Research in Microbiology 165 (2014) 813e825 www.elsevier.com/locate/resmic

Original article

Evolution of the RNase P RNA structural domain in Leptospira spp. Vigneshwaran Ravishankar a, Ahmed Ahmed b, Ulaganathan Sivagnanam a, Krishnaraja Muthuraman a, Anbarasu Karthikaichamy a, Herald A. Wilson a, Ajay Devendran a, Rudy A. Hartskeerl b, Stephen M.L. Raj a,* a

b

Department of Biotechnology, Mepco Schlenk Engineering College, Sivakasi 626005, Tamilnadu, India WHO/FAO/OIE, National Collaborating Centre for Reference and Research on Leptospirosis, KIT Biomedical Research, Meibergdreef 39, 1105 AZ Amsterdam, The Netherlands Received 9 September 2014; accepted 15 October 2014 Available online 23 October 2014

Abstract We have employed the RNase P RNA (RPR) gene, which is present as single copy in chromosome I of Leptospira spp. to investigate the phylogeny of structural domains present in the RNA subunit of the tRNA processing enzyme, RNase P. RPR gene sequences of 150 strains derived from NCBI database along with sequences determined from 8 reference strains were examined to fathom strain specific structural differences present in leptospiral RPR. Sequence variations in the RPR gene impacted on the configuration of loops, stems and bulges found in the RPR highlighting species and strain specific structural motifs. In vitro transcribed leptospiral RPR ribozymes are demonstrated to process pre-tRNA into mature tRNA in consonance with the positioning of Leptospira in the taxonomic domain of bacteria. RPR sequence datasets used to construct a phylogenetic tree exemplified the segregation of strains into their respective lineages with a (re)speciation of strain SH 9 to Leptospira borgpetersenii, strains Fiocruz LV 3954 and Fiocruz LV 4135 to Leptospira santarosai, strain CBC 613 to Leptospira kirschneri and strain HAI 1536 to Leptospira noguchii. Furthermore, it allowed characterization of an isolate P2653, presumptively characterized as either serovar Hebdomadis, Kremastos or Longnan to Leptospira weilii, serovar Longnan. © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Keywords: Leptospira; RNase P RNA; Phylogeny; Ribozyme

1. Introduction Differentiation of microorganisms based on nucleotide sequences of RNase P RNA (RPR) was demonstrated in many bacterial genera [1e4]. RPR genes of various species have shown highly conserved stretches interspersed with varying sequences unique to each organism. RPR is a subunit of an

* Corresponding author. E-mail addresses: [email protected] (V. Ravishankar), a. [email protected] (A. Ahmed), [email protected] (U. Sivagnanam), krish_ [email protected] (K. Muthuraman), [email protected] (A. Karthikaichamy), [email protected] (H.A. Wilson), dajayneo@ gmail.com (A. Devendran), [email protected] (R.A. Hartskeerl), [email protected], [email protected] (S.M.L. Raj).

essential tRNA processing enzyme, ribonuclease P (RNase P). 0 The 5 leader sequence of precursor tRNA (pre-tRNA) is catalytically cleaved by RNase P to produce mature tRNA [5,6]. Generally, RNase P holoenzyme is a ribonucleoprotein complex comprising the RPR subunit, and one or more protein cofactor(s) [7e10]. In all eukaryotic organisms, both RNA and protein subunit(s) are required for catalytic activity at physiologic concentration of Mg2þ whereas in bacteria and archaea, RPR alone can cleave pre-tRNA at elevated Mg2þ concentration [11,12]. RPR sequences of many species representing the domains of life have been catalogued in the RNase P database where secondary structures of RNA subunits were constructed and made available for public use. Phylogenetic comparative analyses and biochemical studies performed on various bacterial

http://dx.doi.org/10.1016/j.resmic.2014.10.007 0923-2508/© 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

814

V. Ravishankar et al. / Research in Microbiology 165 (2014) 813e825

RPRs [13e16] have helped understanding how tertiary interaction between different domains facilitated the formation of higher order structures. Analysis of the crystal and solution structures of bacterial RPR revealed the presence of two distinct structural components called the catalytic and the pretRNA binding substrate specific domains [17e22]. All RPR structures known so far have a common core but vary in the presence of peripheral structural elements playing role in tertiary interactions [23] to offer stability in the overall conformation [14]. Variations observed in the helices of RPR secondary structures provided useful phylogenetic information among bacterial species and strains. Our study focused on understanding the sequence and structural variations that necessitate evolution of RPR in distinct strains of Leptospira. The genus Leptospira is highly heterogenous comprising pathogenic (Leptospira interrogans, Leptospira santarosai, Leptospira borgpetersenii, Leptospira alstonii, Leptospira noguchii, Leptospira weilii, Leptospira kirschneri, Leptospira alexanderi and Leptospira kmetyi), saprophytic (Leptospira biflexa, Leptospira meyeri, Leptospira vanthielii, Leptospira terpstrae, Leptospira yanagawae, Leptospira idonii and Leptospira wolbachii) and intermediate species (Leptospira inadai, Leptospira licerasiae, Leptospira broomii, Leptospira fainei and Leptospira wolffii) [24,25]. To date, about 300 serovars of Leptospira spp. have been identified and the genomic sequences of 158 strains are available in the public database. The RPR gene sequences determined in this study were used along with sequences obtained from the database to construct secondary structures of different leptospiral RPRs and compared to evaluate phylogeny based on sequence variations contributing to unique conformations of distinct RPRs. 2. Materials and methods 2.1. Bacterial strains and culture condition Eight Leptospira strains were from the collection of WHO/ FAO/OIE and National Leptospirosis Reference Centre in Amsterdam, The Netherlands. Leptospires were propagated at 30  C in EMJH liquid media as described elsewhere [26] with modifications suggested by Johnson and Harris, 1967 [27]. Strain P2653 is an isolate from a human patient in The Netherlands and has been serologically typed as serogroup Hebdomadis, either serovar Hebdomadis, Kremastos or Longnan. 2.2. Genomic DNA extraction Genomic DNAs were extracted from 17 reference strains of Leptospira using QIAamp DNA extraction kit (QIAGEN GmbH, Germany) followed by RNase treatment using RNase Cocktail enzyme mix (Ambion, TX, USA). Seventeen reference strains consist of eight strains for which the RPR gene sequences were determined in this study and RPR gene sequences of another nine strains were obtained

from the database (Table 1), cloned and in vitro transcribed. Purified DNA was eluted with 0.1  TE buffer, pH 8.0 in accordance with manufacturer's instructions. The quantity of genomic DNA was estimated by spectrophotometry using the Nanodrop spectrophotometer (Nanodrop, DE, USA). 2.3. Cloning and sequencing of RPR gene RPR genes were amplified from nine strains of Leptospira using Taq polymerase (NEB, MA, USA). RPR specific P4 sense and P4 antisense primers (Table 2) were deduced 280e300 bp apart from sequences present in the universally conserved P4 region of the gene (Fig. 1), thus comprising 85e90% of the RPR gene sequences. Degeneracy was introduced at three consecutive nucleotide positions of the antisense primer where R and K denote A/G and G/T, respectively. Ten picomoles each of the above primers were used in PCR mixture with 5 ng of leptospiral genomic DNA, 200 mM dNTPs and 2.5 U of Taq polymerase (NEB, MA, USA) in a total volume of 20 ml reaction mix. Amplification was performed on DNA Engine (MJ Research, CA, USA) using 95  C for 5 min for initial denaturation followed by 95  C for 30 s, 48  C or 50  C for 30 s and 72  C for 1 min of 40 cycles. Final extension was performed at 72  C for 30 min before terminating the reaction at 4  C. PCR products were analyzed by agarose gel electrophoresis according to standard procedures. An aliquot of the fresh PCR product was incubated at 65  C for 15 min, then brought to room temperature, ligated into vector pCR2.1 and subsequently transformed into TOPO cells (Invitrogen, CA, USA). Reaction conditions for ligation and transformation were followed as prescribed by the manufacturer. Transformants were picked up from the agar plate and inoculated into LB broth containing ampicillin (50 mg/ml) and incubated overnight at 37  C. Plasmid DNA was extracted from the cultures using the plasmid mini kit (QIAGEN GmbH, Germany) and the extracted plasmids were digested with the restriction enzyme EcoRI (NEB, MA, USA). For each serovar, at least three clones were subjected to sequencing (SciGenom, Cochin, India) using M13 reverse primer. Sequences with 100% sequence identities between all three RPR clones were included for further analysis. Sequences were deposited in Genbank. Accession numbers of the sequences are listed in Table 1. The single copy nature of RPR gene was supported by an in silico analysis of genomic sequences of 150 Leptospira strains available in the NCBI database (Table 1). The secY gene sequences for 158 leptospiral strains included in this study were also retrieved from the NCBI database (Table 1) and employed to evaluate the phylogenetic utility of RPR gene. Full length RPR gene was amplified from genomic DNAs of nine Leptospira strains (Table 1) using species specific primers as listed in Table 2. Primers were designed based on RPR gene sequences available in the database. T7 promoter sequence and appropriate restriction recognition sequences were included in the primers for in vitro transcription and cloning. PCR reaction was performed as described before.

V. Ravishankar et al. / Research in Microbiology 165 (2014) 813e825

815

Table 1 List of strains used in the present study to obtain RPR and secY genes. Species

Serovar

Strain

Accession number RPR

secY

L. interrogans

Icterohaemorrhagiae Icterohaemorrhagiae Icterohaemorrhagiae Autumnalis Bulgarica Bataviae Bataviae Perameles Canicola Canicola Canicola Djasiman Hardjo Pomona Pomona Pomona Pomona Pomona Pomona Copenhageni Copenhageni Copenhageni Copenhageni Lai Lai Lora Grippotyphosa Grippotyphosa Grippotyphosa Grippotyphosa Grippotyphosa Grippotyphosa Grippotyphosa Hebdomadis Medanensis Medanensis Muenchen Pyrogenes Pyrogenes Pyrogenes Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined

RGAa (ATCC 43642) Verdun (LP) Verdun (HP) LP 101 Mallika L 1111 UI 08561 Bandicoot 343a Hond Utrecht (IV)a Fiocruz LV 133 LT 1962 LT1649 Hardjoprajitnoa CSL 4002 CSL 10083 Pomona Fox 32256 Kennewicki LC (82-25) UT 364 HAI 0188 M 20 Fiocruz L (1e130)c LT 2050 56601 IPAV TE 1992 Andaman 2006006986 LT 2186 UI 08368 UI 08434 UI 12764 UI 12769 R 499 UT 053 L 0448 Brem 129 2006006960 L 0374 R 168 Brem 329 C 10069 HAI 1536 HAI 1594 FPW 1039 FPW 2026 Kito 2002000621 2002000623 2002000624 2002000626 2002000631 2002000632 2003000735 2006001854 L 1207 MMD 3731 UI 12758 UI 12621 UI 13372 UI 08452

KC733861 NZ_AKWP02000015 NZ_AHNZ02000283 NZ_AHNF02000031 NZ_AFLS02000007 NZ_AHND02000042 NZ_AHNM02000102 KC733863 KC733858 NZ_AKWU02000005 AFMC02000011 NZ_AFMB02000176 KC733860 NZ_ANMZ01000073 NZ_AOHJ01000156 NZ_AFLT02000017 NZ_AOHG01000022 NZ_AHMK02000009 NZ_AHNX02000039 NZ_AHOG02000002 NZ_AOGV02000027 AE016823 AFMD02000025 AE010300 CP001221 AKWW02000048.1 NZ_AKXG02000020 NZ_AKXC02000051 AFME02000401 NZ_AHNJ02000042 NZ_AHNK02000026 NZ_AHNS02000011 NZ_AHNT02000037 NZ_AHNI02000010 NZ_AHNW02000057 NZ_AHNA02000036 NZ_AHMQ02000025 NZ_AHME02000025 NZ_AHMZ02000120 NZ_AHNH02000027 NZ_AKXA02000046 NZ_AFLZ02000027 NZ_AKWD02000062 NZ_AKWC02000019 NZ_AKWR02000164 NZ_AHMX02000036 NZ_ANCF01000016 NZ_AFLU02000012 NZ_AHMG02000071 NZ_AFJK02000064 NZ_AFJL02000004 NZ_ANMV01000013 NZ_ANMW01000142 NZ_ANMX01000053 NZ_AFLW02000038 NZ_AHNE02000003 NZ_AHOL02000002 NZ_AHNR02000065 NZ_AHNQ02000057 NZ_AHNV02000215 NZ_AHNL02000030

EU357997.1 AKWP02000005.1 NZ_AHNZ02000361.1 AHNF02000007.1 AFLS02000004.1 AHND02000065.1 AHNM02000126.1 EU358034.1d EU357961.1 AKWU02000005.1 AFMC02000009.1 AFMB02000186.1 EU357983.1 ANMZ01000068.1 AOHJ01000052.1 AFLT02000023.1 AOHG01000169.1 AHMK02000045.1 AHNX02000013.1 AHOG02000011.1 NZ_AOGV02000036.1 AE016823.1 NZ_AFMD02000139.1 AE010300.2 CP001221.1 AKWW02000029.1 AKXG02000038.1 NZ_AKXC02000030.1 NZ_AFME02000350.1 AHNJ02000063.1 AHNK02000025.1 AHNS02000018.1 AHNT02000072.1 AHNI02000057.1 AHNW02000022.1 AHNA02000056.1 AHMQ02000029.1 AHME02000056.1 AHMZ02000114.1 AHNH02000047.1 AKXA02000032.1 AFLZ02000041.1 NZ_AKWD02000029.1 AKWC02000004.1 AKWR02000110.1 NZ_AHMX02000047.1 ANCF01000106.1 AFLU02000036.1 AHMG02000052.1 AFJK02000013.1 NZ_AFJL02000112.1 ANMV01000061.1 ANMW01000158.1 ANMX01000147.1 NZ_AFLW02000140.1 AHNE02000003.1 AHOL02000016.1 AHNR02000028.1 AHNQ02000002.1 AHNV02000152.1 AHNL02000056.1 (continued on next page)

816

V. Ravishankar et al. / Research in Microbiology 165 (2014) 813e825

Table 1 (continued ) Species

Serovar

Strain

Accession number RPR

secY

Undetermined Undetermined Valbuzzi Valbuzzi Zanoni

UT 126 UI 09600 Duyster Valbuzzi LT 2156

NZ_ANOJ01000075 NZ_AHNO02000029 NZ_ANNL01000133 NZ_AKXF02000004 NZ_AFMF02000017

NZ_ANOJ01000042.1 AHNO02000050.1 NZ_ANNL01000024.1 NZ_AKXF02000028.1 NZ_AFMF02000002.1

Javanica

KC733852

EU358040.1

Poi Tarassovi Hardjobovis Hardjobovis Hardjobovis Ballum Balcanica Castellonis Javanica Javanica Mini Pomona Undetermined Undetermined Undetermined Undetermined Undetermined

Veldrat Bataviae 46a (ATCC 43292) Poia Perepelitsina L 550 JB 197c Sponselee CDC Mus 127a 1627 Burgasb 200801910 UI 09931 MK 146 201000851 200901868 200801926 UI 09149 Brem 307 Brem 328 Noumea 25

KC733853 KC733854 CP000348 CP000350 NZ_ANMU01000085 KC733851 AF056381 NZ_AHOB02000008 NZ_AHNP02000011 NZ_AHNG02000030 NZ_AHOS02000002 NZ_AKWF02000033 NZ_AKWJ02000025 NZ_AHNN02000013 NZ_AHMR02000109 NZ_AHMS02000045 NZ_AHOD02000027

EU358007.1 EU358057.1 CP000348.1 CP000350.1 NZ_ANMU01000156.1 EU357953.1 EU357986.1 NZ_AHOB02000016.1 NZ_AHNP02000004.1 NZ_AHNG02000027.1 NZ_AHOS02000021.1 NZ_AKWF02000111.1 NZ_AKWJ02000017.1 NZ_AHNN02000011.1 NZ_AHMR02000031.1 NZ_AHMS02000040.1 NZ_AHOD02000013.1

L. kirschneri

Grippotyphosa Grippotyphosa Bim Bim Bulgarica Sokoine Valbuzzi Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined

Moskva RM 52 1051c PUO 1247 Nikolaevo RM 1 200702274 200803703 200801774 200801925 H1 H2 JB MMD 1493 200802841

NZ_AHMV02000018 NZ_AHMJ02000002 NZ_AHML02000033 NZ_ANIF01000027 NZ_ANCE01000060 AHMW02000036 NZ_AHOC02000002 NZ_AKWG02000034 NZ_AKWL02000014 NZ_AKWK02000069 NZ_AHMY02000054 NZ_AKWQ02000024 NZ_ANIM01000044 NZ_ANII01000073 NZ_AKWH02000050

AHMV02000004.1 AHMJ02000004.1 AHML02000023.1 ANIF01000126.1 ANCE01000135.1 AHMW02000021.1 AHOC02000019.1 AKWG02000039.1 AKWL02000032.1 AKWK02000007.1 AHMY02000025.1 AKWQ02000033.1 ANIM01000058.1 ANII01000029.1 AKWH02000037.1

L. meyeri

Hardjo Semaranga

Went 5 Veldrat Semarang 173c

NZ_AKXE01000007 NZ_ANIL01000019

NZ_AKXE01000001.1 NZ_ANIL01000018.1

L. biflexa

Patoc Patoc

Patoc1 (Ames)c Patoc1 (Paris)

CP000777 CP000786

CP000777.1 CP000786.1

L. santarosai

Arenal Shermani Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined

MAVJ 401 1342 KTc AIM JET HAI 821 HAI 134 HAI 1349 HAI 1380 MOR 084 CBC 379 CBC 523 CBC 613 CBC 1416 CBC 1531 ST 188 ZUN 179 200403458

NZ_AHMU02000050 NZ_AOHB02000006 NZ_AKWT02000055 NZ_AKWS02000028 NZ_AHOK02000048 NZ_AHOH02000010 NZ_ANNW01000112 NZ_AHOJ02000032 NZ_AHON02000003 NZ_AHOE02000011 NZ_AHOF02000022 NZ_ANIH01000139 NZ_AKWE02000128 NZ_APGN01000111 NZ_AOHA02000028 NZ_AHOQ02000031 NZ_AKWI02000030

NZ_AHMU02000024.1 NZ_AOHB02000045.1 NZ_AKWT02000026.1 NZ_AKWS02000054.1 NZ_AHOK02000029.1 NZ_AHOH02000008.1 NZ_ANNW01000041.1 NZ_AHOJ02000035.1 NZ_AHON02000014.1 NZ_AHOE02000006.1 NZ_AHOF02000009.1 ANIH01000057.1 NZ_AKWE02000035.1 NZ_APGN01000005.1 NZ_AOHA02000009.1 NZ_AHOQ02000011.1 NZ_AKWI02000002.1

L. borgpetersenii

(continued on next page)

V. Ravishankar et al. / Research in Microbiology 165 (2014) 813e825

817

Table 1 (continued ) Species

Serovar

Strain

Accession number RPR

secY

Undetermined Undetermined Undetermined

200702252 2000027870 2000030832

NZ_AHOA02000029 NZ_AFLX02000005 NZ_AFJN02000008

NZ_AHOA02000030.1 NZ_AFLX02000019.1 NZ_AFJN02000024.1

L. noguchii

Panama Autumnalis Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined Undetermined

CZ 214c ZUN 142 Bonito Cascata Hook 2001034031 2006001870 2007001578 1993005606

NZ_AKWY02000021 NZ_AHOP02000018 NZ_AOHH01000013 NZ_AOUB01000126 NZ_AOUC01000022 NZ_AKXB02000080 NZ_AFLY02000017 NZ_AHMH02000052 NZ_AHMF02000085

NZ_AKWY02000014.1 NZ_AHOP02000054.1 NZ_AOHH01000107.1 NZ_AOUB01000234.1 NZ_AOUC01000111.1 NZ_AKXB02000134.1 NZ_AFLY02000062.1 NZ_AHMH02000152.1 NZ_AHMF02000105.1

L. licerasiae

Varillal Undetermined

VAR 010c MMD 4847

NZ_AHOO02000011 NZ_AHOM02000010

NZ_AHOO02000005.1 NZ_AHOM02000010.1

L. weilii

Ranarum Topaz Undetermined Undetermined Undetermined Undetermined Undetermined

ICFT LT 2116c Ecochallenge LNT 1234 UI 13098 2006001853 2006001855

NZ_AOHC02000034 NZ_AHOR02000010 NZ_AHMI02000035 NZ_AHNC02000070 NZ_AHNU02000067 NZ_AFLV02000062 NZ_AFJM02000016

NZ_AOHC02000023.1 NZ_AHOR02000017.1 NZ_AHMI02000251.1 NZ_AHNC02000010.1 NZ_AHNU02000045.1 NZ_AFLV02000058.1 NZ_AFJM02000042.1

L. L. L. L.

Hurstbridge Khorat Holland Hualin

BUT 6 Khorat-H2 Waz Holland (ATCC 700522) LT (11e33) (ATCC 700639)

NZ_AKWZ02000001 NZ_AKWX02000004 NZ_AOGY02000032 NZ_AOGW02000004

NZ_AKWZ02000010.1 NZ_AKWX02000023.1 NZ_AOGY02000051.1 NZ_AOGW02000010.1

L. alstonii

Pingchang Sichuan

80-412 79601

NZ_AOHD02000067 NZ_ANIK01000116

NZ_AOHD02000041.1 NZ_ANIK01000035.1

L. L. L. L. L. L.

Lyme Hurstbridge Manhao 3 Malaysia Codice Saopaulo

10 5399 L 60 Bejo-Iso 9 CDC Saopaulo (ATCC 700523)

NZ_AHMM02000006 NZ_AHMO02000008 NZ_AHMT02000020 NZ_AHMP02000004 NZ_AOGZ02000014 NZ_AOGX02000022

NZ_AHMM02000015.1 NZ_AHMO02000008.1 NZ_AHMT02000039.1 NZ_AHMP02000003.1 NZ_AOGZ02000008.1 NZ_AOGX02000024.1

Undetermined Undetermined Undetermined Kenya Hebdomadis/Kremastos/ Longnan

Fiocruz LV 3954 Fiocruz LV 4135 B (5-022) SH 9 P 2653e

NZ_AKWV02000002 NZ_AOHI01000031 NZ_ANIJ01000047 NZ_ANIG01000049 NZ_ANMY01000115

NZ_AKWV02000047.1 NZ_AOHI01000107.1 NZ_ANIJ01000025.1 NZ_ANIG01000090.1 NZ_ANMY01000055.1

fainei wolffii vanthielii terpstrae

inadai broomii alexanderi kmetyi wolbachii yanagawae

Leptospira sp.

a b c d e

RPR sequences determined in this study. Sequence and secondary structure obtained from RNase P database. RPR gene was cloned and in vitro transcribed. NCBI database denotes the source of secY gene sequence as L. meyeri instead of L. interrogans [42]. Typed as L. weilii, serovar Longnan in this study.

RPR genes were amplified using 95  C for 5 min for initial denaturation followed by 9 cycles of 95  C for 1 min, 50  C for 30 s and 72  C for 1 min continued with 35 cycles of 95  C and 72  C each for 1 min. Final extension was performed using 72  C for 5 min before terminating the reaction at 4  C. Aliquots of amplified PCR products were electrophoresed on a 1.2% agarose gel. PCR products were excised from the gel, extracted and then cloned into the BamHI and HindIII sites of pUC19 vector. Recombinant clones were sequenced to confirm the presence of the RPR gene.

2.4. In vitro transcription of RPR and tRNA substrate RPR encoding plasmids of Leptospira were linearized with 0 FokI (NEB, MA, USA) along with plasmids pJA 2 and pTyr containing Escherichia coli RPR and tRNATyr gene, respectively [11]. In vitro transcription was performed with the linearized plasmid DNAs as template using the HiScribe™ in vitro transcription kit (NEB, MA, USA). RNA transcripts were treated with RNase free DNase (Fermentas, USA), phenol extracted, purified using columns and subsequently

818

V. Ravishankar et al. / Research in Microbiology 165 (2014) 813e825 Table 2 List of primers used to amplify RPR gene from genomic DNAs of Leptospira spp. 0

0

Primer name

Primer sequence (5 / 3 )

P4 sense P4 antisense L. santF L. santR L. borgF L. borgR L. intF L. intR L. kirschF L. kirschR L. noguF L. noguR L. weiliiF L. weiliiR L. liceraF L. liceraR L. meyeriF L. meyeriR L. biflexaF L. biflexaR

GAGGAAAGTCCGGGC TAAGCCRKRTTCTGTC GGATCCGAAATTAATACGACTCACTATAGAATCAAACATTCTGCCGG AAGCTTGCATGCCTGCAGGATGTTTTGAAAGATTAGCAACATTCTGCCTG GGATCCGAAATTAATACGACTCACTATAGAATCAAACATTCTGCYGGATG AAGCTTGCATGCCTGCAGGATGTTTTGAAAGAATACKAACATTCTGCCTYTAAG GGATCCGAAATTAATACGACTCACTATAGAATCAAGCATTCTGTCG AAGCTTGCATGCCTGCAGGATGTTTTGAAAGACTACGGGCATTCTG GGATCCGAAATTAATACGACTCACTATAGAATCAAGCATTCTGTCG AAGCTTGCATGCCTGCAGGATGTTTTGAAAGACTARGGGCATTCTG GGATCCGAAATTAATACGACTCACTATAGAATCAAGCATTCTGTCG AAGCTTGCATGCCTGCAGGATGTTTTGAAAGACTYTGGGCATTCTG GGATCCGAAATTAATACGACTCACTATAGAATCAAACATTCTGCTGGATG AAGCTTGCATGCCTGCAGGATGTTTTGAAAGAATACCAACATTCTGCCTG GGATCCGAAATTAATACGACTCACTATAGATGGTCGCGCTTTCTTTTCTG AAGCTTGCATGCCTGCAGGATGTTTTGAAAGTTGCAGTGGAAGGTTGCCTG GGATCCGAAATTAATACGACTCACTATAGAAACTGACTCTGGCCG AAGCTTGCATGCCTGCAGGATGTTTTGAAAGAAAGTGACTCTGGCCC GGATCCGAAATTAATACGACTCACTATAGAAGTTGACTCTGGCC AAGCTTGCATGCCTGCAGGATGTTTTGAAAGAAGGTGACTCTGGCC

precipitated with ethanol according to standard procedures. Aliquots of purified RNAs were quantified by spectrophotometry (Hitachi, Japan) and their integrity was checked by electrophoresis in a 2% agarose gel stained with ethidium bromide. 2.5. Preparation of radioactively labelled ptRNATyr substrate Preparation of radioactively labelled pre-tRNATyr using in vitro transcription was carried out as described previously [28]. pre-tRNATyr was internally labelled using [a-32P] GTP in the in vitro transcription reaction. The labelled transcripts were gel purified, following electrophoresis on a 8% acrylamideebisacrylamide gel containing 8 M urea and the radioactivity of the purified labelled transcripts was measured (Bioscan, USA). 2.6. RNase P cleavage assay In vitro transcribed RPRs of Leptospira and E. coli were folded and used for RNase P cleavage assay as described earlier [11]. The 20 ml reaction mixture contained 10  RNase P digestion buffer (500 mM TriseHCl, pH 7.5, 100 mM MgCl2, 1 M NH4Cl), 50 nM cold and labelled pre-tRNATyr (5000 cpm) and 0.01 pmol of leptospiral and E. coli RPRs. Reaction mixtures were incubated at 37  C for 5 min, terminated with 9 M urea dye and cleavage products were separated by electrophoresis on 8% acrylamideebisacrylamide gel containing 8 M urea. 2.7. RNA structure and phylogenetic analysis Leptospiral RPR sequences determined in this study and also sequences obtained from genomic database were folded

using RNAfold (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold. cgi) software. Stem and loop regions were manually reconstructed with the help of partial RPR secondary structures available at http://www.rnasep.ncsu.edu. Predicted secondary structures were used to identify paired stems, loops and helices present within putative RPR molecule. Deduced RPR gene sequences were trimmed, deleting sequences at the primer annealing regions and aligned with RPR gene sequences obtained from the database using CLC Sequence Viewer 6.8.1. Similarly, secY gene sequences of 158 leptospiral strains retrieved from the NCBI database were trimmed and aligned. Both RPR and secY sequences consist of positions with gaps that are eliminated from the dataset resulting into 261 and 1238 nucleotide positions, respectively. To find out the best substitution model, the aligned sequences were fed into MEGA 6.0 software. The substitution model implemented in the construction of phylogenetic tree was HKY85 þ G (with discrete gamma distribution) which is considered to be the best substitution pattern as it provides the lowest Bayesian Information Criterion score. To evaluate clade support in each gene, the phylogeny was inferred using MrBayes algorithm (UGENE 1.13.3). The posterior probabilities for the desired parameters were calculated using Markov chain Monte Carlo method where the analysis was conducted for 1.5  107 generations with four heated chains discarding initial generations as burn-in. Different methods of phylogenetic analyses namely, Neighbor-joining, UPGMA, Minimum Evolution and Maximum-parsimony were also performed using MEGA 6.0 to evaluate evolutionary relationships among distinct serovars of Leptospira spp. The evolutionary history was inferred using Neighbor-joining method and the optimal tree generated was validated with bootstrapping technique conducted for 1000 replicates. The evolutionary distances were computed using the Maximum Composite Likelihood method.

V. Ravishankar et al. / Research in Microbiology 165 (2014) 813e825

819

Fig. 1. Cage structure representing secondary and tertiary interactions between nucleotides of various domains present in RPRs of (A) Leptospira interrogans serovar Copenhageni strain Fiocruz L (1e130) (pathogenic group I), (B) Leptospira kmetyi serovar Malaysia strain Bejo-Iso 9 (pathogenic group II), (C) Leptospira borgpetersenii serovar Hardjo-bovis strain L 550 (pathogenic group III), (D) Leptospira licerasiae serovar Varillal strain VAR 010 (intermediate group I), (E) Leptospira inadai serovar Lyme strain 10 (intermediate group II), (F) Leptospira biflexa serovar Patoc strain Patoc1 (Ames) (saprophyte). P1, P2, P3 etc. denote paired regions of RPR. C  U and G  U base pairings in which a dot (C) represents non-canonical base pairing. Boxed nucleotides depict the sites of co-variation. Universally conserved nucleotides present in bacterial RPRs are shown embossed within dark circles and lines connecting nucleotides indicate possible tertiary interactions between different domains. Nucleotides represented in lower case denote P4 primer annealing region on RPR gene sequence. Arrows indicate the positions of nucleotides where variations occur in RPR of leptospiral strains. RPR secondary structures of remaining Leptospira strains are deposited in the RNase P database.

820

V. Ravishankar et al. / Research in Microbiology 165 (2014) 813e825

3. Results 3.1. Sequence variability in Leptospira spp. A total of 158 RPR gene sequences were aligned and sequence similarities were estimated between different strains. The GC content of the RPR gene sequences of all Leptospira strains varied between 47 and 55%. Based on multiple sequence alignment, sequence identities of strains within their species were calculated for various leptospiral RPRs; the pathogenic species L. weilii, L. kirschneri, L. borgpetersenii, L. noguchii, L. interrogans and L. santarosai showed decreasing sequence identities of >99.5%, >99.3%, >98.3%, >98%, >97.8% and >97.6% respectively. 3.2. Structural differences of RNase P RNA The RPR sequences were folded into secondary structures based on a minimum consensus structure model. The helical configuration of the Leptospira RPR secondary structure (Fig. 1) resembled an ancient type A RPR component. Sequence alignment of RPR gene revealed 13 variable regions spread across stems, loops and bulges of RPR. These variable regions are mostly present outside the structural and functional hot spots identified as universally conserved core in bacterial RPRs. Leptospiral RPRs could be distinguished based on the presence or absence of domains P19 and/or P18 in addition to configurations of J2/3, the GAAA tetraloop in P12, the bulge present in J16/17 and single nucleotide polymorphisms (SNPs) in concordance to the pathogenic, intermediate and saprophytic status of the strains (Table 3). Interestingly, sequence and structural differences in the above RPR domains allowed us to categorise the strains of Leptospira spp. into six types as pathogenic group I (L. interrogans, L. noguchii and L. kirschneri), pathogenic group II (L. kmetyi), pathogenic group III (L. alstonii, L. weilii, L. alexanderi, L. borgpetersenii and L. santarosai), intermediate group I (L. wolffii and L. licerasiae), intermediate group II (L. inadai, L. broomii and L. fainei) and saprophytes (L. biflexa, L. yanagawae, L. terpstrae, L. vanthielii, L. wolbachii and L. meyeri) (Table 3). P18 and P19 are present in all RPRs of pathogenic groups I, II and III and intermediate group II Leptospira strains included in this study whereas strains of intermediate group I lacked P19

(Fig. 1D). RPRs of the saprophytic strains lacked both P18 and P19 (Fig. 1F). Moreover, saprophytic RPRs appeared unique at its J2/3 joining segment by containing a single G nucleotide. In contrast, all other strains of Leptospira contained a 2e5 nucleotide bulge at J2/3 (Fig. 1AeE). RPR of L. biflexa strains Patoc I (Ames) and Patoc 1 (Paris) distinguishes itself from other strains of Leptospira by a unique 10 bp stem structure with a loop containing five U residues in P3 (Fig. 1F). Strains of pathogenic group I contained an UAU internal bulge at J16/ 17 but was devoid of the GAAA tetraloop at L12. On the other hand, serovars of pathogenic group III comprised a UUU bulge at J16/17 along with a GAAA tetraloop present in L12 (Fig. 1C). L. inadai serovar Lyme strain 10 consists of A rich residues in L9 which is unique among the leptospires included in this study (Fig. 1E). Strain-specific SNPs were found in J11/12, P13, P14, J14/ 11, J15/16, P17 and J15/18 of leptospiral RPRs included in this study (Table 3). Presence of sporadic single nucleotide variations was observed in all helices of RPR of intermediate groups I and II along with a discrepant L. weilii serovar Ranarum strain ICFT, which is unique among the leptospiral strains included in this study. P9 and P12 stem-loop presented hypervariable regions where nucleotide transitions and transversions were frequently found in all leptospiral RPRs studied. Purine to purine or pyrimidine to pyrimidine transition with no consequences for the pairing of nucleotides in the secondary structure was found in the P9, P12, P13, P14 and P18 stems of all leptospiral RPRs investigated. Purine to pyrimidine and pyrimidine to purine transversions leading to mismatching were confined to P7, P9, P12 and P18 stems of pathogenic and intermediate RPRs. Nucleotide co-variations (boxed sequences in Fig. 1) occurred in the RPRs of different leptospires to retain base pairing in specific helix to maintain higher order structure. UeA base paring present in P18 of pathogenic group I was substituted with CeG in pathogenic groups II, III and in intermediate groups I and II (Table 3). Strains of L. licerasiae contain consecutive UeA to GeC and UeA to AeU co-variations in P18 in addition to AeU to GeC covariation in P16 (Fig. 1D). Saprophytic RPRs possess UeA base pairing in P8 and P14 whereas CeG was present in all other leptospiral RPRs. CeG base pairing present in P8 of pathogenic leptospiral RPRs was replaced with UeA

Table 3 Typing Leptospira spp. based on RPR features. P18

Pathogenic group I Pathogenic group II Pathogenic group III Intermediate group I Intermediate group II Saprophytes

þ þ þ þ þ 

P19 þ þ þ  þ 

J2/3

2e5 2e5 2e5 2e5 2e5 1 nt

nt nt nt nt nt

GAAA in P12

Bulge in J16/17

Covariation in P18

SNPs J11/12

P13

P14

J14/11

J15/16

P17

J15/18

  þ   

þ þ þ   

UeA CeG CeG CeG UeA 

A/G G G A/G A G

U/C U U/C C C U

A C U/C C C C

U U C A/G A U

C G U/C C U U

A C C U/C G U/C/A

G G A/G A/G A e

þ/ denotes presence or absence of specific component. Positions of covariations and SNPs were defined using nearest conserved nucleotide as land mark.

V. Ravishankar et al. / Research in Microbiology 165 (2014) 813e825

in serovars of L. biflexa, L. yanagawae serovar Saopaulo strain Saopaulo whereas non-canonical U  G was observed in L. meyeri serovar Hardjo strain Went 5 and L. meyeri serovar Semaranga strain Veldrat Semarang 173, L. vanthielii serovar Holland strain Waz Holland, L. wolbachii serovar Codice strain CDC and L. terpstrae serovar Hualin LT (11e33). AeU base pairing present in P7 and P16 of saprophytic RPRs were substituted with GeC in all other strains. 3.3. Pre-tRNA cleavage by leptospiral RPRs To confirm the validity of RPR genes included in this study, RPR genes of nine reference strains of Leptospira were cloned separately, in vitro transcribed, folded and used for RNase P cleavage assay. At elevated Mg2þ concentration, leptospiral RPRs indeed cleaved in vitro transcribed pre-tRNATyr in the absence of their protein cofactor similar to E. coli RPR (Fig. 2). Thus, as expected for bacteria, we demonstrated that leptospiral RPR alone was capable of performing its catalytic 0 function by cleaving the 5 leader sequence of pre-tRNA to produce mature tRNA. 3.4. Phylogenetic differentiation of Leptospira spp. In addition to MrBayes analysis, distance and character based matrices were employed to construct a phylogenetic tree using RPR sequences. To evaluate the reliability of RPR based phylogeny, the above analyses were also performed using secY sequences and the results were compared in the light of sequence and structural differences present in leptospiral RPRs. While employing different algorithms, similar topology was observed amongst various phylogenetic trees (data not shown). The topology of the phylogenetic trees grouped the species of Leptospira in separate clades according to their presumed pathogenic, saprophytic and intermediate status (Fig. 3A,B). In the RPR sequence based tree, intermediate

Fig. 2. RNase P cleavage products were resolved on 8% acrylamideebisacrylamide gel containing 8 M urea. Lane 1 corresponds to internally labelled pre-tRNATyr substrate incubated without RNase P whereas Lanes 2e11 correspond to labelled pre-tRNATyr cleaved by E. coli, L. noguchii, L. borgpetersenii, L. interrogans, L. kirschneri, L. santarosai, L. weilii, L. licerasiae, L. meyeri and L. biflexa RNase P respectively.

821

groups I and II branched distinctly as separate clades. Pathogenic strains of L. interrogans emerged as a clonal branch encompassing closely related strains clustered together in a clade that possibly emerged from L. kirschneri and L. noguchii. Pathogenic group II branched as a separate clade, positioned adjacent to the strains of L. kirschneri. Furthermore, L. santarosai strain CBC 613 and L. interrogans strain HAI 1536 were grouped within the L. kirschneri cluster and L. noguchii cluster, respectively. L. alexanderi serovar Manhao3 strain L 60 is located as a separate clade. L. weilii serovar Ranarum strain ICFT is clustered among the strains of L. alstonii. Both RPR and secY sequences demonstrated that strain P2653 belonged to L. weilii excluding its identity as serovar Kremastos or Hebdomadis that were proven to be the serovars of L. interrogans by DNA hybridization, hence strain P2653 could possibly be L. weilii serovar Longnan [29]. 4. Discussion In the present investigation, the structural variations observed in the RPRs of various strains of Leptospira were used to delineate the phylogeny. We evaluated RPRs of 150 strains for which the genomic sequences are available in the NCBI database along with 8 reference strain. Species and serovar specific sequence and structural variations found among RPRs allowed us to categorize the serovars consistence with their presumed speciation and grouping into clades of species with pathogenic, saprophytic and intermediate nature [30]. In addition, differences found in RPR configuration contributed to further segregation of the genus Leptospira into finer groups (pathogenic groups I, II, III, intermediate groups I and II). Moreover, comparative analysis of RPR and secY loci based phylogeny has brought in new dimension to the existing phylogenetic methods that would help understanding the evolution of Leptospira spp. into a full blown pathogen. Co-variations observed in the helices of RPRs provided useful phylogenetic information on leptospires included in this study. Nucleotide co-variations observed in many leptospiral RPRs indicate the occurrence of concerted change of nucleotides at complementary positions during the course of evolution either to retain structural integrity of the specific motif and/or to maintain long range bonding between bases of juxtapose helices to preserve tertiary folds. Presence of covariation confirms the existence of stems in higher order RPR structure and also represents possible genetic transformation among the serovars of intermediate species to attain pathogenic status over an evolutionary time scale. Certain obvious features found on RPR are reminiscent of species and serovar specific characteristics. The absence of domain P19 in saprophytic strains, including few intermediate species was compensated by an extended domain P3. Similarly, presence or absence of GAAA tetraloop in L12 impacted the length of P9 in many pathogenic and saprophytic strains. Such compensatory changes impose desirable conformation of RPR in which one motif could possibly usurp the structural and functional role of another. A bulge present in J2/3 shows striking dissimilarity between serovars of Leptospira spp.

822

V. Ravishankar et al. / Research in Microbiology 165 (2014) 813e825

V. Ravishankar et al. / Research in Microbiology 165 (2014) 813e825

Saprophytic strains contain a single G nucleotide J2/3 bulge resembling typical bacterial RPR whereas pathogenic and semipathogenic strains contain a 2e5 nucleotide bulge as identified in RPRs of archaea. The single G nucleotide at J2/3 is conserved in all saprophytic RPRs included in this study. The flanking nucleotides of conserved G at J2/3 are engaged in typical Watson-Crick base pairing confirming the robustness of base pairs present in the distal and proximal positions of P2 and P3 stems, respectively. In contrast, 2e5 nucleotide bulge present in J2/3 of other intermediate and pathogenic RPRs is flanked by ensemble of both canonical and noncanonical base pairs conferring structural flexibility to the bulge. The number of nucleotides present in the J2/3 bulge is dictated by the length of P2 stem [31]. As observed in many of the bacterial RPRs, single nucleotide J2/3 bulge is preceded by a 6 nucleotide long P2 stem whereas the 2e5 nucleotide bulge is preceded by a 7 nucleotide long P2 stem similar to archael RPRs. The nucleotide(s) present in the J2/3 bulge possibly leverage the coaxial stacking of P1, P4 and P5 and also mitigate the structural perturbations that arise out of substrate and cofactor docking into the catalytic core. This represents the evolution of J2/3 being an essential RPR component suggesting the existence of subtle differences in mode of substrate and cofactor interaction with the RPRs of Leptospira spp. Serovar specific sequence variations predominantly confined to P9 and P12 motifs of all leptospiral RPRs included in this study indicates that these regions are highly susceptible for sequence variation as they might desist from any structural or functional role. The sequence of P9 and P12 motifs could be ideal for designing probes to detect leptospires present in clinical and environmental samples. Strains of intermediate groups I and II appear as a bridge between saprophytic and pathogenic species. This observation is based on the presence or absence of P18 and/or P19 of the Leptospira RPR. Pathogenic strains consist of both P18 and P19 while saprophytic strains distinctly lacked both motifs. Absence of P18 and P19 in saprophytic RPRs implies that these might neither play a role in pre-tRNA binding nor its catalytic cleavage in these species and thus are dispensable in RPRs of certain Leptospira spp. Interestingly, intermediate species diverged into two different groups based on P18 and P19. Intermediate group I possess P18 (Fig. 1D) alone whereas Intermediate group II resemble pathogenic strains by possessing both P18 and P19 (Fig. 1E). Intermediate RPRs resembling the pathogenic RPR configuration represent how intermediate strains are evolving into another sequence type in due course of time. Genes responsible for virulence and pathogenesis identified in multiple genomic sequences of saprophytic and intermediate strains showed that nonpathogenic or semipathogenic strains are evolving into a pathogenic nature acquiring a string of virulent and pathogenic genes by lateral gene transfer [32].

823

Although serovar specific nucleotide variations are found in specific loops and stems of RPR, the core structure remains unchanged for all strains investigated. The RPR components such as P4, P5, P10, P11 and P15 that play crucial role in organizing the active site and pre-tRNA binding in other bacterial RPRs are largely unchanged in Leptospira. Analogous to many bacterial RPRs, J15/16 of leptospiral RPR is a symmetrical motif comprising conserved sequences conceivably playing a role in substrate binding. Presence of a purine rich tetraloop containing GGGU in J15/16 of all leptospiral RPR investigated indicates its plausible interaction with 0 RCCA present in 3 terminal of tRNAs. This tRNA-RPR interaction is reinforced by the identification of RCCA 0 sequence in the 3 position of many tRNA genes present in the multiple genomic sequences of Leptospira spp. Phylogenetic trees constructed using Bayesian analysis and Neighbor-Joining method [33] for sequences of RPRs and secY showed almost similar topologies albeit with two conflicts. In both RPR and secY trees, serovars of L. borgpetersenii branched into two obvious clades where serovars Hardjo-bovis, Tarassovi, Balcanica and Pomona evolved separately. In contrast to previous reports, our findings based on RPR and secY gene indicate that several strains of L. interrogans might have originated from L. kirschneri and L. noguchii. It appears that both L. interrogans and L. noguchii in turn could have emerged from L. kirschneri [34e36]. Strains of L. borgpetersenii might have evolved from L. weilii and they both are possible progenitors of L. santarosai. However, both secY and RPR trees suggest disagreement in two counts. In secY based classification, the saprophytes are shown to originate from intermediate strains whereas in RPR, the saprophytes are exemplified as progenitors of serovars of Leptospira spp. Furthermore, pathogenic group II emerges as a distinct clade in RPR based tree whereas in secY it remains clustered among the strains of pathogenic group III. The comparison of RPR and secY sequence analyses revealed that some of the strains either emerged from a distinct species, thus acquiring sufficient divergence to be placed along with another species or serologic incongruities occurred during strain identification misplacing their taxonomic position. L. sp. serovar Kenya, strain SH 9 has been identified as L. borgpetersenii confirming previous observations based on similar DNA fingerprinting patterns of this strain [37]. Sequence and structural similarities and phylogenetic conclusions ascribe strain Fiocruz LV 3954 and strain Fiocruz LV 4135 to L. santarosai as their most likely species whereas strain B (5-022) and strain P 2653 belong to L. licerasiae and L. weilii, respectively. The strain P 2653, has been typed serologically to either serovar Hebdomadis, Kremastos or Longnan. The present study identifies the strain as L. weilii, serovar Longnan, showing the power of the presented molecular tool to type strains where serological approaches fail. Based on the conclusions derived from RPR and

Fig. 3. Sequences of RPR (A) and secY (B) genes were used for Bayesian analysis and Neighbor-Joining method to construct the phylogenetic trees of 158 leptospiral strains. The evolutionary distances were calculated based on Maximum Composite Likelihood method. Optimal tree for both RPR and secY genes with the sum of branch length 1.23946 and 2.45485, respectively was obtained using MEGA 6.0 software. The branches whose posterior probability values 50% (data not shown). The strains identified as discrepant in the present study are shown in black.

824

V. Ravishankar et al. / Research in Microbiology 165 (2014) 813e825

secY analyses, L. santarosai strain CBC 613 is abnormally clustered among L. kirschneri serovars. Moreover, presence of L. kirschneri RPR signature UAU internal bulge in J16/17 and absence of GAAA tetraloop confirms that L. santarosai strain CBC 613 belongs to L. kirschneri. Similarly, L. interrogans strain HAI 1536 is placed within the L. noguchii cluster both in the RPR and secY derived trees, indicating that strain HAI 1536 belongs to L. noguchii rather than to L. interrogans. We suppose an error or sample switch during the initial characterization of these two strains resulting into their misclassification, and suggest that the strains are re-classified to L. kirschneri, strain CBC 613 and L. noguchii, strain HAI 1536, respectively. Our finding of the initial incorrect speciation of these two strains further substantiates the strength of our typing approach. L. meyeri serovar Hardjo strain Went 5 is grouped with L. biflexa cluster as observed in the previous reports [38,39]. Based on RPR and secY analysis, the phylogenetic position of L. weilii serovar Ranarum strain ICFT is debatable as it is clustered with serovars of L. alstonii instead of L. weilii. These observations together obviate the existence of strains with doubtful taxonomic status in reference collections and the occurrence of sample and/or data switches, stressing the need to consider identities of strains and deposited genome sequences with care. Present study demonstrated that phylogenetic deviations showing aberrant taxonomic positions of leptospiral strains could be evaluated by the comparative analysis of RPR structural configurations that are unique to each serovar. RPR structural differences among serovars present a simple and straight forward way of studying diversity of Leptospira at the species and serovar level. Considering its essential role in cellular metabolism, being refractory to both lateral gene transfer and momentary sequence changes, RPR gene might be an ideal signature moiety conferring a valid taxonomic status of the genus [40]. Being an informational gene, RPR appears more exquisite in classifying the Leptospira spp. than the operational secY gene which might be susceptible for lateral gene transfer [41]. Furthermore, this investigation provided an opportunity to construct RPR structures of 158 leptospiral strains, which is the largest structural data available for a single genus in the RNase P database. This would help shedding more light on structural and functional in sights of bacterial RNase P in general. Acknowledgments The authors would like to thank Dr. Sidney Altman, Professor, Yale University, New Haven, USA for kindly providing 0 pJA 2 and pTyr plasmids. We also thank M. Marimuthu for technical assistance. This work was supported by the All India Council for Technical Education, New Delhi, Research Promotion Scheme project (8023/RID/RPS-39/Pvt (II Policy) 2011e2012 dated 13 Aug 2012). Appendix A. Supplementary material Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.resmic.2014.10.007.

References [1] Herrmann B, Pettersson B, Everett KD, Mikkelsen NE, Kirsebom LA. Characterization of the rnpB gene and RNase P RNA in the order Chlamydiales. Int J Syst Evol Microbiol 2000;50(1):149e58. [2] Rubin CJ, Thollesson M, Kirsebom LA, Herrmann B. Phylogenetic relationships and species differentiation of 39 Legionella species by sequence determination of the RNase P RNA gene rnpB. Int J Syst Evol Microbiol 2005;55:2039e49. [3] Schon A, Fingerhut C, Hess WR. Conserved and variable domains within divergent RNase P RNA gene sequences of Prochlorococcus strains. Int J Syst Evol Microbiol 2002;52:1383e9. [4] Tapp J, Thollesson M, Herrmann B. Phylogenetic relationships and genotyping of the genus Streptococcus by sequence determination of the RNase P RNA gene, rnpB. Int J Syst Evol Microbiol 2003;53:1861e71. [5] Altman S, Kirsebom LA. In: Gesteland RF, Cech T, Atkins JF, editors. The RNA world. 2nd ed. New York: Cold Spring Harbor Laboratory Press Plainview; 1999. p. 351e80. [6] Frank DN, Pace NR. Ribonuclease P: unity and diversity in a tRNA processing ribozyme. Annu Rev Biochem 1998;67:153e80. [7] Brown JW, Pace NR. Ribonuclease P RNA and protein subunits from bacteria. Nucleic Acids Res 1992;20:1451e6. [8] Gopalan V, Vioque A, Altman S. RNase P: variations and uses. J Biol Chem 2002;277:6759e62. [9] Reich C, Olsen GJ, Pace B, Pace NR. Role of the protein moiety of ribonuclease P, a ribonucleoprotein enzyme. Science 1988;239:178e81. [10] Stark BC, Kole R, Bowman EJ, Altman S. Ribonuclease P: an enzyme with an essential RNA component. Proc Natl Acad Sci U S A 1978;75:3717e21. [11] Guerrier-Takada C, Gardiner K, Marsh T, Pace N, Altman S. The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme. Cell 1983;35:849e57. [12] Pannucci JA, Haas ES, Hall TA, Harris JK, Brown JW. RNase P RNAs from some Archaea are catalytically active. Proc Natl Acad Sci U S A 1999;96:7803e8. [13] Buck AH, Kazantsev AV, Dalby AB, Pace NR. Structural perspective on the activation of RNAse P RNA by protein. Nat Struct Mol Biol 2005;12:958e64. [14] Massire C, Jaeger L, Westhof E. Derivation of the three-dimensional architecture of bacterial ribonuclease P RNAs from comparative sequence analysis. J Mol Biol 1998;279:773e93. [15] Torres-Larios A, Swinger KK, Pan T, Mondragon A. Structure of ribonuclease P e a universal ribozyme. Curr Opin Struct Biol 2006;16:327e35. [16] Tsai HY, Masquida B, Biswas R, Westhof E, Gopalan V. Molecular modeling of the three-dimensional structure of the bacterial RNase P holoenzyme. J Mol Biol 2003;325:661e75. [17] Kazantsev AV, Krivenko AA, Harrington DJ, Holbrook SR, Adams PD, Pace NR. Crystal structure of a bacterial ribonuclease P RNA. Proc Natl Acad Sci U S A 2005;102:13392e7. [18] Kazantsev AV, Rambo RP, Karimpour S, Santalucia Jr J, Tainer JA, Pace NR. Solution structure of RNase P RNA. RNA 2011;17:1159e71. [19] Krasilnikov AS, Yang X, Pan T, Mondragon A. Crystal structure of the specificity domain of ribonuclease P. Nature 2003;421:760e4. [20] Krasilnikov AS, Xiao Y, Pan T, Mondragon A. Basis for structural diversity in homologous RNAs. Science 2004;306:104e7. [21] Loria A, Pan T. Domain structure of the ribozyme from eubacterial ribonuclease P. RNA 1996;2:551e63. [22] Torres-Larios A, Swinger KK, Krasilnikov AS, Pan T, Mondragon A. Crystal structure of the RNA component of bacterial ribonuclease P. Nature 2005;437:584e7. [23] Brown JW, Pace NR. Structure and evolution of ribonuclease P RNA. Biochimie 1991;73:689e97. [24] Levett PN. Leptospirosis. Clin Microbiol Rev 2001;14:296e326. [25] Saito M, Villanueva SY, Kawamura Y, Iida K, Tomida J, Kanemaru T, et al. Leptospira idonii sp. nov., isolated from environmental water. Int J Syst Evol Microbiol 2013;63:2457e62.

V. Ravishankar et al. / Research in Microbiology 165 (2014) 813e825 [26] Ellinghausen Jr HC, McCullough WG. Nutrition of Leptospira pomona and growth of 13 other serotypes: fractionation of oleic albumin complex and a medium of bovine albumin and polysorbate 80. Am J Vet Res 1965;26:45e51. [27] Johnson RC, Harris VG. Differentiation of pathogenic and saprophytic letospires. I. Growth at low temperatures. J Bacteriol 1967;94:27e31. [28] Robertson HD, Altman S, Smith JD. Purification and properties of a specific Escherichia coli ribonuclease which cleaves a tyrosine transfer ribonucleic acid precursor. J Biol Chem 1972;247:5243e51. [29] Brenner DJ, Kaufmann AF, Sulzer KR, Steigerwalt AG, Rogers FC, Weyant RS. Further determination of DNA relatedness between serogroups and serovars in the family Leptospiraceae with a proposal for Leptospira alexanderi sp. nov. and four new Leptospira genomospecies. Int J Syst Bacteriol 1999;49(Pt 2):839e58. [30] Ahmed A, Grobusch MP, Klatser P, Hartskeerl RA. Molecular approaches in the detection and characterization of Leptospira. J Bacteriol Parasitol 2012;3:133. [31] Haas ES, Armbruster DW, Vucson BM, Daniels CJ, Brown JW. Comparative analysis of ribonuclease P RNA structure in Archaea. Nucleic Acids Res 1996;24:1252e9. [32] Ricaldi JN, Fouts DE, Selengut JD, Harkins DM, Patra KP, Moreno A, et al. Whole genome analysis of Leptospira licerasiae provides insight into leptospiral evolution and pathogenicity. PLoS Negl Trop Dis 2012;6:e1853. [33] Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406e25. [34] Ahmed N, Devi SM, Valverde Mde L, Vijayachari P, Machang'u RS, Ellis WA, et al. Multilocus sequence typing method for identification and genotypic classification of pathogenic Leptospira species. Ann Clin Microbiol Antimicrob 2006;5:28.

825

[35] Cerqueira GM, McBride AJ, Picardeau M, Ribeiro SG, Moreira AN, Morel V, et al. Distribution of the leptospiral immunoglobulin-like (lig) genes in pathogenic Leptospira species and application of ligB to typing leptospiral isolates. J Med Microbiol 2009;58:1173e81. [36] Victoria B, Ahmed A, Zuerner RL, Ahmed N, Bulach DM, Quinteiro J, et al. Conservation of the S10-spc-alpha locus within otherwise highly plastic genomes provides phylogenetic insight into the genus Leptospira. PLoS ONE 2008;3:e2752. [37] Machang'u RS, Mgode GF, Assenga J, Mhamphi G, Weetjens B, Cox C, et al. Serological and molecular characterization of Leptospira serovar Kenya from captive African giant pouched rats (Cricetomys gambianus) from Morogoro Tanzania. FEMS Immunol Med Microbiol 2004;41: 117e21. [38] Morey RE, Galloway RL, Bragg SL, Steigerwalt AG, Mayer LW, Levett PN. Species-specific identification of Leptospiraceae by 16S rRNA gene sequencing. J Clin Microbiol 2006;44:3510e6. [39] Wangroongsarb P, Chanket T, Gunlabun K, Long do H, Satheanmethakul P, Jetanadee S, et al. Molecular typing of Leptospira spp. based on putative O-antigen polymerase gene (wzy), the benefit over 16S rRNA gene sequence. FEMS Microbiol Lett 2007;271:170e9. [40] Li Y, Altman S. In search of RNase P RNA from microbial genomes. RNA 2004;10:1533e40. [41] Jain R, Rivera MC, Lake JA. Horizontal gene transfer among genomes: the complexity hypothesis. Proc Natl Acad Sci U S A 1999;96:3801e6. [42] Slack AT, Galloway RL, Symonds ML, Dohnt MF, Smythe LD. Reclassification of Leptospira meyeri serovar Perameles to Leptospira interrogans serovar Perameles through serological and molecular analysis: evidence of a need for changes to current procedures in Leptospira taxonomy. Int J Syst Evol Microbiol 2009;59:1199e203.