, 2014. Published online ahead of print January, 2015. From the *Cellular and Molecular Research Center, Zahedan University of Medical Sciences, Zahedan, Iran; †Department of Clinical Biochemistry, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran; ‡Department of Ophthalmology, Alzahra Eye Hospital, Zahedan University of Medical Sciences, Zahedan, Iran; §Department of Immunology, Iran University of Medical Sciences (IUMS), Tehran, Iran; ¶Biotechnology Department, Pasteur Institute of Iran, Tehran, Iran; and #Department of Nursing and Midwifery, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Supported by a fund based on the MSc thesis of F. Hasanian-Langroudi and the deputy for Research, Zahedan University of Medical Science. The authors have no conflicts of interest to disclose. Reprints: Farzaneh Hasanian-Langroudi, Msc, Department of Clinical Biochemistry, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran 9817688959, (e-mail: [email protected]). Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
318
| www.corneajrnl.com
Conclusions: We suggest that the COL4A4 rs2229813 AA and GA+AA genotypes as well as the A allele play roles as risk factors for developing KC in our population. Key Words: keratoconus, gene polymorphism, COL4A4 (Cornea 2015;34:318–322)
K
eratoconus (KC) is a corneal disorder with an occurrence of approximately 1 in 2000 and a prevalence of 54.5 per 100,000. KC occurs in both genders and all ethnicities with higher prevalence and incidence rates in Asians compared with whites.1,2 A study undertaken in the Midlands area of the United Kingdom found a prevalence of 4:1, and an incidence of 4.4:1 was reported in Asians compared with whites, whereas another UK study conducted in Yorkshire found that the incidence was 7.5 times higher in Asians compared with whites.3 KC is typically bilateral and is characterized by progressive thinning of the cornea, leading to asymmetric bulging and, in advanced cases, formation of a conical cornea.4 The disorder leads to severe refractive error and irregular astigmatism. Although the most frequent presentation of KC is as an isolated sporadic disorder, a positive association between KC and various factors has been proposed, including atopy, eye rubbing, wearing hard contact lens, and cardiovascular disease. Furthermore, it has been well documented that KC is associated with syndromic conditions such as connective tissue disorders (osteogenesis imperfecta, Gapo syndrome, and Ehlers–Danlos syndrome type VI),5 pigmentary retinopathy, Marfan syndrome, Noonan syndrome, Apert syndrome, Leber congenital amaurosis, and Down syndrome.2,3,6 Although the etiology of KC is still unknown, genetic predisposition plays an important role as indicated by the association of KC with genetic syndromes, segregation analyses, genetic epidemiological data, and gene-mapping studies.7–9 Family-based and twin studies have also shown that genetic factors in particular play a significant role in the development of KC and that there is a high concordance rate for KC in monozygotic twins. These include a positive family history in 6% to 10% of KC cases and its higher concordance rate in monozygotic twins.6,10 A number of candidate genes for KC have been mapped by linkage analysis including collagen genes.11,12 Cornea Volume 34, Number 3, March 2015
Copyright ª 2015 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
Cornea Volume 34, Number 3, March 2015
Collagens are the major protein components in the corneal stroma and basement membranes. Basement membranes are specialized structures of extracellular matrix that play essential roles in tissue development and maintenance. Type IV collagen is one of the main constituents of the basement membrane. Type IV collagens are a family of 6 proteins encoded by 6 distinct genes, COL4A1 through COL4A6. During assembly in the endoplasmic reticulum, 3 collagen IV peptides interact to construct 1 of 3 triple-helical heterotrimers, a1a1a2, a3a4a5, or a5a5a6.13 Mutations in the genes encoding collagen subunits a3 (IV), a4 (IV), or a5 (IV) can result in Alport syndrome, a human genetic disease that is distinguished by hematuric glomerulonephritis, auditory defects, and lens abnormalities, including capsular thinning, lenticonus, and cataract. Recent studies have mapped collagen type IV a-3 (COL4A3) and collagen type IV a-4 (COL4A4) genes to the same region, 2q35-q37, but on opposite strands and transcribed in opposite directions.14,15 The COL4A3 gene spans 250 kb and consists of 51 exons; the COL4A4 gene is shorter, spreading 113 kb and harboring 48 exons. Both genes were shown to be expressed by highly differentiated central corneal epithelium, and their downregulation have been observed in KC.16,17 Collagen type IV has been suggested as a candidate gene in KC pathogenesis.16 Recently, COL4A4 rs2229813 (M1327V) A/G polymorphism has been associated with predisposition to KC in a Slovenian population.9,16 Another genetic variation in the COL4A4 gene, rs2228555 (V1516V), has also been a risk factor for KC in Slovenian patients.9 With respect to the function of collagen IV crosslinking in maintenance of corneal stroma and basement membranes, any genetic variations leading to impaired synthesis of collagen IV alpha chains could possibly lead to eye-related abnormalities such as KC. Therefore, this study aimed to investigate the possible associations between 2 COL4A4 polymorphisms (rs2229813, M1327V, A/G and rs2228555, V1516V, A/G) and susceptibility to KC in an Iranian population. To the best of our knowledge, this is the first study assessing possible impacts of these SNPs on KC in an Asian/Iranian population.
MATERIALS AND METHODS Patients A total of 112 patients (56 men and 56 women) with KC, age range 9 to 80 years and mean 6 SD = 29.7 6 13.4, and 150 healthy individuals as the control group (66 men and 84 women), age range 8–83 years and mean 6 SD = 29.9 6 15.6, were enrolled from Alzahra Eye Hospital, Zahedan University of Medical Sciences, Zahedan, Iran (P value between case and control groups was 0.335 and 0.908 for sex and age, respectively). Detection of KC was performed using an inclusive ophthalmic examination following these criteria: (1) signs of KC (Munson sign, protrusion, Vogt striae, corneal thickness, scarring, Fleischer ring, photokeratoscopy signs, video keratography signs, and refractive errors) and (2) medical histories (age, gender, contact lens wear, eye rubbing, Copyright Ó 2015 Wolters Kluwer Health, Inc. All rights reserved.
COL4A4 Gene Polymorphisms and Risk of KC
systemic disease, atopy, and connective tissue diseases).18 Keratometry was performed by 4 quantitative videokeratographic indices including central corneal power .47.2 diopter (D), inferior–superior dioptric asymmetry over 1.2 D, Sim-K astigmatism .1.5 D and skewed radial axes .21 degrees. KC evaluation was performed for the control group completely the same was as for the patients. Then, healthy subjects with no KC-signs were considered as the control group, whereas patients with KC were selected for the case group. The patients’ characteristics are provided in Table 1. Controls were healthy volunteers from a geographic region similar to that for the patients with KC. Blood samples taken from all participants were collected in EDTA-containing tubes for DNA extraction. Ethical approvals for recruitment were obtained from the local ethics committee of Zahedan University of Medical Sciences, and informed consent was obtained from all patients and healthy individuals.
COL4A4 Gene Polymorphisms Genotyping DNA was extracted from peripheral leukocytes of 112 patients with KC and 150 healthy subjects using the saltingout method, as stated previously.19 After authenticating the quality of the extract by electrophoresis on 1% agarose gel and quantitated spectrophotometrically, the isolated DNA was stored at 220°C until further use. COL4A4 polymorphisms, rs2229813, and rs2228555, were detected by allelespecific primer–polymerase chain reaction (PCR), and TETRA-ARMS-PCR, respectively. All analyses were performed blindly with respect to the patient characteristics. PCR was executed using commercially available PCR premix (AccuPower PCR PreMix; BIONEER, Daejeon, Korea) according to the manufacturer’s instructions. Briefly, 1 mL TABLE 1. Clinical and Pathological Characteristics of Patients With KC, and Their Associations With COL4A4 Polymorphisms Characteristics KC index 1 2 3 Rv/Rh range ,2 2–4 4–6 6, Corneal radius of curvature ,50 50–60 .60 Thinnest cornea point 1 2 3 4 5
Cases, n (%)
rs2229813, P
rs2228555, P
0.057
0.839
0.208
0.690
0.647
0.737
0.762
0.435
18 (16.1) 48 (42.9) 46 (41.1) 15 23 30 44
(13.4) (20.5) (26.8) (39.3)
33 (29.5) 62 (55.4) 17 (15.2) 13 5 15 43 36
(11.6) (4.5) (13.4) (38.4) (32.1)
RH, radius of horizontal meridian; RV, radius of vertical meridian.
www.corneajrnl.com |
319
Copyright ª 2015 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
Cornea Volume 34, Number 3, March 2015
Saravani et al
TABLE 2. Primers Sequence for Detection of COL4A4 Gene Polymorphisms Primers
Sequence (59/.39)
COL4A4; rs2229813 G.A R1 (G allele) R2 (A allele) F COL4A4; rs2228555 A.G FO RO FI (G allele) RI (A allele)
Amplicon Size
GGTCCCGGGAATCCAAC GGTCCCGGGAATCCAAT TGTTCCCGGATATTGAAAGC
358 bp
GCAGGGCCTCCAGATTTCAGAACACGTA ATGAATACCCGATCCAGAGGCTCCTCCA GTCTGGCAGGGTCTTGCCTTCCCTTG GCAGTAGGCAAAGGGCAGCGTGCTACAT
395 bp
of template DNA (;100 ng/mL), 1 mL of each primer (10 pmol/mL), and 17 mL of DNase-free water were added to AccuPower PCR PreMix. For rs2229813, amplification was performed with an initial denaturation step at 95°C for 5 minutes, followed by 34 cycles at 95°C for 30 seconds, 52°C for 35 seconds, and 72°C for 35 seconds with a final extension at 72°C for 10 minutes. For SNP rs2228555, the cycling conditions were as follow: an initial denaturation step at 95°C for 6 minutes, followed by 30 cycles at 95°C for 30 seconds, 69.5°C for 40 seconds, and 72°C for 30 seconds with a final extension at 72°C for 10 minutes. Each reaction was verified on 2% agarose gel. All primer sequences and fragment sizes are listed in Table 2. For each sample, 2 separate reactions were performed. For the rs2229813 G.A, PCR performed using a common forward primer (F), and 2 sequence-specific reverse primers (R1 and R2) created a 358-bp band for both G and A alleles (Fig. 1A). PCR for the polymorphism rs2288393 C.G was performed using 2 outer primers (FO and RO) creating a 395-bp band, and 1 forward inner primer (FI-G) and 1 reverse inner primer (RI-A) producing the 279 bp and 169 bp amplicons, respectively (Fig. 1B).
279 bp 169 bp
position rs2229813 G.A. The frequency of AA genotype was increased in KC patients compared with controls (21% vs. 14%), showing a statistically significant difference (OR = 2.1, 95% CI: 1.04–4.3, P = 0.036). Furthermore, the GA+AA genotype was a risk factor for KC with the frequency of 67% versus 54% in cases and controls, respectively (OR = 1.7, 95% CI: 1–3, P = 0.042). The A allele at the rs2229813 position was also associated with an increased risk of KC, with a frequency of 44% and 34% in patients and controls, respectively (OR = 1.5, 95% CI: 1.1–2.2, P = 0.018).
Statistical Analysis All statistical analyses were executed by SPSS software for Windows, version 15.0 (SPSS Inc, Chicago, IL). The association between genotypes and KC was tested by computing the odds ratio (OR) and 95% confidence intervals (95% CI) from logistic regression analyses. P ,0.05 was considered statistically significant. The Hardy–Weinberg equilibrium (HWE) was tested with the x2 test for any of the SNPs under consideration. Frequencies of haplotypes in the controls and patients were estimated using HAPSTAT-3.0 software.20
RESULTS Frequency of COL4A4 rs2229813 G.A and rs2228555 A.G Genetic Polymorphisms The allele and genotype frequencies of 2 COL4A4 variants, rs2229813 G.A and rs2228555 A.G, in patients with KC and controls are listed in Table 3. A significant difference was found between the 2 groups regarding allelic and genotyping distribution of COL4A4 polymorphism at
FIGURE 1. A, Photograph of the PCR products of the COL4A4 rs2229813 G.A polymorphism, M: DNA marker; lane 1, 2: GG; lanes 3, 4: AA; lane 6, 7: AG. B, Photograph of the PCR products of the COL4A4 rs2228555 A.G polymorphism, M: DNA marker; lanes 1, 2: AG; lanes 3, 4: GG; lanes 5, 6: AA.
320
Copyright Ó 2015 Wolters Kluwer Health, Inc. All rights reserved.
| www.corneajrnl.com
Copyright ª 2015 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
Cornea Volume 34, Number 3, March 2015
COL4A4 Gene Polymorphisms and Risk of KC
TABLE 3. Comparison of COL4A4 Gene Polymorphisms Between Patients With KC and Controls Polymorphism rs2229813 G.A genotype GG GA AA GA+AA Alleles G A rs2228555 A.G genotypes AA AG GG Alleles A G
Patients With KC Control (n = 112), % (n = 150), %
OR (95% CI)*
P
(46.0) (40.0) (14.0) (54.0)
Reference — 1.6 (0.9–2.7) 0.099 2.1 (1.0–4.3) 0.036 1.7 (1.0–3) 0.042
125 (55.8) 99 (44.2)
198 (66.0) 102 (34.0)
Reference — 1.5 (1.1–2.2) 0.018
43 (38.4) 60 (53.6) 9 (8.0)
59 (39.3) 77 (51.3) 14 (9.3)
Reference — 1.1 (0.6–1.8) 0.800 0.9 (0.4–2.2) 0.790
146 (65.1) 78 (34.9)
195 (65.0) 105 (35.0)
37 51 24 75
(33.0) (45.5) (21.4) (67.0)
69 60 21 81
Reference 1 (0.7–1.4)
— 0.999
*Adjusted for age and sex. P-values below 0.05 were considered statistically significant.
However, the allelic and genotypic distribution of COL4A4 polymorphism at position rs2228555 A.G did not differ between patients and controls (OR = 0.9, 95% CI: 0.4– 2.2, P = 0.790 for the GG genotype; OR = 0.9, 95% CI: 0.7–1.5, P = 0.999 for the G allele). Additionally, in this study, COL4A4 gene polymorphisms were analyzed according to the clinical and pathological characteristics of patients, however, no significant association among these features and COL4A4 genotypes was found (P values are shown in Table 1).
Linkage Disequilibrium and Haplotype Analysis of COL4A4 Polymorphisms None of the SNPs had genotype frequencies that deviated significantly from HWE in the studied groups (HWE for rs2229813 in cases and controls were P = 0.416 and 0.183, respectively; HWE for the variation rs2228555 in cases and controls were P = 0.056 and 0.116, respectively). Linkage disequilibrium was tested by calculating the Lewontin Delta9 coefficient and the correlation coefficient r2,21 and it was revealed that the magnitude of linkage disequilibrium between 2 COL4A4 SNPs, rs2229813 and rs2228555, was low (D9 =
TABLE 4. Frequency of Haplotypes of COL4A4 Gene Polymorphisms in KC and Control Groups Haplotypes rs2229813 rs2229813 rs2229813 rs2229813
A/rs2228555 A/rs2228555 G/rs2228555 G/rs2228555
A G A G
KC Controls
x2
P
OR
95% CI
0.3 0.2 0.4 0.2
1.7 2.9 1.3 2.2
0.187 0.086 0.261 0.142
1.4 1.6 0.8 0.7
0.88–1.94 0.94–2.57 0.57–1.16 0.47–1.11
0.2 0.1 0.4 0.2
Copyright Ó 2015 Wolters Kluwer Health, Inc. All rights reserved.
0.005, r2 = 0.001). Four haplotypes of the COL4A4 involve 2 alleles of each polymorphism site (Table 4). Data showed that haplotypes distribution did not differ between patients with KC and controls (P . 0.05). Additionally, we analyzed the association of COL4A4 genotypes combination and KC (Table 5), but no significant association was found (P . 0.05).
DISCUSSION KC is a noninflammatory disorder in which there is thinning and ectasia of the cornea.14 Collagens are the major protein component in the corneal stroma, which present largely as fibrillar proteins that interact with the stromaspecific proteoglycans to produce a normal optically useful stroma.15,22 Evidence has shown that corneas from patients with KC contain reduced amounts of total collagen proteins and that defective cross-linking of collagen molecules has been implicated in KC pathogenesis.23 In our study, we found that COL4A4 rs2229813 AA genotype and A allele act as risk factors for developing KC in our population. The COL4A4 rs2229813 AA genotype was observed more frequent in patients than in the controls (21% vs. 14%); in addition, the COL4A4 rs2229813 A allele was found to be more prevalent in patients with KC compared with healthy subjects (44% vs. 34%). Our data regarding COL4A4 polymorphism at rs2229813 corroborates the studies of Stabuc-Silih et al9,16 who indicated an association between rs2229813 A/G variation and the risk of KC in a Slovenian population. Although Stabuc-Silih et al found no mutations in the COL4A3 and COL4A4 genes in patients with KC, they indicated that specific genotypes of 7 polymorphisms, including rs2229813 (M1327V) in the COL4A4, were significantly associated with KC under dominant, recessive, or additive models. In opposition to the study by Stabuc-Silih et al and ours, Wang et al24 failed to show any association between COL4A4 rs2229813 G/A polymorphism and KC in a Han Chinese population. Several types of collagens have been identified in the human cornea including collagen type IV.25 The cornea is
TABLE 5. Frequency Distribution of the Combination of the COL4A4 Genotypes and Association With KC Patients With KC, %
Control, %
OR (95% CI)*
rs2229813/ rs2228555 GG/AA
16
11
GG/AG GG/GG GA/AA GA/AG GA/GG AA/AA AA/AG AA/GG
26 1 17 22 4 8 10 3
20 4 18 19 3 6 6 2
1.0 (reference) 1.1 (0.5–2.6) 0.3 (0.03–2.8) 1.5 (0.6–3.2) 1.6 (0.2–3.01) 1.8 (0.4–7.1) 2.5 (0.8–7.6) 1.8 (0.9–5.2) 1.6 (0.5–3.3)
0.844 0.298 0.377 0.290 0.395 0.294 0.107 0.489
www.corneajrnl.com |
321
Diplotype
P
—
*Adjusted for age and sex.
Copyright ª 2015 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
Cornea Volume 34, Number 3, March 2015
Saravani et al
a clear tissue sheltering the front of the eye. In KC, the shape of the cornea progressively alters from the normal round shape to a cone shape; then, the eye bulges out. Biochemical studies have also shown that cornea thinning in patients with KC may occur as a result of a reduced amount of total collagen proteins and changes in collagen fiber orientation.26 The changes in the orientation of collagen molecules, which are followed by rearrangement of collagen fibrils, could also alter shape and transparency of the cornea.27 Each type IV collagen molecule is a trimer composed of 3 a chains, which shape heterotrimeric molecules of A1–2 (IV), A3–5 (IV), and A5–6 (IV) chains.28 The different collagen IV molecules have distinct topographical locations and functions, and they appear in various developmental periods. For example, COL4 subunits, which are connected to elastic membranes (COL4A1, A2, A5, and A6) emerge early in lens development, demonstrating the observation that the very young capsule (infants) is highly extensible. However, collagen IV subunits, which are associated with mesh-like and cross-linked networks (COL4A3 and A4), appear late in development, which may provide the postnatal capsule with the strength required to transport accommodative forces.29 With respect to another variant, COL4A4 rs2228555, V1516V, in this study, we did not find any significant differences in allelic and genotypic distribution of this SNP across the groups. In opposition to our results, Stabuc-Silih et al16 found a significant association between the COL4A4 variation, rs2228555, and susceptibility to KC in the dominant and additive models. In summary, in light of these findings, we suggest that there is an association between the COL4A4 rs2229813 AA and GA+AA genotypes and A allele and KC in the studied population. This is the first study that assessed the impact of COL4A4 genetic variations on the risk of KC in an Asian/ Iranian population, and therefore might develop efficiency and assurance of collagen cross-linking treatment by decreasing negative outcomes and excluding nonresponders by recognizing them before treatment. Larger studies on different ethnicities are warranted to validate our findings.
REFERENCES 1. Ziaei H, Jafarinasab MR, Javadi MA, et al. Epidemiology of keratoconus in an Iranian population. Cornea. 2012;31:1044–1047. 2. Mikami T, Meguro A, Teshigawara T, et al. Interleukin 1 beta promoter polymorphism is associated with keratoconus in a Japanese population. Mol Vis. 2013;19:845–851. 3. Saee-Rad S, Hashemi H, Miraftab M, et al. Mutation analysis of VSX1 and SOD1 in Iranian patients with keratoconus. Mol Vis. 2011; 17:3128–3136. 4. Li X, Bykhovskaya Y, Haritunians T, et al. A genome-wide association study identifies a potential novel gene locus for keratoconus, one of the commonest causes for corneal transplantation in developed countries. Hum Mol Genet. 2012;21:421–429. 5. Ambekar R, Toussaint KC Jr, Wagoner Johnson A. The effect of keratoconus on the structural, mechanical, and optical properties of the cornea. J Mech Behav Biomed Mater. 2011;4:223–236.
322
| www.corneajrnl.com
6. Mok JW, Baek SJ, Joo CK. VSX1 gene variants are associated with keratoconus in unrelated Korean patients. J Hum Genet. 2008;53: 842–849. 7. Kapasi M, Baath J, Mintsioulis G, et al. Phototherapeutic keratectomy versus mechanical epithelial removal followed by corneal collagen crosslinking for keratoconus. Can J Ophthalmol. 2012;47:344–347. 8. Lima GdS, Moreira H, Wahab SA. Laser in situ keratomileusis to correct myopia, hypermetropia and astigmatism after penetrating keratoplasty for keratoconus: a series of 27 cases. Can J Ophthalmol. 2001;36:391–396; discussion 396–397. 9. Stabuc-Silih M, Strazisar M, Ravnik-Glavac M, et al. Genetics and clinical characteristics of keratoconus. Acta Dermatovenerol Alp Panonica Adriat. 2010;19:3–10. 10. Bechara SJ, Waring GO III, Insler MS. Keratoconus in two pairs of identical twins. Cornea. 1996;15:90–93. 11. Knappe S, Stachs O, Zhivov A, et al. Results of confocal microscopy examinations after collagen cross-linking with riboflavin and UVA light in patients with progressive keratoconus. Ophthalmologica. 2011;225: 95–104. 12. Jain R, Basu S, Garg P. Corneal collagen cross-linkage in keratoconus. Br J Ophthalmol. 2013;97:108–109. 13. Bai X, Dilworth DJ, Weng YC, et al. Developmental distribution of collagen IV isoforms and relevance to ocular diseases. Matrix Biol. 2009; 28:194–201. 14. Palamar M, Onay H, Ozdemir TR, et al. Relationship between IL1beta511C.T and ILRN VNTR polymorphisms and keratoconus. Cornea. 2014;33:145–147. 15. Egrilmez S, Sahin S, Yagci A. The effect of vernal keratoconjunctivitis on clinical outcomes of penetrating keratoplasty for keratoconus. Can J Ophthalmol. 2004;39:772–777. 16. Stabuc-Silih M, Ravnik-Glavac M, Glavac D, et al. Polymorphisms in COL4A3 and COL4A4 genes associated with keratoconus. Mol Vis. 2009;15:2848–2860. 17. Bochert A, Berlau J, Koczan D, et al. Gene expression in keratoconus. Initial results using DNA microarrays [in German]. Ophthalmologe. 2003;100:545–549. 18. Rabinowitz YS. Keratoconus. Surv Ophthalmol. 1998;42:297–319. 19. Eskandari-Nasab E, Hashemi M, Rezaei H, et al. Evaluation of UDPglucuronosyltransferase 2B17 (UGT2B17) and dihydrofolate reductase (DHFR) genes deletion and the expression level of NGX6 mRNA in breast cancer. Mol Biol Rep. 2012;39:10531–10539. 20. Lin DY, Huang BE. The use of inferred haplotypes in downstream analyses. Am J Hum Genet. 2007;80:577–579. 21. Lewontin RC. The detection of linkage disequilibrium in molecular sequence data. Genetics. 1995;140:377–388. 22. Legare ME, Iovieno A, Yeung SN, et al. Corneal collagen cross-linking using riboflavin and ultraviolet A for the treatment of mild to moderate keratoconus: 2-year follow-up. Can J Ophthalmol. 2013;48:63–68. 23. Ormonde S. Refractive surgery for keratoconus. Clin Exp Optom. 2013; 96:173–182. 24. Wang Y, Jin T, Zhang X, et al. Common single nucleotide polymorphisms and keratoconus in the Han Chinese population. Ophthalmic Genet. 2013;34:160–166. 25. Chan E, Snibson GR. Current status of corneal collagen cross-linking for keratoconus: a review. Clin Exp Optom. 2013;96:155–164. 26. Daxer A, Fratzl P. Collagen fibril orientation in the human corneal stroma and its implication in keratoconus. Invest Ophthalmol Vis Sci. 1997;38: 121–129. 27. Newsome DA, Foidart JM, Hassell JR, et al. Detection of specific collagen types in normal and keratoconus corneas. Invest Ophthalmol Vis Sci. 1981;20:738–750. 28. Chen L, Miyamura N, Ninomiya Y, et al. Distribution of the collagen IV isoforms in human Bruch’s membrane. Br J Ophthalmol. 2003;87: 212–215. 29. Balasubramani M, Schreiber EM, Candiello J, et al. Molecular interactions in the retinal basement membrane system: a proteomic approach. Matrix Biol. 2010;29:471–483.
Copyright Ó 2015 Wolters Kluwer Health, Inc. All rights reserved.
Copyright ª 2015 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
Evaluation of Possible Relationship Between COL4A4 Gene Polymorphisms and Risk of Keratoconus Ramin Saravani, PhD,*† Farzaneh Hasanian-Langroudi, MSc,† Mohammad-Hosein Validad, MD,‡ Davood Yari, MSc,† Gholamreza Bahari, MSc,† Mahmood Faramarzi, MSc,§ Mehdi Khateri, MSc,¶ and Somayeh Bahadoram, MSc#
Purpose: Keratoconus (KC) is a genetically heterogeneous corneal dystrophy with unknown etiology that causes loss of visual acuity. Evidence has shown that corneas from patients with KC contain reduced amounts of total collagen proteins, and collagen type IV has been suggested as a candidate gene in KC pathogenesis. This study aimed to evaluate the possible associations between collagen type IV alpha-4 chain (COL4A4) polymorphisms (rs2229813 G/A, M1327V and rs2228555 A/G, V1516V) and susceptibility to KC.
Methods: A total of 262 Iranian subjects including 112 patients with KC and 150 healthy individuals as controls were recruited in this case–control study. Diagnosis was based on clinical examination, electronic refractometry, and keratometry. Genotyping for the COL4A4 rs2229813 and rs2228555 variants was executed using allele-specific polymerase chain reaction and Tetra-ARMS polymerase chain reaction, respectively.
Results: A significant difference was found between the 2 groups regarding allelic and genotyping distribution of COL4A4 polymorphism at position rs2229813 G.A. The COL4A4 rs2229813 AA and GA+AA genotypes were risk factors for developing KC (odds ratio [OR] = 2.1, P = 0.036 and OR = 1.7, P = 0.042, for the AA and GA+AA genotypes, respectively). The COL4A4 rs2229813 A allele was also associated with an increased risk for KC (OR = 1.5, 95% confidence intervals: 1.1–2.2, P = 0.018). However, in our study, we found no association between COL4A4 rs2228555 polymorphism and the risk of KC.
Received for publication September 1, 2014; revision received November 19, 2014; accepted November 19, 2014. Published online ahead of print January, 2015. From the *Cellular and Molecular Research Center, Zahedan University of Medical Sciences, Zahedan, Iran; †Department of Clinical Biochemistry, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran; ‡Department of Ophthalmology, Alzahra Eye Hospital, Zahedan University of Medical Sciences, Zahedan, Iran; §Department of Immunology, Iran University of Medical Sciences (IUMS), Tehran, Iran; ¶Biotechnology Department, Pasteur Institute of Iran, Tehran, Iran; and #Department of Nursing and Midwifery, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Supported by a fund based on the MSc thesis of F. Hasanian-Langroudi and the deputy for Research, Zahedan University of Medical Science. The authors have no conflicts of interest to disclose. Reprints: Farzaneh Hasanian-Langroudi, Msc, Department of Clinical Biochemistry, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran 9817688959, (e-mail: [email protected]). Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
318
| www.corneajrnl.com
Conclusions: We suggest that the COL4A4 rs2229813 AA and GA+AA genotypes as well as the A allele play roles as risk factors for developing KC in our population. Key Words: keratoconus, gene polymorphism, COL4A4 (Cornea 2015;34:318–322)
K
eratoconus (KC) is a corneal disorder with an occurrence of approximately 1 in 2000 and a prevalence of 54.5 per 100,000. KC occurs in both genders and all ethnicities with higher prevalence and incidence rates in Asians compared with whites.1,2 A study undertaken in the Midlands area of the United Kingdom found a prevalence of 4:1, and an incidence of 4.4:1 was reported in Asians compared with whites, whereas another UK study conducted in Yorkshire found that the incidence was 7.5 times higher in Asians compared with whites.3 KC is typically bilateral and is characterized by progressive thinning of the cornea, leading to asymmetric bulging and, in advanced cases, formation of a conical cornea.4 The disorder leads to severe refractive error and irregular astigmatism. Although the most frequent presentation of KC is as an isolated sporadic disorder, a positive association between KC and various factors has been proposed, including atopy, eye rubbing, wearing hard contact lens, and cardiovascular disease. Furthermore, it has been well documented that KC is associated with syndromic conditions such as connective tissue disorders (osteogenesis imperfecta, Gapo syndrome, and Ehlers–Danlos syndrome type VI),5 pigmentary retinopathy, Marfan syndrome, Noonan syndrome, Apert syndrome, Leber congenital amaurosis, and Down syndrome.2,3,6 Although the etiology of KC is still unknown, genetic predisposition plays an important role as indicated by the association of KC with genetic syndromes, segregation analyses, genetic epidemiological data, and gene-mapping studies.7–9 Family-based and twin studies have also shown that genetic factors in particular play a significant role in the development of KC and that there is a high concordance rate for KC in monozygotic twins. These include a positive family history in 6% to 10% of KC cases and its higher concordance rate in monozygotic twins.6,10 A number of candidate genes for KC have been mapped by linkage analysis including collagen genes.11,12 Cornea Volume 34, Number 3, March 2015
Copyright ª 2015 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
Cornea Volume 34, Number 3, March 2015
Collagens are the major protein components in the corneal stroma and basement membranes. Basement membranes are specialized structures of extracellular matrix that play essential roles in tissue development and maintenance. Type IV collagen is one of the main constituents of the basement membrane. Type IV collagens are a family of 6 proteins encoded by 6 distinct genes, COL4A1 through COL4A6. During assembly in the endoplasmic reticulum, 3 collagen IV peptides interact to construct 1 of 3 triple-helical heterotrimers, a1a1a2, a3a4a5, or a5a5a6.13 Mutations in the genes encoding collagen subunits a3 (IV), a4 (IV), or a5 (IV) can result in Alport syndrome, a human genetic disease that is distinguished by hematuric glomerulonephritis, auditory defects, and lens abnormalities, including capsular thinning, lenticonus, and cataract. Recent studies have mapped collagen type IV a-3 (COL4A3) and collagen type IV a-4 (COL4A4) genes to the same region, 2q35-q37, but on opposite strands and transcribed in opposite directions.14,15 The COL4A3 gene spans 250 kb and consists of 51 exons; the COL4A4 gene is shorter, spreading 113 kb and harboring 48 exons. Both genes were shown to be expressed by highly differentiated central corneal epithelium, and their downregulation have been observed in KC.16,17 Collagen type IV has been suggested as a candidate gene in KC pathogenesis.16 Recently, COL4A4 rs2229813 (M1327V) A/G polymorphism has been associated with predisposition to KC in a Slovenian population.9,16 Another genetic variation in the COL4A4 gene, rs2228555 (V1516V), has also been a risk factor for KC in Slovenian patients.9 With respect to the function of collagen IV crosslinking in maintenance of corneal stroma and basement membranes, any genetic variations leading to impaired synthesis of collagen IV alpha chains could possibly lead to eye-related abnormalities such as KC. Therefore, this study aimed to investigate the possible associations between 2 COL4A4 polymorphisms (rs2229813, M1327V, A/G and rs2228555, V1516V, A/G) and susceptibility to KC in an Iranian population. To the best of our knowledge, this is the first study assessing possible impacts of these SNPs on KC in an Asian/Iranian population.
MATERIALS AND METHODS Patients A total of 112 patients (56 men and 56 women) with KC, age range 9 to 80 years and mean 6 SD = 29.7 6 13.4, and 150 healthy individuals as the control group (66 men and 84 women), age range 8–83 years and mean 6 SD = 29.9 6 15.6, were enrolled from Alzahra Eye Hospital, Zahedan University of Medical Sciences, Zahedan, Iran (P value between case and control groups was 0.335 and 0.908 for sex and age, respectively). Detection of KC was performed using an inclusive ophthalmic examination following these criteria: (1) signs of KC (Munson sign, protrusion, Vogt striae, corneal thickness, scarring, Fleischer ring, photokeratoscopy signs, video keratography signs, and refractive errors) and (2) medical histories (age, gender, contact lens wear, eye rubbing, Copyright Ó 2015 Wolters Kluwer Health, Inc. All rights reserved.
COL4A4 Gene Polymorphisms and Risk of KC
systemic disease, atopy, and connective tissue diseases).18 Keratometry was performed by 4 quantitative videokeratographic indices including central corneal power .47.2 diopter (D), inferior–superior dioptric asymmetry over 1.2 D, Sim-K astigmatism .1.5 D and skewed radial axes .21 degrees. KC evaluation was performed for the control group completely the same was as for the patients. Then, healthy subjects with no KC-signs were considered as the control group, whereas patients with KC were selected for the case group. The patients’ characteristics are provided in Table 1. Controls were healthy volunteers from a geographic region similar to that for the patients with KC. Blood samples taken from all participants were collected in EDTA-containing tubes for DNA extraction. Ethical approvals for recruitment were obtained from the local ethics committee of Zahedan University of Medical Sciences, and informed consent was obtained from all patients and healthy individuals.
COL4A4 Gene Polymorphisms Genotyping DNA was extracted from peripheral leukocytes of 112 patients with KC and 150 healthy subjects using the saltingout method, as stated previously.19 After authenticating the quality of the extract by electrophoresis on 1% agarose gel and quantitated spectrophotometrically, the isolated DNA was stored at 220°C until further use. COL4A4 polymorphisms, rs2229813, and rs2228555, were detected by allelespecific primer–polymerase chain reaction (PCR), and TETRA-ARMS-PCR, respectively. All analyses were performed blindly with respect to the patient characteristics. PCR was executed using commercially available PCR premix (AccuPower PCR PreMix; BIONEER, Daejeon, Korea) according to the manufacturer’s instructions. Briefly, 1 mL TABLE 1. Clinical and Pathological Characteristics of Patients With KC, and Their Associations With COL4A4 Polymorphisms Characteristics KC index 1 2 3 Rv/Rh range ,2 2–4 4–6 6, Corneal radius of curvature ,50 50–60 .60 Thinnest cornea point 1 2 3 4 5
Cases, n (%)
rs2229813, P
rs2228555, P
0.057
0.839
0.208
0.690
0.647
0.737
0.762
0.435
18 (16.1) 48 (42.9) 46 (41.1) 15 23 30 44
(13.4) (20.5) (26.8) (39.3)
33 (29.5) 62 (55.4) 17 (15.2) 13 5 15 43 36
(11.6) (4.5) (13.4) (38.4) (32.1)
RH, radius of horizontal meridian; RV, radius of vertical meridian.
www.corneajrnl.com |
319
Copyright ª 2015 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
Cornea Volume 34, Number 3, March 2015
Saravani et al
TABLE 2. Primers Sequence for Detection of COL4A4 Gene Polymorphisms Primers
Sequence (59/.39)
COL4A4; rs2229813 G.A R1 (G allele) R2 (A allele) F COL4A4; rs2228555 A.G FO RO FI (G allele) RI (A allele)
Amplicon Size
GGTCCCGGGAATCCAAC GGTCCCGGGAATCCAAT TGTTCCCGGATATTGAAAGC
358 bp
GCAGGGCCTCCAGATTTCAGAACACGTA ATGAATACCCGATCCAGAGGCTCCTCCA GTCTGGCAGGGTCTTGCCTTCCCTTG GCAGTAGGCAAAGGGCAGCGTGCTACAT
395 bp
of template DNA (;100 ng/mL), 1 mL of each primer (10 pmol/mL), and 17 mL of DNase-free water were added to AccuPower PCR PreMix. For rs2229813, amplification was performed with an initial denaturation step at 95°C for 5 minutes, followed by 34 cycles at 95°C for 30 seconds, 52°C for 35 seconds, and 72°C for 35 seconds with a final extension at 72°C for 10 minutes. For SNP rs2228555, the cycling conditions were as follow: an initial denaturation step at 95°C for 6 minutes, followed by 30 cycles at 95°C for 30 seconds, 69.5°C for 40 seconds, and 72°C for 30 seconds with a final extension at 72°C for 10 minutes. Each reaction was verified on 2% agarose gel. All primer sequences and fragment sizes are listed in Table 2. For each sample, 2 separate reactions were performed. For the rs2229813 G.A, PCR performed using a common forward primer (F), and 2 sequence-specific reverse primers (R1 and R2) created a 358-bp band for both G and A alleles (Fig. 1A). PCR for the polymorphism rs2288393 C.G was performed using 2 outer primers (FO and RO) creating a 395-bp band, and 1 forward inner primer (FI-G) and 1 reverse inner primer (RI-A) producing the 279 bp and 169 bp amplicons, respectively (Fig. 1B).
279 bp 169 bp
position rs2229813 G.A. The frequency of AA genotype was increased in KC patients compared with controls (21% vs. 14%), showing a statistically significant difference (OR = 2.1, 95% CI: 1.04–4.3, P = 0.036). Furthermore, the GA+AA genotype was a risk factor for KC with the frequency of 67% versus 54% in cases and controls, respectively (OR = 1.7, 95% CI: 1–3, P = 0.042). The A allele at the rs2229813 position was also associated with an increased risk of KC, with a frequency of 44% and 34% in patients and controls, respectively (OR = 1.5, 95% CI: 1.1–2.2, P = 0.018).
Statistical Analysis All statistical analyses were executed by SPSS software for Windows, version 15.0 (SPSS Inc, Chicago, IL). The association between genotypes and KC was tested by computing the odds ratio (OR) and 95% confidence intervals (95% CI) from logistic regression analyses. P ,0.05 was considered statistically significant. The Hardy–Weinberg equilibrium (HWE) was tested with the x2 test for any of the SNPs under consideration. Frequencies of haplotypes in the controls and patients were estimated using HAPSTAT-3.0 software.20
RESULTS Frequency of COL4A4 rs2229813 G.A and rs2228555 A.G Genetic Polymorphisms The allele and genotype frequencies of 2 COL4A4 variants, rs2229813 G.A and rs2228555 A.G, in patients with KC and controls are listed in Table 3. A significant difference was found between the 2 groups regarding allelic and genotyping distribution of COL4A4 polymorphism at
FIGURE 1. A, Photograph of the PCR products of the COL4A4 rs2229813 G.A polymorphism, M: DNA marker; lane 1, 2: GG; lanes 3, 4: AA; lane 6, 7: AG. B, Photograph of the PCR products of the COL4A4 rs2228555 A.G polymorphism, M: DNA marker; lanes 1, 2: AG; lanes 3, 4: GG; lanes 5, 6: AA.
320
Copyright Ó 2015 Wolters Kluwer Health, Inc. All rights reserved.
| www.corneajrnl.com
Copyright ª 2015 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
Cornea Volume 34, Number 3, March 2015
COL4A4 Gene Polymorphisms and Risk of KC
TABLE 3. Comparison of COL4A4 Gene Polymorphisms Between Patients With KC and Controls Polymorphism rs2229813 G.A genotype GG GA AA GA+AA Alleles G A rs2228555 A.G genotypes AA AG GG Alleles A G
Patients With KC Control (n = 112), % (n = 150), %
OR (95% CI)*
P
(46.0) (40.0) (14.0) (54.0)
Reference — 1.6 (0.9–2.7) 0.099 2.1 (1.0–4.3) 0.036 1.7 (1.0–3) 0.042
125 (55.8) 99 (44.2)
198 (66.0) 102 (34.0)
Reference — 1.5 (1.1–2.2) 0.018
43 (38.4) 60 (53.6) 9 (8.0)
59 (39.3) 77 (51.3) 14 (9.3)
Reference — 1.1 (0.6–1.8) 0.800 0.9 (0.4–2.2) 0.790
146 (65.1) 78 (34.9)
195 (65.0) 105 (35.0)
37 51 24 75
(33.0) (45.5) (21.4) (67.0)
69 60 21 81
Reference 1 (0.7–1.4)
— 0.999
*Adjusted for age and sex. P-values below 0.05 were considered statistically significant.
However, the allelic and genotypic distribution of COL4A4 polymorphism at position rs2228555 A.G did not differ between patients and controls (OR = 0.9, 95% CI: 0.4– 2.2, P = 0.790 for the GG genotype; OR = 0.9, 95% CI: 0.7–1.5, P = 0.999 for the G allele). Additionally, in this study, COL4A4 gene polymorphisms were analyzed according to the clinical and pathological characteristics of patients, however, no significant association among these features and COL4A4 genotypes was found (P values are shown in Table 1).
Linkage Disequilibrium and Haplotype Analysis of COL4A4 Polymorphisms None of the SNPs had genotype frequencies that deviated significantly from HWE in the studied groups (HWE for rs2229813 in cases and controls were P = 0.416 and 0.183, respectively; HWE for the variation rs2228555 in cases and controls were P = 0.056 and 0.116, respectively). Linkage disequilibrium was tested by calculating the Lewontin Delta9 coefficient and the correlation coefficient r2,21 and it was revealed that the magnitude of linkage disequilibrium between 2 COL4A4 SNPs, rs2229813 and rs2228555, was low (D9 =
TABLE 4. Frequency of Haplotypes of COL4A4 Gene Polymorphisms in KC and Control Groups Haplotypes rs2229813 rs2229813 rs2229813 rs2229813
A/rs2228555 A/rs2228555 G/rs2228555 G/rs2228555
A G A G
KC Controls
x2
P
OR
95% CI
0.3 0.2 0.4 0.2
1.7 2.9 1.3 2.2
0.187 0.086 0.261 0.142
1.4 1.6 0.8 0.7
0.88–1.94 0.94–2.57 0.57–1.16 0.47–1.11
0.2 0.1 0.4 0.2
Copyright Ó 2015 Wolters Kluwer Health, Inc. All rights reserved.
0.005, r2 = 0.001). Four haplotypes of the COL4A4 involve 2 alleles of each polymorphism site (Table 4). Data showed that haplotypes distribution did not differ between patients with KC and controls (P . 0.05). Additionally, we analyzed the association of COL4A4 genotypes combination and KC (Table 5), but no significant association was found (P . 0.05).
DISCUSSION KC is a noninflammatory disorder in which there is thinning and ectasia of the cornea.14 Collagens are the major protein component in the corneal stroma, which present largely as fibrillar proteins that interact with the stromaspecific proteoglycans to produce a normal optically useful stroma.15,22 Evidence has shown that corneas from patients with KC contain reduced amounts of total collagen proteins and that defective cross-linking of collagen molecules has been implicated in KC pathogenesis.23 In our study, we found that COL4A4 rs2229813 AA genotype and A allele act as risk factors for developing KC in our population. The COL4A4 rs2229813 AA genotype was observed more frequent in patients than in the controls (21% vs. 14%); in addition, the COL4A4 rs2229813 A allele was found to be more prevalent in patients with KC compared with healthy subjects (44% vs. 34%). Our data regarding COL4A4 polymorphism at rs2229813 corroborates the studies of Stabuc-Silih et al9,16 who indicated an association between rs2229813 A/G variation and the risk of KC in a Slovenian population. Although Stabuc-Silih et al found no mutations in the COL4A3 and COL4A4 genes in patients with KC, they indicated that specific genotypes of 7 polymorphisms, including rs2229813 (M1327V) in the COL4A4, were significantly associated with KC under dominant, recessive, or additive models. In opposition to the study by Stabuc-Silih et al and ours, Wang et al24 failed to show any association between COL4A4 rs2229813 G/A polymorphism and KC in a Han Chinese population. Several types of collagens have been identified in the human cornea including collagen type IV.25 The cornea is
TABLE 5. Frequency Distribution of the Combination of the COL4A4 Genotypes and Association With KC Patients With KC, %
Control, %
OR (95% CI)*
rs2229813/ rs2228555 GG/AA
16
11
GG/AG GG/GG GA/AA GA/AG GA/GG AA/AA AA/AG AA/GG
26 1 17 22 4 8 10 3
20 4 18 19 3 6 6 2
1.0 (reference) 1.1 (0.5–2.6) 0.3 (0.03–2.8) 1.5 (0.6–3.2) 1.6 (0.2–3.01) 1.8 (0.4–7.1) 2.5 (0.8–7.6) 1.8 (0.9–5.2) 1.6 (0.5–3.3)
0.844 0.298 0.377 0.290 0.395 0.294 0.107 0.489
www.corneajrnl.com |
321
Diplotype
P
—
*Adjusted for age and sex.
Copyright ª 2015 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
Cornea Volume 34, Number 3, March 2015
Saravani et al
a clear tissue sheltering the front of the eye. In KC, the shape of the cornea progressively alters from the normal round shape to a cone shape; then, the eye bulges out. Biochemical studies have also shown that cornea thinning in patients with KC may occur as a result of a reduced amount of total collagen proteins and changes in collagen fiber orientation.26 The changes in the orientation of collagen molecules, which are followed by rearrangement of collagen fibrils, could also alter shape and transparency of the cornea.27 Each type IV collagen molecule is a trimer composed of 3 a chains, which shape heterotrimeric molecules of A1–2 (IV), A3–5 (IV), and A5–6 (IV) chains.28 The different collagen IV molecules have distinct topographical locations and functions, and they appear in various developmental periods. For example, COL4 subunits, which are connected to elastic membranes (COL4A1, A2, A5, and A6) emerge early in lens development, demonstrating the observation that the very young capsule (infants) is highly extensible. However, collagen IV subunits, which are associated with mesh-like and cross-linked networks (COL4A3 and A4), appear late in development, which may provide the postnatal capsule with the strength required to transport accommodative forces.29 With respect to another variant, COL4A4 rs2228555, V1516V, in this study, we did not find any significant differences in allelic and genotypic distribution of this SNP across the groups. In opposition to our results, Stabuc-Silih et al16 found a significant association between the COL4A4 variation, rs2228555, and susceptibility to KC in the dominant and additive models. In summary, in light of these findings, we suggest that there is an association between the COL4A4 rs2229813 AA and GA+AA genotypes and A allele and KC in the studied population. This is the first study that assessed the impact of COL4A4 genetic variations on the risk of KC in an Asian/ Iranian population, and therefore might develop efficiency and assurance of collagen cross-linking treatment by decreasing negative outcomes and excluding nonresponders by recognizing them before treatment. Larger studies on different ethnicities are warranted to validate our findings.
REFERENCES 1. Ziaei H, Jafarinasab MR, Javadi MA, et al. Epidemiology of keratoconus in an Iranian population. Cornea. 2012;31:1044–1047. 2. Mikami T, Meguro A, Teshigawara T, et al. Interleukin 1 beta promoter polymorphism is associated with keratoconus in a Japanese population. Mol Vis. 2013;19:845–851. 3. Saee-Rad S, Hashemi H, Miraftab M, et al. Mutation analysis of VSX1 and SOD1 in Iranian patients with keratoconus. Mol Vis. 2011; 17:3128–3136. 4. Li X, Bykhovskaya Y, Haritunians T, et al. A genome-wide association study identifies a potential novel gene locus for keratoconus, one of the commonest causes for corneal transplantation in developed countries. Hum Mol Genet. 2012;21:421–429. 5. Ambekar R, Toussaint KC Jr, Wagoner Johnson A. The effect of keratoconus on the structural, mechanical, and optical properties of the cornea. J Mech Behav Biomed Mater. 2011;4:223–236.
322
| www.corneajrnl.com
6. Mok JW, Baek SJ, Joo CK. VSX1 gene variants are associated with keratoconus in unrelated Korean patients. J Hum Genet. 2008;53: 842–849. 7. Kapasi M, Baath J, Mintsioulis G, et al. Phototherapeutic keratectomy versus mechanical epithelial removal followed by corneal collagen crosslinking for keratoconus. Can J Ophthalmol. 2012;47:344–347. 8. Lima GdS, Moreira H, Wahab SA. Laser in situ keratomileusis to correct myopia, hypermetropia and astigmatism after penetrating keratoplasty for keratoconus: a series of 27 cases. Can J Ophthalmol. 2001;36:391–396; discussion 396–397. 9. Stabuc-Silih M, Strazisar M, Ravnik-Glavac M, et al. Genetics and clinical characteristics of keratoconus. Acta Dermatovenerol Alp Panonica Adriat. 2010;19:3–10. 10. Bechara SJ, Waring GO III, Insler MS. Keratoconus in two pairs of identical twins. Cornea. 1996;15:90–93. 11. Knappe S, Stachs O, Zhivov A, et al. Results of confocal microscopy examinations after collagen cross-linking with riboflavin and UVA light in patients with progressive keratoconus. Ophthalmologica. 2011;225: 95–104. 12. Jain R, Basu S, Garg P. Corneal collagen cross-linkage in keratoconus. Br J Ophthalmol. 2013;97:108–109. 13. Bai X, Dilworth DJ, Weng YC, et al. Developmental distribution of collagen IV isoforms and relevance to ocular diseases. Matrix Biol. 2009; 28:194–201. 14. Palamar M, Onay H, Ozdemir TR, et al. Relationship between IL1beta511C.T and ILRN VNTR polymorphisms and keratoconus. Cornea. 2014;33:145–147. 15. Egrilmez S, Sahin S, Yagci A. The effect of vernal keratoconjunctivitis on clinical outcomes of penetrating keratoplasty for keratoconus. Can J Ophthalmol. 2004;39:772–777. 16. Stabuc-Silih M, Ravnik-Glavac M, Glavac D, et al. Polymorphisms in COL4A3 and COL4A4 genes associated with keratoconus. Mol Vis. 2009;15:2848–2860. 17. Bochert A, Berlau J, Koczan D, et al. Gene expression in keratoconus. Initial results using DNA microarrays [in German]. Ophthalmologe. 2003;100:545–549. 18. Rabinowitz YS. Keratoconus. Surv Ophthalmol. 1998;42:297–319. 19. Eskandari-Nasab E, Hashemi M, Rezaei H, et al. Evaluation of UDPglucuronosyltransferase 2B17 (UGT2B17) and dihydrofolate reductase (DHFR) genes deletion and the expression level of NGX6 mRNA in breast cancer. Mol Biol Rep. 2012;39:10531–10539. 20. Lin DY, Huang BE. The use of inferred haplotypes in downstream analyses. Am J Hum Genet. 2007;80:577–579. 21. Lewontin RC. The detection of linkage disequilibrium in molecular sequence data. Genetics. 1995;140:377–388. 22. Legare ME, Iovieno A, Yeung SN, et al. Corneal collagen cross-linking using riboflavin and ultraviolet A for the treatment of mild to moderate keratoconus: 2-year follow-up. Can J Ophthalmol. 2013;48:63–68. 23. Ormonde S. Refractive surgery for keratoconus. Clin Exp Optom. 2013; 96:173–182. 24. Wang Y, Jin T, Zhang X, et al. Common single nucleotide polymorphisms and keratoconus in the Han Chinese population. Ophthalmic Genet. 2013;34:160–166. 25. Chan E, Snibson GR. Current status of corneal collagen cross-linking for keratoconus: a review. Clin Exp Optom. 2013;96:155–164. 26. Daxer A, Fratzl P. Collagen fibril orientation in the human corneal stroma and its implication in keratoconus. Invest Ophthalmol Vis Sci. 1997;38: 121–129. 27. Newsome DA, Foidart JM, Hassell JR, et al. Detection of specific collagen types in normal and keratoconus corneas. Invest Ophthalmol Vis Sci. 1981;20:738–750. 28. Chen L, Miyamura N, Ninomiya Y, et al. Distribution of the collagen IV isoforms in human Bruch’s membrane. Br J Ophthalmol. 2003;87: 212–215. 29. Balasubramani M, Schreiber EM, Candiello J, et al. Molecular interactions in the retinal basement membrane system: a proteomic approach. Matrix Biol. 2010;29:471–483.
Copyright Ó 2015 Wolters Kluwer Health, Inc. All rights reserved.
Copyright ª 2015 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
