EXD2 promotes homologous recombination by facilitating DNA end resection.

A RT I C L E S

EXD2 promotes homologous recombination by facilitating DNA end resection Ronan Broderick1,4, Jadwiga Nieminuszczy1,4, Hannah T. Baddock2, Rajashree A. Deshpande3, Opher Gileadi2, Tanya T. Paull3, Peter J. McHugh1 and Wojciech Niedzwiedz1,5 Repair of DNA double-strand breaks (DSBs) by homologous recombination (HR) is critical for survival and genome stability of individual cells and organisms, but also contributes to the genetic diversity of species. A vital step in HR is MRN–CtIP-dependent end resection, which generates the 30 single-stranded DNA overhangs required for the subsequent strand exchange reaction. Here, we identify EXD2 (also known as EXDL2) as an exonuclease essential for DSB resection and efficient HR. EXD2 is recruited to chromatin in a damage-dependent manner and confers resistance to DSB-inducing agents. EXD2 functionally interacts with the MRN complex to accelerate resection through its 30 –50 exonuclease activity, which efficiently processes double-stranded DNA substrates containing nicks. Finally, we establish that EXD2 stimulates both short- and long-range DSB resection, and thus, together with MRE11, is required for efficient HR. This establishes a key role for EXD2 in controlling the initial steps of chromosomal break repair. DNA double-strand breaks (DSBs) are extremely cytotoxic lesions that can arise during normal cellular processes or are induced by exogenous factors such as ionizing radiation (IR) as well as many commonly used anticancer drugs. The faithful repair of DSBs is essential for cell survival and organismal development, as defective repair can contribute to a plethora of inherited human syndromes with life-threatening symptoms including cancer, neurodegeneration or premature ageing1,2. The two major pathways involved in the repair of DSBs in eukaryotic cells are non-homologous end joining and homologous recombination (HR; refs 3–5). A key initial step in HR is resection of the DNA ends on either side of the break, which is carried out initially by the MRE11–RAD50–NBS1 complex (MRN) and CtIP (also known as RBBP8, retinoblastoma binding protein 8) to generate short stretches of single-stranded DNA (ssDNA; refs 6–8). Subsequently, the EXO1 (exonuclease 1) or DNA2 (DNA replication helicase/nuclease 2) nucleases, in conjunction with the Bloom syndrome helicase (BLM), extend these to generate longer 30 ssDNA tails9–15. These ssDNA strands are then bound by replication protein A (RPA; refs 10–12,16–18), which is subsequently replaced by RAD51 in a BRCA2 (breast cancer 2)-dependent manner, leading to the formation of ssDNA–RAD51 nucleoprotein filaments essential for the strand exchange process3,19. In vitro, MRE11 displays a weak endo- and exonuclease activity, which may be due to

the lack of accessory factors16,20. Accordingly, work from multiple laboratories has shown that CtIP, or its yeast homologue Sae2 (sporulation in the absence of spo eleven), can stimulate MRE11’s endonuclease activity9,16–18. Interestingly, MRE11 has also been shown to nick the DNA strand to be resected in multiple positions, as far as 300 base pairs (bp) from the break itself, suggesting that resection could proceed from several entry points that are distal to the DSB (refs 21,22). However, it is unclear whether this would enhance MRE11-dependent nucleolytic processing of DNA ends, thus generating a better substrate for subsequent processing of the break by BLM–DNA2 and/or BLM–EXO1 complexes, or allow access for additional factors accelerating the initial strand processing. Indeed, the inhibition of MRE11’s endonuclease activity confers a stronger resection defect than inhibition of its exonuclease activity, suggesting perhaps that initial break processing might be also carried out by other exonucleases23. Here we identify EXD2 (exonuclease 30 –50 domain containing 2) as a cofactor of the MRN complex required for efficient DNA end resection, recruitment of RPA, HR and suppression of genome instability. EXD2 is required for repair of damage to DNA In an effort to identify factors required to promote HR, we carried out an unbiased proteomic approach to define the CtIP interactome.

1

Department of Oncology, Weatherall Institute of Molecular Medicine, University of Oxford, Oxford OX3 9DS, UK. 2Structural Genomics Consortium, Old Road Campus Research Building, Roosevelt Drive, University of Oxford, Oxford OX3 7DQ, UK. 3The Howard Hughes Medical Institute and Department of Molecular Biosciences, Institute for Cellular and Molecular Biology, University of Texas at Austin, Austin, Texas 78712, USA. 4These authors contributed equally to this work. 5 Correspondence should be addressed to W.N. (e-mail: [email protected]) Received 8 July 2015; accepted 17 December 2015; published online 25 January 2016; DOI: 10.1038/ncb3303

NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION

© 2016 Macmillan Publishers Limited. All rights reserved

1

IP

130 GFP–CtIP

70

EXD2

170

GFP–CtIP

80 60 40 Control siRNA EDX2 siRNA 1 EDX2 siRNA 2

20 0 0

0.5

1.0

1.5

IR (Gy)

f

80 60 40 Control siRNA EDX2 siRNA 1 EDX2 siRNA 2

20 0

2.0

2.5

0

1

2

+

70

MRE11

70

Flag–EXD2

CtIP BRCA1

70

MRE11

70

Flag–EXD2

100 80 60 40 Control siRNA EDX2 siRNA 1 EDX2 siRNA 2

20 0 0

3

1 µM CPT CtIP BRCA1

235 Inputs Percentage survival

Percentage survival

100

e

100

–

130

Percentage survival

d

–

235

70 EXD2

Flag–EXD2

Mr (K)

HEK293FT

Mr (K) 170

IP: Flag–EXD2

Peptides 50 11 8 8 6 6

Inputs

Protein CtIP EXD2 EXO1 MRE11 CTBP1 CTBP2

c GFP IP

b Beads

a

Flag–EXD2

A RT I C L E S

0.5

1.0

1.5

2.0

2.5

Phleomycin (µg ml–1)

CPT (nM)

Figure 1 EXD2 is a CtIP interactor and its depletion sensitizes cells to DNA damage. (a) Table showing proteins identified in immunoprecipitation (IP)–mass spectrometry analysis of GFP-Trap purification from U2OS cells stably expressing GFP–CtIP. (b) Input (0.4% of total IP) and eluate fractions from IPs of lysates prepared from U2OS cells stably expressing GFP–CtIP are shown with blocked agarose beads serving as a negative control (beads). Unprocessed original scans of blots are shown in Supplementary Fig. 7. This experiment was carried out once as a validation of mass spectrometry data. (c) Input (0.4% of total IP) and eluate fractions of

Flag–HA–EXD2 pulldowns from HEK293FT cells transiently expressing this fusion protein treated with 1 µM CPT for 1 h or left untreated as indicated. IP performed on mock-transfected HEK293FT cells serves as a negative control. This experiment was carried out twice independently. Unprocessed original scans of blots are shown in Supplementary Fig. 7. (d–f) U2OS cells 72 h post transfection with control siRNA or two independent siRNAs targeting EXD2 were treated with the indicated doses of either IR (d), CPT (e) or phleomycin (f). Survival data represent mean ± s.e.m. (n = 3 independent experiments).

Here, we have identified EXD2, a largely uncharacterized protein with a putative exonuclease domain, as a candidate CtIP binding partner (Fig. 1a). We validated this interaction by co-immunoprecipitations from human cell extracts and found that we could readily detect endogenous EXD2 by western blotting of green fluorescent protein (GFP)–CtIP immunoprecipitates (Fig. 1b). Endogenous CtIP, as well as its known interactors MRE11 and BRCA1, were detected in reciprocal Flag–EXD2 immunoprecipitates (Fig. 1c; lysates were treated with Benzonase to prevent DNA bridging). Therefore, we conclude that the two proteins probably exist in the same complex in cells. EXD2 is highly conserved across vertebrates (Supplementary Fig. 1) and was recently identified in the screen for suppression of sensitivity to mitomycin C (ref. 24). However, the biological and biochemical features of this protein are unknown. As we identified EXD2 as an interactor of DSB-repair factors, we tested its requirement in response to a range of DSB-inducing agents, namely IR, camptothecin (CPT) and phleomycin. We found that depletion of EXD2 by two different short interfering RNAs (siRNAs) sensitized U2OS cells to these agents (Fig. 1d–f and Supplementary Fig. 2a,b). Taken together, these results suggest a putative role for this protein in the repair of damaged DNA.

EXD2 promotes DNA end resection and the generation of ssDNA CtIP is essential for efficient DNA end processing during DSB repair, with cells depleted for this factor showing a defect in the generation of ssDNA and the subsequent formation of RPA foci16,25,26. Thus we hypothesized that EXD2 may promote DNA end resection. To test this, we analysed RPA focus formation in response to both CPT and IR in wild-type (WT) and EXD2-depleted cells. Strikingly, cells depleted for EXD2 showed severely impaired kinetics of RPA focus formation in response to both treatments (Fig. 2a,b and Supplementary Fig. 2c,d). RPA2 phosphorylation at Ser4 and Ser8 has been widely used as a marker for the generation of ssDNA by DNA end resection27. Consistent with the data above, EXD2-depleted cells showed impaired RPA Ser4, Ser8 phosphorylation in response to DNA damage (Fig. 2c and Supplementary Fig. 2e). Treatment with both agents resulted in a robust phosphorylation of histone H2AX (also known as H2AFX) and CHK2 (also known as CHEK2) (Fig. 2c and Supplementary Fig. 2e), confirming induction of DNA damage in cells. Moreover, since these responses were intact in EXD2-depleted cells, EXD2 is most likely not required for initial sensing of the DNA damage. Failure to generate RPA foci could be associated either with a defect in exonucleolytic

2



A RT I C L E S c

b

DAPI RPA

Percentage of cells with >15 RPA foci per nucleus

P = 0.0011

DAPI RPA

Untreated

1 μM CPT

EXD2 siRNA

40

20

Untreated

Control siRNA

DAPI BrdU

DAPI BrdU

1 μM CPT Untreated EXD2 siRNA

DAPI BrdU Untreated

1 μM CPT

30

RPA2 pSer4/Ser8

30 18

RPA2

18

H3

γH2AX

f

1 μM CPT

DAPI BrdU 1 μM CPT

e Percentage of cells with >15 BrdU foci per nucleus (%)

d

EXD2 CHK2 pThr68

Control siRNA EXD2 siRNA

DAPI RPA

Untreated

Control siRNA EXD2 siRNA 0 20 60 0 20 60 CPT (min)

60

0 DAPI RPA

Mr (K) 70

P = 0.0004

Mr (K) 70

93 130

40 Control siRNA EXD2 siRNA

–

+

Chromatin

Control siRNA

Nuclear soluble

a

–

+

Phleomycin MRE11 NBS1 CtIP

70 EXD2

20

30

RPA2 pSer4/Ser8

30

RPA2

18

γH2AX

18

H3

0 Untreated

1 μM CPT

Figure 2 EXD2 depletion impairs DNA end resection following DSB induction. (a) Representative images of U2OS cells 72 h post transfection with control siRNA or an siRNA oligonucleotide targeting EXD2 (EXD2 siRNA) treated with 1 µM CPT for 1 h as indicated and stained for RPA and 4,6-diamidino-2phenylindole (DAPI). Scale bars, 20 µm. (b) Quantification of the percentage of U2OS cells treated as in a with more than 15 RPA foci per nucleus. Bars represent ±s.e.m. n = 412 cells (control siRNA, untreated), 358 cells (EXD2 siRNA, untreated), 396 cells (control siRNA, 1 µM CPT) and 403 cells (EXD2 siRNA, 1 µM CPT), grouped from three independent experiments. Statistical significance was determined by the Chi-square test. (c) Western blotting of various DDR proteins in U2OS cells 72 h post transfection with control siRNA or an siRNA oligonucleotide targeting EXD2 (EXD2 siRNA) treated with 1 µM CPT for indicated lengths of time. CHK2 pThr68 acts as a control for ATM activation, RPA2 pSer4, Ser8 acts to indicate resection efficiency and γH2AX serves to indicate DSB induction, with RPA and histone H3 acting as loading controls. This experiment was carried out twice independently. Unprocessed

original scans of blots are shown in Supplementary Fig. 7. (d) Representative images of U2OS cells 72 h post transfection with control siRNA or an siRNA oligonucleotide targeting EXD2 (EXD2 siRNA) treated with 1 µM CPT for 1 h as indicated and stained for BrdU and DAPI. BrdU staining was carried out under non-denaturing conditions, with foci indicating the presence of ssDNA. Scale bars, 5 µm. (e) Quantification of the percentage of U2OS cells treated as in d exhibiting more than 15 BrdU foci per nucleus. n = 311 cells (control siRNA, untreated), 300 cells (EXD2 siRNA, untreated), 300 cells (control siRNA, 1 µM CPT) and 300 cells (EXD2 siRNA, 1 µM CPT), grouped from three independent experiments. Error bars represent ±s.e.m. The Chisquare test was used to determine statistical significance. (f) Chromatin fractionation of HeLa cells untreated or treated with 500 µM phleomycin for 1 h as indicated. γH2AX and RPA2 pSer4, Ser8 are used as markers of DNA damage and histone H3 acts as a loading control. This experiment was carried out twice independently. Unprocessed original scans of blots are shown in Supplementary Fig. 7.

processing of the DSB into ssDNA, or with impaired recruitment of RPA itself to ssDNA. To distinguish between these two possibilities we tested the efficiency of ssDNA generation in EXD2-depleted cells exposed to DNA damage. To this end, we labelled cells with 5-bromodeoxyuridine (BrdU) and then employed immunofluorescence microscopy using an anti-BrdU antibody under non-denaturing conditions to detect stretches of ssDNA. Depletion of EXD2 significantly reduced formation of ssDNA foci (Fig. 2d,e), suggesting impaired resection. This is reminiscent of the phenotype observed in cells depleted for essential components of DNA end resection machinery, such as MRE11 or CtIP (refs 6,16). Importantly, these phenotypes were not due to changes in the cell cycle, as EXD2 depletion had little

effect on the overall cell-cycle distribution profile (Supplementary Fig. 2f). Despite multiple attempts, we were unable to visualize EXD2 recruitment to DNA damage foci. In this regard, we note that certain other proteins involved in DNA repair do not readily form cytologically discernible foci in mammalian cells, that is, Ku70, Ku80 or DNA2. However, EXD2 was recruited to chromatin in HeLa cells on DNA damage as assayed by subcellular fractionation (Fig. 2f), supporting its putative role in the processing of DSBs. A similar recruitment was also observed for the key resection factor MRE11 (Fig. 2f). Taken together, these results indicate that EXD2 is a putative component of the resection machinery required for the efficient processing of DSBs.



3

A RT I C L E S a

b Percentage of RAD51-focus-positive cells

Control siRNA

DAPI RAD51

DAPI RAD51

8 Gy IR

Untreated EXD2 siRNA

DAPI RAD51

DAPI RAD51

P = 0.008

60


40

20

0

8 Gy IR

Untreated

8 Gy IR

Untreated

c

P < 0.0001

d

e 1.0 Chromosomal aberrations per metaphase

100 Percentage survival

Percentage HR efficiency

100

80 60 40


80 60 40 20

20 0 0

0 Control siRNA

0.2

EXD2 siRNA

0.4

0.6 0.8 1.0 Olaparib (µM)

1.2

1.4

P = 0.004

0.8 0.6 0.4 0.2 0 Control siRNA

EXD2 siRNA

Figure 3 EXD2 promotes HR and suppresses genome instability. (a) RAD51 foci in U2OS cells 72 h following transfection with control siRNA or an siRNA oligonucleotide targeting EXD2 (EXD2 siRNA). Cells were either untreated or were exposed to 8 Gy IR and left to recover for 6 h before fixation and staining for RAD51 and DAPI as indicated. Scale bars, 20 µm. (b) Quantification of the percentage of cells treated as in a exhibiting RAD51 foci; n = 334 cells (control siRNA, untreated), 368 cells (EXD2 siRNA, untreated), 378 cells (control siRNA, 8 Gy IR) and 376 cells (EXD2 siRNA, 8 Gy IR), grouped from three independent experiments. Error bars represent ±s.e.m. The Chi-square test was used to determine statistical significance. (c) Quantification of the relative efficiency of HR as measured by the DR-GFP assay (see Methods for details) in cells treated with control siRNA or an siRNA oligonucleotide targeting EXD2 (EXD2 siRNA). The efficiency of HR

following transient expression of I-SceI enzyme was analysed by fluorescenceactivated cell sorting (FACS) and EXD2 siRNA samples were compared with the control siRNA (normalized to 100%). Data represent the mean ± s.e.m. (n = 3 independent experiments). Statistical significance was determined using Student’s t-test. (d) siRNA treatment was carried out using either control siRNA or siRNA targeting EXD2 (EXD2 siRNA) in cells treated with the indicated doses of olaparib. Survival data represent mean ± s.e.m. (n = 3 independent experiments). (e) Quantification of the frequency of chromosomal aberrations from mitotic spreads prepared from U2OS cells treated with control siRNA or an siRNA smartpool targeting EXD2 (EXD2 siRNA). Error bars represent ±s.e.m., n = 75 metaphase spreads pooled from three independent experiments. Statistical significance was determined using Student’s t-test.

EXD2 promotes HR and suppresses genome instability

instability, and in line with this we found a significantly greater number of chromosomal aberrations in EXD2-depleted U2OS cells as compared with the WT control (Fig. 3e). Taken together, these data support a role for EXD2 in promoting HR and genome stability.

In vivo RPA is required for RAD51 focus formation, and in vitro it has been shown to promote RAD51-mediated strand exchange28,29. Consistent with this, treatment of U2OS cells with IR generated large numbers of RAD51 foci (Fig. 3a,b). In contrast, EXD2 depletion significantly impaired RAD51 focus formation (Fig. 3a,b). RAD51– ssDNA nucleoprotein filament formation is a crucial step in DSB repair by HR (refs 30–32). To examine if EXD2 is also required for efficient HR we used a U2OS cell line carrying an integrated HR reporter transgene and an I-SceI recognition sequence33. Transient expression of I-SceI endonuclease generates a DSB that, when repaired by HR, restores the expression of a functional GFP protein. We found that depletion of EXD2 significantly decreased the frequency of HR (Fig. 3c). Cells defective in HR are intrinsically sensitive to poly ADP ribose polymerase (PARP) inhibitors34. Accordingly, EXD2 depletion sensitized cells to the PARP inhibitor olaparib (Fig. 3d). Failure to efficiently repair damaged DNA is associated with chromosomal

4

Exonuclease activity of EXD2 facilitates the generation of ssDNA The MRN complex processes DSBs to generate ssDNA, which requires MRE11’s 30 –50 exonuclease activity20,35. Interestingly, EXD2 has a predicted exonuclease fold, which has sequence homology to the 30 –50 exonuclease domain of the Werner syndrome protein (WRN). Analysis of the alignment between EXD2 and WRN identified two key amino acids (Asp 108 and Glu 110) within the putative exonuclease domain of EXD2, which are also highly conserved in other DnaQ type exonucleases, including WRN, that coordinate the binding of metal ions within the active site36 (Supplementary Fig. 3a). Mutation of the equivalent residues in WRN (Asp 82 and Glu 84) renders



A RT I C L E S a Time (min)

EXD2 WT

EXD2 D108A–E110A

0 30 60

0 30 60

b

c

ssDNA ∗

5′

EXD2 WT Time (min) 0 30 60

50-mer

50-mer

dAMP Degradation products

Degradation products

50-mer Time (min)

d

3′ ∗ ssDNA

3′ ssDNA

0 15 30 60

f

2

∗

3′

GF fraction: 1 2 3 4 5 6 7 8


EXD2 WT 0 15 30 Endonuclease products

∗

5

–

50-mer EXD2 WT 0 15 30

3′ ssDNA

0

EXD2 D108A–E110A

0 15 30 60

50-mer

∗

5

dsDNA

e

EXD2 WT Time (min)

2

EXD2 WT

∗ ssDNA

3′


∗

0

∗ dsDNA

∗ GF fraction: 1

2

3

3′ ssDNA 4 5 6 7

8 Mr (K) 70

Coomassie 41

5′ overhang

Figure 4 EXD2 displays 30 –50 exonuclease activity in vitro. (a) 50 -radiolabelled ssDNA 50-mer substrate (10 nM molecules) was incubated for the indicated lengths of time with EXD2 WT or EXD2 D108A–E110A mutant protein (70 nM). Samples were resolved on a 20% Tris–boric acid–EDTA (TBE)–urea polyacrylamide gel and visualized by phosphorimaging. This experiment was carried out twice independently. (b) 30 -radiolabelled ssDNA 50-mer substrate (0.25 µM molecules) was incubated for the indicated amounts of time with EXD2 WT or EXD2 D108A–E110A (70 nM) mutant protein. Samples were resolved by thin layer chromatography in 1 M sodium formate at pH 3.4 and visualized by phosphorimaging. This experiment was carried out twice independently. (c) 50 dsDNA 50-mer substrates (10 nM molecules) were incubated for the indicated lengths of time with EXD2 WT protein (70 nM). Samples were resolved on a 20% TBE–urea polyacrylamide gel and visualized by phosphorimaging. This experiment was carried out twice independently. (d) 50 -radiolabelled ssDNA or dsDNA with 50 overhang substrate (3 nM

molecules) was incubated for indicated lengths of time with EXD2 WT (Lys76–Val564) protein (25 nM). Samples were resolved on a 20% TBE–urea polyacrylamide gel and visualized by phosphorimaging. This experiment was carried out twice independently. (e) 50 -radiolabelled ssDNA or dsDNA (3 nM molecules) with the 30 end blocked by biotin—streptavidin was incubated for the indicated time with EXD2 WT (Lys76–Val564) protein (25 nM) in buffer supplemented with 1 mM ATP. Samples were resolved on a 20% TBE–urea polyacrylamide gel and visualized by phosphorimaging. This experiment was carried out twice independently. (f) Upper panel: EXD2 WT (Lys76–Val564) gel-filtration (GF) fractions were tested for nuclease activity against 50 -radiolabelled ssDNA (10 nM molecules). Reactions were incubated for 30 min, resolved on a 15% TBE–urea polyacrylamide gel and visualized by phosphorimaging. Lower panel: Coomassie blue-stained gel depicting the EXD2 protein in gel-filtration fractions analysed in the upper panel. This experiment was carried out twice independently.

the protein devoid of nuclease activity37. Therefore, we hypothesized that the equivalent residues in EXD2 may be also required for its putative nuclease activity. To test this, we expressed the full-length glutathione S-transferase (GST)-tagged EXD2 and the D108A and E110A mutant protein in bacteria, and purified them to apparent homogeneity (Supplementary Fig. 3b). Next, we tested the activity of these purified proteins on ssDNA radiolabelled on the 30 or 50 end (Fig. 4a,b). We found that purified EXD2, but not the D108A and E110A mutant, exhibited a robust nuclease activity on short 50 labelled ssDNA (Fig. 4a). Furthermore, a time course of the 30 labelled substrate digestion indicates that EXD2 degrades the labelled DNA strand from the 30 end, as evidenced by the release of the single labelled nucleotide (Fig. 4b). This data shows that EXD2 displays a 30 –50 exonuclease activity in vitro. Moreover, under these conditions the WT protein exhibited only weak activity towards blunt end doublestranded DNA (dsDNA; Fig. 4c). To verify this data, we also identified a highly soluble truncated form of EXD2 (spanning residues Lys76 through to Val564, containing the predicted exonuclease domain)

that can be produced at very high yields and purity in a three-step procedure (Supplementary Fig. 3c–e). This version of EXD2, and its D108A E110A variant, behaved indistinguishably from full-length EXD2 (Supplementary Fig. 3f). In addition, the protein showed only a weak activity towards dsDNA with a resected 30 end (Fig. 4d), and did not display any endonuclease activity on ssDNA or dsDNA with a biotin/streptavidin-blocked 30 end (Fig. 4e). Importantly, purified EXD2 displayed a robust exonuclease activity, which co-elutes with the protein (Fig. 4f). Thus our data identify EXD2 as a bone fide exonuclease with a 30 –50 polarity. To address the potential biological significance of EXD2’s exonuclease activity, we tested whether this activity was required to promote DNA end resection in vivo. To this end, we examined the phenotypes of two independently derived U2OS clones stably expressing WT or the nuclease-dead (D108A and E110A) EXD2 mutant. The endogenous protein was depleted with siRNA targeting the 30 untranslated region (UTR) of EXD2 (Supplementary Fig. 4a). Notably, cells expressing the nuclease-dead protein did not correct



5

b Percentage of cells with >15 RPA foci per nucleus

a

Percentage of cells with >15 BrdU foci per nucleus

A RT I C L E S

60 P < 0.0001 P < 0.0001

P < 0.0001 40

20

0 EXD2 siRNA

–

+

+ – + – Clone 1 Clone 2

U2OS

P < 0.0001 60

P = 0.001 P = 0.007

40

20

0 EXD2 siRNA –

+ – + – Clone 1 Clone 2 +Flag–HA–EXD2 D108A–E110A

+Flag–HA–EXD2 WT

U2OS

d

P < 0.0001 P < 0.0001

40

20

0 EXD2 siRNA

–

+

U2OS

+ – Clone 1

+ – Clone 2


+ – Clone 1

– + Clone 2

Percentage resistance

Percentage of RAD51-focus-positive cells

c

60 P < 0.0001

+ – Clone 1

+

+ – Clone 2


+ – Clone 1

+ – Clone 2

+Flag–HA–EXD2 D108A–E110A

P = 0.0009 P = 0.0003 P = 0.004 NS NS P = 0.003 P = 0.005 P = 0.003 P = 0.003 P = 0.0007 120 P = 0.0008 100 80 60 40 20

0 EXD2 siRNA

–

+

+ Clone 1


U2OS

+ Clone 2


+ Clone 1

+ Clone 2


Figure 5 Nuclease activity of EXD2 is required for DSB repair in vivo. (a) U2OS control cells or cells stably expressing Flag–HA–EXD2 WT or D108A–E110A mutant fusion proteins 72 h post transfection with an siRNA targeting EXD2 30 UTR or without siRNA were treated with 1 µM CPT for 1 h. Quantification of the percentage of cells with more than 15 BrdU foci per nucleus is represented. n = 223 cells (U2OS – EXD2 siRNA), 235 cells (U2OS + EXD2 siRNA), 209 cells (WT clone 1 – EXD2 siRNA), 170 cells (WT clone 1 + EXD2 siRNA), 183 cells (WT clone 2 – EXD2 siRNA), 203 cells (WT clone 2 + EXD2 siRNA), 200 cells (D108A–E110A clone 1 – EXD2 siRNA), 190 cells (D108A–E110A clone 1 + EXD2 siRNA), 282 cells (D108A–E110A clone 2 – EXD2 siRNA) and 223 cells (D108A–E110A clone 2 + EXD2 siRNA), pooled from three independent experiments. (b) U2OS control cells or cells stably expressing Flag–HA–EXD2 WT or D108A–E110A mutant fusion proteins 72 h post transfection with an siRNA targeting EXD2’s 30 UTR or without siRNA were treated with 1 µM CPT for 1 h as indicated. Cells were fixed and stained for RPA by immunofluorescence with quantification of the percentage of cells with more than 15 RPA foci per nucleus represented. n = 308 cells (U2OS – EXD2 siRNA), 308 cells (U2OS + EXD2 siRNA), 327 cells (WT clone 1 – EXD2 siRNA), 320 cells (WT clone 1 + EXD2 siRNA), 308 cells (WT clone 2 – EXD2 siRNA), 353 cells (WT clone 2 + EXD2 siRNA), 321 cells (D108A–E110A clone 1 – EXD2 siRNA), 368 cells

(D108A–E110A clone 1 + EXD2 siRNA), 370 cells (D108A–E110A clone 2 – EXD2 siRNA) and 337 cells (D108A–E110A clone 2 + EXD2 siRNA), pooled from three independent experiments. At least 100 cells were scored for each experiment. (c) U2OS control cells or cells stably expressing Flag–HA–EXD2 WT or D108A–E110A mutant fusion proteins 72 h post transfection with an siRNA targeting EXD2 30 UTR or without siRNA were irradiated with 8 Gy. Cells were fixed and stained for RAD51 6 h post treatment and the percentage of RAD51-positive cells quantified. n = 213 cells (U2OS – EXD2 siRNA), 254 cells (U2OS + EXD2 siRNA), 169 cells (WT clone 1 – EXD2 siRNA), 176 cells (WT clone 1 + EXD2 siRNA), 191 cells (WT clone 2 – EXD2 siRNA), 184 cells (WT clone 2 + EXD2 siRNA), 195 cells (D108A–E110A clone 1 – EXD2 siRNA), 224 cells (D108A–E110A clone 1), 191 cells (D108A– E110A clone 2 – EXD2 siRNA) and 198 cells (D108A–E110A clone 2 + EXD2 siRNA), pooled from three independent experiments. (d) Survival assay in U2OS cells complemented with WT or D108A–E110A mutant EXD2 protein transfected with control siRNA (sample 1) or siRNA targeting 30 UTR of EXD2 (samples 2–6). Cells were treated with 5 µg ml−1 phleomycin, and the resistance of cells transfected with control siRNA was set at 100% (n = 4 independent experiments). For all panels, bars represent mean ± s.e.m. Statistical significance was determined using the Chi-square test (a–c) or Student’s t-test (d).

phenotypes associated with EXD2 deficiency as compared with cells expressing WT EXD2 (Fig. 5a–d). This result is consistent with our data showing a requirement for EXD2 in the processing of DSBs into ssDNA. Cells overexpressing WT EXD2 displayed elevated resection. In this regard we note that overexpression of WT MRE11 also increases resection efficiency, resulting in elevated levels of RPA focus formation and RPA phosphorylation38.

process with MRE11 we analysed the kinetics of RPA focus formation (a marker of resection) in cells depleted for either of these proteins or concomitantly depleted for both EXD2 and MRE11. We found that combined depletion resulted in a comparable inhibition of resection as observed for depletion of MRE11 alone (Fig. 6a). A similar relationship was also observed for RAD51 foci (Supplementary Fig. 4b,c). Interestingly, the defect observed in EXD2-depleted cells was slightly weaker than that observed in MRE11 alone, suggesting that MRE11 functions upstream of EXD2 in DNA resection, perhaps initiating resection through its endonuclease activity. Indeed, it has been suggested recently that MRE11 may create multiple nicks on the strand

EXD2 cooperates with MRE11 in the repair of DSBs The in vivo resection that initiates DSB repair is catalysed by the MRN complex6,7,14,39. To test whether or not EXD2 collaborates in this

6



A RT I C L E S b

a P < 0.0001 P < 0.0001

NS

+ – –

– + –

+ + –

– – +

+ – +


1

c Percentage DNA degradation efficiency

NS P < 0.0001

0 Time (min)

0 30 60 120

0 30 60 120

Control siRNA

d

– – –

Circular ssDNA

EXD2 WT

EXD2 siRNA

MRE11 siRNA

e

EXD2 D108A–E110A

Time (min) 0 15 30 60 30-mer

0 30 60 120

0 15 30 60

0 30 60 120

EXD2– MRE11 siRNA

EXD2 WT

EXD2 D108A–E110A

Time (min) 0 15 30 60 30-mer


0 15 30 60


5′ ∗ dsDNA nick

5′ 5′

∗

EXD2

f

3′

P < 0.0001

80 60 40 20 0

t t 2 2 RN XD XD mu mu E +E 2 2 D D RN EX +EX M N R M

M

5′ ∗ dsDNA 1 nt gap

3′ end resection Resected DNA Degradation products

Percentage DNA degradation efficiency

RPA signal intensity per nucleus (a.u.)

2

MRN EXD2 WT EXD2 D108A–E110A

100 80 60

EXD2 WT + dsDNA nick EXD2 WT + dsDNA 1 nt gap EXD2 D108A–E110A + dsDNA nick EXD2 D108A–E110A + dsDNA 1 nt gap

40 20 0

0

15 30 Time (min)

60

Figure 6 EXD2 promotes resection through a common mechanism with MRE11. (a) Quantification of the signal intensity of RPA foci in U2OS cells depleted for EXD2, MRE11 or both by siRNA (as indicated) at various time points following treatment with 8 Gy IR. ImageJ was used to quantify signal intensity per nucleus (using RPA as a marker of resection; DAPI staining marks the nucleus). n = 154, 155, 150 and 161 cells for control siRNA 0, 30, 60 and 120 min post treatment, respectively. n = 177, 187, 189 and 173 cells for EXD2 siRNA 0, 30, 60 and 120 min post treatment, respectively. n = 182, 167, 184 and 187 cells for MRE11 siRNA 0, 30, 60 and 120 min post treatment, respectively. n = 214, 182, 150 and 163 cells for EXD2–MRE11 siRNA 0, 30, 60 and 120 min post treatment, respectively. In all cases cells were pooled from three independent experiments. Error bars represent ±s.e.m. Statistical significance was determined using the Mann–Whitney test. (b) EXD2 stimulates MRN complex-dependent nuclease activity. MRN complex (50 nM) was incubated with 8X174 substrate DNA

in the presence or absence of EXD2 WT (Lys76–Val564) or corresponding mutant protein (350 nM). Reaction products were resolved on agarose gel, stained with SYBR Gold and visualized. (c) Quantification of the percentage of intact DNA from b, representing DNA degradation efficiency. The percentage of intact DNA was obtained relative to the no-protein control sample. Error bars represent ±s.e.m., n = 4 independent experiments; Student’s t-test was used to determine statistical significance. (d,e) 50 radiolabelled dsDNA substrate (10 nM molecules) containing a nick (d) or a 1 nucleotide (nt) gap (e) was incubated for the indicated lengths of time with EXD2 WT (Lys76–Val564) or EXD2 (Lys76–Val564) D108A– E110A protein (100 nM). Samples were resolved on a 20% TBE–urea polyacrylamide gel and visualized by phosphorimaging. These experiments were carried out three times independently. (f) Quantification of the efficiency of DNA degradation from d and e. Error bars represent ±s.e.m., n = 3 independent experiments.

being resected that could serve as additional exonuclease entry sites to further enhance nucleolytic processing21,22. We tested this notion in several ways. First, we analysed if MRN-dependent DNA resection is accelerated in the presence of EXD2. Purified EXD2 and the MRN complex (MRE11, RAD50, NBS1) were incubated together with circular single-stranded 8X174 DNA. This substrate requires initial endonuclease-dependent nicking by the MRN complex to undergo resection. As previously reported, the MRN complex exhibited nuclease activity under these conditions16 (Fig. 6b). Importantly, combining EXD2 with the MRN complex resulted in increased ssDNA degradation in vitro (Fig. 6b,c). As expected, addition of exonucleasedead EXD2 protein to the MRN complex resulted in DNA degradation similar to that observed for MRN alone (Fig. 6b,c). Second, we predicted that EXD2 should be able to initiate resection from a nicked and a gapped duplex substrate designed to mimic the substrates generated by MRE11 endonuclease activity during the initial stage of DNA end resection. Strikingly, EXD2 exhibited robust exonuclease activity on

both the nicked and gapped substrates (Fig. 6d–f and Supplementary Fig. 4d,e). Taken together, these data show that EXD2 functionally collaborates with the MRN complex in promoting DNA degradation. To gain more functional insight into the role of EXD2’s exonuclease activity in DNA end resection in vivo, we took advantage of the recently developed small molecule inhibitors targeting the exo- or endonuclease activity of MRE11 (ref. 23). Inhibition of MRE11 endonuclease activity resulted in almost total inhibition of resection, whereas cells treated with the MRE11 exonuclease inhibitor showed a milder resection defect (Fig. 7a), as reported previously23. Knockdown of EXD2 alone resulted in a resection defect significantly stronger (p < 0.0001) than that observed in cells treated with the MRE11 exonuclease inhibitor alone. Depletion of EXD2 in the presence of the MRE11 exonuclease inhibitor did not decrease efficiency of resection further than was achieved with EXD2 depletion alone (Fig. 7a). Interestingly, some residual resection was still observed in cells concomitantly depleted for EXD2 and incubated with the



7

A RT I C L E S a

2 RPA signal intensity per nucleus (a.u.)

b

P = 0.0117 P < 0.0001 P < 0.0001 P < 0.0001 P < 0.0001 P < 0.0001 P < 0.0001 P < 0.0001 NS

AsiSI BsrGI

BsrGI

1,618 nt DSB induction Resection

No resection DSB

335 nt 1,618 nt 335 nt 1,618 nt

1

q PCR primer AsiSI recognition site for DSB induction

0 EXO inhibitor ENDO inhibitor

– –

+ –

– +

– –

Control siRNA

+ –

– +

e

EXD2 siRNA

CtIP MRE11

DSB

d P = 0.0006

P < 0.0001

P < 0.0001

80 60 40 20 0

335 nt

1,618 nt

Control siRNA EXD2 siRNA MRE11 siRNA EXD2–MRE11 siRNA

100 80

NS

3′–5′ DNA resection MRE11 and EXD2

NS

3′ 60 40

RPA loading

20

RPA RPA RPA

3′ 0 iR EX NA D2 s iR M NA RE 11 siR EX NA D2 –M R siR E1 NA 1

100

3′ NS

HR

Co

nt

ro

ls

Percentage resection

P < 0.0001

Endo

P = 0.007 Percentage HR efficiency

c

?

Figure 7 EXD2 is required for efficient HR. (a) Quantification of the signal intensity of RPA foci in U2OS cells treated with dimethylsulphoxide or small molecule inhibitors specifically targeting MRE11’s exo- or endonuclease activity (EXO or ENDO inhibitors, as indicated) 72 h post transfection with siRNA targeting EXD2 (EXD2 siRNA) or control siRNA. Cells were pretreated for 30 min with 100 µM PFM39 (EXO inhibitor) or 100 µM PFM01 (ENDO inhibitor) before irradiation with 3 Gy IR. Cells were collected 2 h post irradiation and stained for RPA foci. The intensity of RPA signal per cell nucleus was analysed using ImageJ. n = 231 cells (control siRNA, EXO–ENDO–), 226 cells (control siRNA, EXO+), 177 cells (control siRNA, ENDO+), 233 cells (EXD2 siRNA EXO–ENDO–), 201 cells (EXD2 siRNA EXO+) and 158 cells (EXD2 siRNA, ENDO+), pooled from three independent experiments. Error bars represent ±s.e.m. The Mann–Whitney test was used to determine statistical significance. (b) Schematic diagram of the resection assay in human cells using the ER-AsiSI system. Arrows indicate qPCR primers for measurement of resection efficiency following induction of the DSB. (c) ER-AsiSI U2OS cells were treated with 300 nM 4-hydroxytamoxifen

(4-OHT) for 1 h; genomic DNA was extracted and digested or mock digested with BsrGI overnight. DNA end resection adjacent to the DSB was measured by qPCR. The percentage of ssDNA was calculated and related to the control siRNA treated sample, which was set as 100%. Bars represent mean values ± s.e.m. (n = 5 independent experiments). Student’s t-test was used to determine statistical significance. (d) Quantification of the relative efficiency of HR in U2OS cells carrying the DR-GFP reporter construct with concomitant depletion of EXD2 and MRE11 by siRNA following transient expression of the I-SceI enzyme (see Methods and text for details). The efficiency of HR was measured by FACS and all knockdowns were compared with control siRNA (normalized to 100%). Data represent the mean ± s.e.m. (n = 3 independent experiments). Student’s t-test was employed to determine statistical significance. (e) Schematic model of EXD2’s putative role in DNA end resection. DSB induction leads to recruitment of MRE11, whose endonuclease activity results in nicking of the DNA strand proximal to the DSB. EXD2 can then process this substrate, either alone or in conjunction with the MRN complex, thereby promoting DNA end resection.

MRE11 exonuclease inhibitor, indicating either an involvement of another exonuclease in this step of DNA end processing23 or that EXD2 knockdown or MRE11 exonuclease inhibition was not complete. Nevertheless, these data suggest that both the exonuclease activity of EXD2 and that of MRE11 function within the same pathway and are required for efficient DNA end resection. Knockdown of EXD2 in cells treated with an inhibitor targeting MRE11’s endonuclease activity showed a similar resection defect when compared with the inhibitor alone (Fig. 7a), supporting the notion that EXD2 functions downstream of MRE11’s endonuclease activity. Next, we asked which part of the resection process, that is, short-range versus long-range resection, is affected in cells depleted for EXD2. To test this, we depleted EXD2 in a cell line allowing

for the induction of a DSB in a specific genomic locus in vivo40. Then we analysed the efficiency of DNA resection at this DSB by quantitative PCR (qPCR) at two positions: one located close to the break (335 bp downstream of the break—short-range resection) and the other located at 1,618 bp from the break (long-range resection; ref. 40). Interestingly, we found that EXD2 depletion affected both short-range and long-range resection (Fig. 7b,c and Supplementary Fig. 4f). Knockdown of MRE11 resulted in a similar albeit stronger resection phenotype, thus providing further evidence to support its upstream function in this process. Importantly, concomitant depletion of both proteins did not further potentiate the resection defect. Given that both EXD2 and MRE11 regulate DSB resection, we tested the effect of their combined depletion on HR using the DR-GFP

8



A RT I C L E S assay. In support of their role in this process, we observed that combined depletion of EXD2 and MRE11 did not decrease HR efficiency further than observed in the single knockdowns (Fig. 6d and Supplementary Fig. 4g). These findings therefore show that EXD2 promotes DNA end resection and HR by enhancing the generation of ssDNA through a common mechanism with the MRN complex. Furthermore, it seems likely that MRE11 functions upstream of EXD2 in this process, probably initiating resection through its endonuclease activity. To verify and extend the above conclusions, we used CRISPR/Cas9 nickase based gene editing41 in HeLa cells to generate EXD2−/− clones (Supplementary Fig. 5a). The use of Cas9 nickase has been recently shown to minimize any off-target effects42. Comparable to siRNA-treated U2OS cells, EXD2−/− HeLa cells showed dramatically decreased RPA focus formation in response to CPT (Supplementary Fig. 5b,c), diminished RPA2 phosphorylation on Ser4, Ser8 (Supplementary Fig. 5d) and decreased survival in response to CPT (Supplementary Fig. 5e). We also tested if EXD2 depletion affects the MRE11 or CtIP protein stability and/or their recruitment to DSBs. We found this not to be the case, as cells lacking EXD2 had similar levels of endogenous MRE11 or CtIP to the WT control (Supplementary Fig. 5f). Likewise, MRE11 or GFP–CtIP localization to DSBs induced by microirradiation43 was not affected (Supplementary Fig. 6a–c). These findings therefore establish EXD2 as an important regulator of DSB resection.

is sufficient to support HR (ref. 46). Not mutually exclusive is the possibility that EXD2 could also augment resection efficiency under specific circumstances, for instance in the presence of modifications to the damaged DNA and/or polypeptides bound at the 50 ends. In line with this, we show that in vivo EXD2 depletion impairs shortrange resection. Recently, it has been proposed that MRE11 may create multiple incisions on the DNA strand undergoing resection up to 300 bp distal to the break, which could allow for more efficient resection21,22. Indeed, inhibition of MRE11’s endonuclease activity seems to be dominant in promoting the generation of ssDNA over its exonuclease activity23. Thus, we postulate a model whereby EXD2 functionally collaborates with the resection machinery, most likely utilizing DNA nicks generated by MRE11’s endonuclease activity 30 of the DSB. This would enhance the generation of ssDNA tails required for efficient homologous recombination (model Fig. 6d). In summary, our work identifies EXD2 as a critical factor in the maintenance of genome stability through HR-dependent repair of DSBs, including those induced by commonly used anticancer agents, such as IR or CPT. This highlights EXD2 itself and/or its enzymatic activity as a potential candidate for development of anticancer drugs. METHODS Methods and any associated references are available in the online version of the paper.

DISCUSSION We have shown that EXD2 facilitates DSB resection, thus promoting recruitment of RPA and HR. Accordingly, cells depleted for EXD2 show spontaneous chromosomal instability and are sensitive to DNA damage induced by agents that generate DSBs. Furthermore, we establish that EXD2 functionally interacts with the MRN complex, utilizing its 30 –50 exonuclease activity to accelerate DSB resection and promote efficient HR. In line with this, complementation experiments showed that exonuclease-dead mutant protein failed to complement these phenotypes. Interestingly, EXD2 seems to be dispensable for the initial sensing of the break, as evidenced by efficient γH2AX and CHK2 phosphorylation, and most likely acts downstream of MRE11. Finally we reveal that both EXD2 and MRE11 function in the same pathway for DSB resection and HR. It is unclear at present why cells would need two exonucleases with the same polarity. However, a paradigm for such a requirement is evident from the fact that cells have two alternative machineries, consisting of BLM–DNA2–RPA–MRN and EXO1–BLM–RPA–MRN, that carry out long-range resection9,10,13,44. Thus, by analogy EXD2 may function together with MRE11 to accelerate resection in the 30 –50 direction to efficiently produce short 30 ssDNA overhangs. This could promote faster generation of longer stretches of ssDNA, which in turn may serve as a better substrate for BLM–DNA2 or BLM–EXO1 to initiate long-range resection. Accordingly, depletion of EXD2 adversely impacts on this process. Ultimately, efficient generation of ssDNA with minimal homology length required for productive HR would suppress unscheduled deleterious recombination events. This may be particularly important in vertebrates, as they require significantly longer stretches of ssDNA (200–500 bp) to initiate productive HR (ref. 45), in contrast to yeast, where as little as 60 bp of 30 ssDNA

Note: Supplementary Information is available in the online version of the paper ACKNOWLEDGEMENTS We thank S. Jackson, M. de Bruijn, J. Riepsaame, V. Macaulay, G. Legube, G. Stewart, F. Esashi, C. Green and R. Chapman for cell lines, plasmids and antibodies; J. A. Tainer for the provision of MRE11 exo- and endonuclease inhibitors; the Mass Spectrometry Laboratory (IBB PAS, Warsaw, Poland) for their work on analyses of GFP–CtIP IP experiments; J. A. Newman for advice on protein purification and D. Waithe for help with image analysis. We also thank G. Ira for critical reading of the manuscript. R.B., J.N. and W.N. are funded by Worldwide Cancer Research and MRC Senior Non-Clinical Fellowships awarded to W.N., P.J.M. and O.G. are funded by an MRC Grant, H.T.B. is funded by a Cancer Research UK Studentship and R.A.D. and T.T.P. are funded by the Cancer Research and Prevention Institute of Texas (CPRIT) grant RP110465-P4. AUTHOR CONTRIBUTIONS R.B. and J.N. carried out the majority of experimental work with contributions from W.N.; H.T.B., P.J.M. and O.G. contributed to the purification and analysis of the biochemical activities of EXD2. R.A.D. and T.T.P. purified the MRN complex. W.N. conceived the project and wrote the manuscript with editing contributions from R.B., J.N., T.T.P. and P.J.M. COMPETING FINANCIAL INTERESTS The authors declare no competing financial interests. Published online at http://dx.doi.org/10.1038/ncb3303 Reprints and permissions information is available online at www.nature.com/reprints 1. Jackson, S. P. & Bartek, J. The DNA-damage response in human biology and disease. Nature 461, 1071–1078 (2009). 2. Malkova, A. & Haber, J. E. Mutations arising during repair of chromosome breaks. Annu. Rev. Genet. 46, 455–473 (2012). 3. Krogh, B. O. & Symington, L. S. Recombination proteins in yeast. Annu. Rev. Genet. 38, 233–271 (2004). 4. Symington, L. S. & Gautier, J. Double-strand break end resection and repair pathway choice. Annu. Rev. Genet. 45, 247–271 (2011). 5. Huertas, P., Cortes-Ledesma, F., Sartori, A. A., Aguilera, A. & Jackson, S. P. CDK targets Sae2 to control DNA-end resection and homologous recombination. Nature 455, 689–692 (2008).



9

A RT I C L E S 6. Mimitou, E. P. & Symington, L. S. DNA end resection–unraveling the tail. DNA Rep. 10, 344–348 (2011). 7. Stracker, T. H. & Petrini, J. H. The MRE11 complex: starting from the ends. Nat. Rev. Mol. Cell Biol. 12, 90–103 (2011). 8. Ciccia, A. & Elledge, S. J. The DNA damage response: making it safe to play with knives. Mol. Cell 40, 179–204 (2010). 9. Mimitou, E. P. & Symington, L. S. Sae2, Exo1 and Sgs1 collaborate in DNA doublestrand break processing. Nature 455, 770–774 (2008). 10. Zhu, Z., Chung, W. H., Shim, E. Y., Lee, S. E. & Ira, G. Sgs1 helicase and two nucleases Dna2 and Exo1 resect DNA double-strand break ends. Cell 134, 981–994 (2008). 11. Cejka, P. et al. DNA end resection by Dna2-Sgs1-RPA and its stimulation by Top3Rmi1 and Mre11-Rad50-Xrs2. Nature 467, 112–116 (2010). 12. Niu, H. et al. Mechanism of the ATP-dependent DNA end-resection machinery from Saccharomyces cerevisiae. Nature 467, 108–111 (2010). 13. Nimonkar, A. V. et al. BLM–DNA2–RPA–MRN and EXO1–BLM–RPA–MRN constitute two DNA end resection machineries for human DNA break repair. Genes Dev. 25, 350–362 (2011). 14. Paull, T. T. Making the best of the loose ends: Mre11/Rad50 complexes and Sae2 promote DNA double-strand break resection. DNA Rep. 9, 1283–1291 (2010). 15. Blackwood, J. K. et al. End-resection at DNA double-strand breaks in the three domains of life. Biochem. Soc. Trans. 41, 314–320 (2013). 16. Sartori, A. A. et al. Human CtIP promotes DNA end resection. Nature 450, 509–514 (2007). 17. Nicolette, M. L. et al. Mre11-Rad50-Xrs2 and Sae2 promote 50 strand resection of DNA double-strand breaks. Nat. Struct. Mol. Biol. 17, 1478–1485 (2010). 18. Cannavo, E. & Cejka, P. Sae2 promotes dsDNA endonuclease activity within Mre11Rad50-Xrs2 to resect DNA breaks. Nature 514, 122–125 (2014). 19. Esashi, F., Galkin, V. E., Yu, X., Egelman, E. H. & West, S. C. Stabilization of RAD51 nucleoprotein filaments by the C-terminal region of BRCA2. Nat. Struct. Mol. Biol. 14, 468–474 (2007). 20. Paull, T. T. & Gellert, M. The 30 to 50 exonuclease activity of Mre 11 facilitates repair of DNA double-strand breaks. Mol. Cell 1, 969–979 (1998). 21. Garcia, V., Phelps, S. E., Gray, S. & Neale, M. J. Bidirectional resection of DNA double-strand breaks by Mre11 and Exo1. Nature 479, 241–244 (2011). 22. Jazayeri, A., Balestrini, A., Garner, E., Haber, J. E. & Costanzo, V. Mre11-Rad50Nbs1-dependent processing of DNA breaks generates oligonucleotides that stimulate ATM activity. EMBO J. 27, 1953–1962 (2008). 23. Shibata, A. et al. DNA double-strand break repair pathway choice is directed by distinct MRE11 nuclease activities. Mol. Cell 53, 7–18 (2014). 24. Smogorzewska, A. et al. A genetic screen identifies FAN1, a Fanconi anemiaassociated nuclease necessary for DNA interstrand crosslink repair. Mol. Cell 39, 36–47 (2010). 25. Limbo, O. et al. Ctp1 is a cell-cycle-regulated protein that functions with Mre11 complex to control double-strand break repair by homologous recombination. Mol. Cell 28, 134–146 (2007). 26. Yun, M. H. & Hiom, K. CtIP-BRCA1 modulates the choice of DNA double-strandbreak repair pathway throughout the cell cycle. Nature 459, 460–463 (2009).

10

27. Kousholt, A. N. et al. CtIP-dependent DNA resection is required for DNA damage checkpoint maintenance but not initiation. J. Cell Biol. 197, 869–876 (2012). 28. Eggler, A. L., Inman, R. B. & Cox, M. M. The Rad51-dependent pairing of long DNA substrates is stabilized by replication protein A. J. Biol. Chem. 277, 39280–39288 (2002). 29. Sung, P., Krejci, L., Van Komen, S. & Sehorn, M. G. Rad51 recombinase and recombination mediators. J. Biol. Chem. 278, 42729–42732 (2003). 30. Sung, P. & Robberson, D. L. DNA strand exchange mediated by a RAD51ssDNA nucleoprotein filament with polarity opposite to that of RecA. Cell 82, 453–461 (1995). 31. Baumann, P., Benson, F. E. & West, S. C. Human Rad51 protein promotes ATPdependent homologous pairing and strand transfer reactions in vitro. Cell 87, 757–766 (1996). 32. Filippone, S. et al. On the mechanism of the thermal retrocycloaddition of pyrrolidinofullerenes (retro-Prato reaction). Chemistry 14, 5198–5206 (2008). 33. Pierce, A. J., Hu, P., Han, M., Ellis, N. & Jasin, M. Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes Dev. 15, 3237–3242 (2001). 34. McCabe, N. et al. Deficiency in the repair of DNA damage by homologous recombination and sensitivity to poly(ADP-ribose) polymerase inhibition. Cancer Res. 66, 8109–8115 (2006). 35. Buis, J. et al. Mre11 nuclease activity has essential roles in DNA repair and genomic stability distinct from ATM activation. Cell 135, 85–96 (2008). 36. Choi, J. M. et al. Probing the roles of active site residues in the 30 –50 exonuclease of the Werner syndrome protein. J. Biol. Chem. 282, 9941–9951 (2007). 37. Li, B., Reddy, S. & Comai, L. Sequence-specific processing of telomeric 30 overhangs by the Werner syndrome protein exonuclease activity. Aging 1, 289–302 (2009). 38. Rass, E. et al. Role of Mre11 in chromosomal nonhomologous end joining in mammalian cells. Nat. Struct. Mol. Biol. 16, 819–824 (2009). 39. Huertas, P. DNA resection in eukaryotes: deciding how to fix the break. Nat. Struct. Mol. Biol. 17, 11–16 (2010). 40. Zhou, Y., Caron, P., Legube, G. & Paull, T. T. Quantitation of DNA doublestrand break resection intermediates in human cells. Nucleic Acids Res. 42, e19 (2014). 41. Hsu, P. D., Lander, E. S. & Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262–1278 (2014). 42. Shen, B. et al. Efficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects. Nat. Methods 11, 399–402 (2014). 43. Suzuki, K., Yamauchi, M., Oka, Y., Suzuki, M. & Yamashita, S. Creating localized DNA double-strand breaks with microirradiation. Nat. Protoc. 6, 134–139 (2011). 44. Gravel, S., Chapman, J. R., Magill, C. & Jackson, S. P. DNA helicases Sgs1 and BLM promote DNA double-strand break resection. Genes Dev. 22, 2767–2772 (2008). 45. Rubnitz, J. & Subramani, S. The minimum amount of homology required for homologous recombination in mammalian cells. Mol. Cell. Biol. 4, 2253–2258 (1984). 46. Sugawara, N. & Haber, J. E. Characterization of double-strand break-induced recombination: homology requirements and single-stranded DNA formation. Mol. Cell. Biol. 12, 563–575 (1992).



METHODS

DOI: 10.1038/ncb3303 METHODS Cell lines. HEK293FT cells were a gift from G. Stewart (Institute of Cardiovascular Sciences, University of Birmingham, UK) and HeLa and U2OS cells were a gift from F. Esashi (Sir William Dunn School of Pathology, University of Oxford, UK). These cell lines were initially obtained as authenticated stocks from Life Technologies and ATCC, respectively, and were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and standard antibiotics. U2OS cells stably expressing GFP–CtIP and U2OS cells harbouring the HR reporter DR-GFP were a gift from S. P. Jackson (Wellcome Trust/Cancer Research UK Gurdon Institute, University of Cambridge, UK) and were maintained in media supplemented with 500 µg ml−1 G-418. The ER-AsiSI U2OS cell line47, a gift from G. Legube (Center for Integrative Biology, Université Paul Sabatier, France), was maintained in DMEM media without phenol red supplemented with 10% dialysed FBS (Life Technologies) and 1 µg ml−1 puromycin. Cell lines stably expressing Flag–HA–EXD2 WT or D108A–E110A fusion proteins were generated by transfection of U2OS cells with these plasmid constructs, followed by clonal selection of cells grown in media containing 0.5 µg ml−1 puromycin (Life Technologies). All cell lines have been verified mycoplasma free by a PCR-based test (Takara). Plasmids. The open reading frame (ORF) of human EXD2 was purchased as a gateway entry clone in the pDONR221 plasmid backbone from DNASU Plasmid Repository (HsCD00295838). Discrepancies in the amino-acid sequence in comparison to the reference sequence for human EXD2 (NM_001193360.1) were corrected by site-directed mutagenesis. Site-directed mutagenesis was then employed to generate EXD2 D108A–E110A in pDONR221. Flag–HA–EXD2 WT and D108A–E110A as well as GST–EXD2 WT and D108A–E110A plasmid constructs were generated by recombination of the WT or D108A–E110A EXD2 ORF in pDONR221 by LR Clonase reaction into either the pHAGE-N-Flag–HA destination vector (a gift from R. Chapman, The Wellcome Trust Centre for Human Genetics, University of Oxford, UK), or the pDESTpGEX6P-1 destination vector (a gift from C. Green, The Wellcome Trust Centre for Human Genetics, University of Oxford, UK), respectively. LR Clonase reactions were carried out using the Gateway LR Clonase II enzyme mix according to the instructions of the manufacturer (Life Technologies). The pCMV-I-Sce1 plasmid was a gift from V. Macaulay (Department of Oncology, University of Oxford, UK). pmCherry-C1 was obtained from Clontech. pX335-GFP plasmid (pX335 vector48 containing PGK-EGFP-P2A-Neo-pA) was a gift from J. Riepsaame and M. de Bruijn (MRC Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, University of Oxford, UK). His–EXD2 (Lys76–Ser589) construct was generated by cloning of truncated human EXD2 (Lys76–Ser589) in the expression vector pNIC28-Bsa4 (ref. 49), containing an amino-terminal His tag followed by a tobacco etch virus protease cleavage site. The construct was subsequently subjected to site-directed mutagenesis to introduce the D108A–E110A mutations. Plasmids were transfected into human cells using Lipofectamine 2000 (Life Technologies), according to the manufacturer’s instructions.

before mounting with VECTASHIELD mounting medium (Vector Laboratories) with DAPI. To visualize ssDNA foci, the same protocol as for RPA focus staining was used, preceded by treatment of cells growing on coverslips with 10 µM BrdU for 24 h before fixation. To visualize RAD51 foci, cells grown on coverslips were fixed with 4% paraformaldehyde in PBS for 10 min at room temperature followed by permeabilization with 0.5% Triton-X100 in PBS for 10 min at room temperature. Cells were then blocked, incubated with primary and secondary antibodies and mounted for analysis as described above. Confocal microscopy was carried out using a Zeiss LSM 510 laser scanning confocal microscope with Zen 2009 software using a ×63 objective. Image analysis was carried out with FIJI (ImageJ) software. Microirradiation experiments. Induction of localized DSBs in human cells was carried out as described previously43. Briefly, cells were grown on coverslips and pre-treated for 24 h with 10 µM BrdU before microirradiation. To induce localized DSBs, the medium was removed and cells were washed once in PBS, with subsequent removal of excess PBS. Isopore membrane filters (Millipore TMTP02500, 0.5 µM pore size) were placed on top of the coverslips and cells were exposed to 30 J m−2 ultraviolet C light using a Stratagene UV Stratalinker 2400. Membrane filters were removed and media placed back on the cells, which were allowed to recover for the indicated times before fixation. Cells were fixed, permeabilized and blocked as per RAD51 focus staining (described above). Cells expressing GFP–CtIP were stained for GFP (using the GFP-Booster reagent, ChromoTek, 1:200) and γ H2AX using the indicated secondary antibody. Images of microirradiated cells were acquired using a DeltaVision DV Elite microscope using a ×40 objective. Image analysis was carried out with FIJI (ImageJ) and Huygens Professional (Scientific Volume Imaging) software. U2OS cells were stained for MRE11 and γ H2AX and visualized on a Zeiss LSM 510 confocal microscope using a ×40 objective. Image analysis was carried out using FIJI (ImageJ).

Immunoblotting. Cell extracts were prepared by lysing cells in urea buffer (9 M urea, 50 mM Tris-HCl, pH 7.3, 150 mM β-mercaptoethanol) followed by sonication using a Soniprep 150 (MSE) probe sonicator. Proteins were resolved by SDS–PAGE and transferred to polyvinylidene difluoride. Immunoblots were carried out using the indicated antibodies (see Supplementary Table 1).

Immunoprecipitation experiments. Lysates for co-immunoprecipitation experiments were prepared as follows: cells were washed twice in PBS and then lysed in IP buffer (100 mM NaCl, 0.2% IGEPAL CA-630, 1 mM MgCl2 , 10% glycerol, 5 mM NaF, 50 mM Tris-HCl, pH 7.5), supplemented with complete EDTA-free protease inhibitor cocktail (Roche) and 25 U ml−1 Benzonase (Novagen). After Benzonase digestion, the NaCl and EDTA concentrations were adjusted to 200 mM and 2 mM, respectively, and lysates cleared by centrifugation (16,000g for 25 min). Lysates were then incubated with 20 µl of GFP-Trap agarose beads (ChromoTek) blocked with 5% BSA in IP lysis buffer for 1 h at 4 ◦ C in the case of GFP-Trap IPs or with 20 µl of anti-Flag M2 affinity gel in the case of Flag IPs for 2 h with end-to-end mixing at 4 ◦ C. Complexes were washed extensively in IP buffer (including 200 mM NaCl and 2 mM EDTA) before elution. In the case of GFP-Trap IPs, beads were resuspended in ×2 SDS sample buffer and boiled for 3 min before centrifugation at 5,000g for 5 min. The resultant supernatant fraction was retained as the eluate. In the case of Flag IPs, beads were incubated for 30 min with gentle agitation at 4 ◦ C in IP buffer supplemented with 400 µM ×3 Flag peptide (Sigma), followed by centrifugation at 5,000g for 5 min. The resultant supernatant fraction was collected as eluate. For mass spectrometry analyses, eluates from IP experiments were analysed by the Mass Spectrometry Laboratory (IBB PAS) using the Thermo Orbitrap Velos system and protein hits were identified by MASCOT.

Cell survival assay. Alamar Blue survival assays were Carried out in accordance with the recommendations of the manufacturer (Life Technologies). Briefly, 300 cells per well in 96-well plates were left untreated or treated with indicated doses of CPT, ionizing radiation, phleomycin or olaparib and incubated for 7 days. Alamar Blue reagent (Life Technologies) was added to each well and fluorometric measurements made after 2 h incubation at 37 ◦ C.

Chromosomal aberrations. Cells were prepared for analyses of chromosomal aberrations as described previously51. Briefly, colcemid (0.1 µg ml−1 ) was added 4 h before cell harvesting. Cells were trypsinized and incubated in 0.075 M KCl for 20 min. After fixing in methanol:acetic acid (3:1) for 30 min, cells were dropped onto slides and stained with Leishman’s solution for 2 min. Slides were then coded and scored blind to the observer.

RNAi treatment. siRNAs used in this study are listed in Supplementary Table 2. ONTARGETplus non-targeting pool or siRNA targeting luciferase50 were used as control siRNAs where appropriate.

Homologous recombination DR-GFP assay. 48 h after siRNA transfection, U2OS DR-GFP cells16 were co-transfected using Amaxa nucleofection with an I-SceI expression vector (pCMV-I-SceI) and a vector expressing mCherry fluorescent protein (pmCherry-C1). 24 h after I-SceI transfection cells were collected and analysed by flow cytometry (CyAn ADP Analyzer, Beckman Coulter). The percentage of GFP-positive cells among transfected cells (mCherry-positive cells) was determined using Summit 4.3 software. The control siRNA treated sample was set as 100%. Statistical significance was determined with Student’s t-test.

Immunofluorescence microscopy. Antibodies employed for immunofluorescence are listed in Supplementary Table 1. For visualization of RPA foci, cells were pre-extracted on ice for 2 min (10 mM PIPES, pH 6.8, 300 mM sucrose, 100 mM NaCl, 1.5 mM MgCl2 and 0.5% Triton-X100) and fixed with 4% paraformaldehyde in PBS for 10 min at room temperature. Coverslips were washed 3× in PBS and blocked in 10% FBS in PBS for 30 min before incubation with primary antibody in 0.1% FBS in PBS for 1 h at room temperature. Unbound primary antibody was removed by washing for 4 × 5 min in PBS at room temperature followed by incubation with the indicated secondary antibody for 45 min at room temperature. Slides were then washed for 4 × 5 min in PBS

Recombinant protein purification. GST-tagged proteins were purified as described51 with some modifications. Briefly, GST protein expression was induced with 0.1 mM IPTG (isopropyl-β-D-thiogalactoside) (Sigma-Aldrich) at 16 ◦ C for 18 h. Bacteria were collected by centrifugation and resuspended in lysis buffer containing 50 mM Tris-HCl at pH 8.0, 150 mM NaCl, 2 mM EDTA,

NATURE CELL BIOLOGY


METHODS

DOI: 10.1038/ncb3303

1 mM dithiothreitol (DTT), 1% Triton-X100, and protease inhibitors. Lysates were sonicated and cleared by centrifugation. Supernatants were incubated with Glutathione HiCap Matrix (Qiagen) for 2 h with rotation at 4 ◦ C. Beads were washed with lysis buffer containing increasing NaCl concentration, elution buffer (50 mM Tris-HCl at pH 7.0, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.2% Triton-X100), resuspended in elution buffer supplemented with PreScission Protease (50 units ml−1 ) (GE Healthcare) and incubated for 18 h with rotation at 4 ◦ C. Eluates were dialysed to buffer containing 20 mM HEPES-KOH at pH 7.2, 100 mM NaCl, 1 mM DTT and 10% glycerol, aliquoted and stored at −80 ◦ C. His–EXD2 (Lys76–Ser589) protein and the corresponding D108A–E110A mutant protein were expressed in Escherichia coli BL21(DE3)-R3-pRARE2 cells49 grown in TB medium and induced with 0.5 mM IPTG at 18 ◦ C overnight. Cells were collected by centrifugation and resuspended in a lysis buffer containing 50 mM HEPES, pH 7.5, 500 mM NaCl, 10 mM imidazole, 5% glycerol, 1 mM tris(2-carboxyethyl)phosphine (TCEP), 0.5% Triton, supplemented with a protease inhibitor mixture (Roche Applied Science). The cells were sonicated, polyethyleneimine was added to 0.15% (w/v) from a 5% pH 7.5 stock solution, and lysates were cleared by centrifugation. The supernatant was applied to a Ni-Sepharose resin, washed with 50 mM HEPES, pH 7.5, 300 mM NaCl, 45 mM imidazole, 5% glycerol, 1 mM TCEP, 0.5% Triton, 1 mM phenylmethyl sulphonyl fluoride (PMSF) and 2 mM benzamidine, and eluted in 50 mM HEPES, pH 7.5, 300 mM NaCl, 300 mM imidazole, 5% glycerol, 1 mM TCEP, 1 mM PMSF and 2 mM benzamidine. The eluate was further purified on two sequential Superdex S200 gel-filtration columns in GF buffer (50 mM HEPES, pH 7.5, 500 mM NaCl, 5% glycerol, 1 mM TCEP, 0.1% Triton, 1 mM PMSF and 2 mM benzamidine). At each stage the presence of protein was confirmed on an InstantBlue-stained SDS–PAGE gel, and the identity of the final preparation was confirmed using electrospray ionization–time of flight mass spectrometry. Mass spectrometry indicated that both the WT and D108A–E110A mutant proteins had a lower mass than predicted. Analysis using PAWS software (Genomic Solutions) suggests that the proteins were lacking amino acids 565–589 at the carboxy-terminus, probably due to proteolysis resulting in an EXD2 protein (WT or mutant) that consisted of amino acids Lys76–Val564. Recombinant human MRN was purified as previously described52. In vitro nuclease assay. Sequences of DNA oligonucleotides used are listed in Supplementary Table 3. To generate 30 end labelled substrates, the indicated ssDNA oligonucleotide was labelled using [α-32 P] dATP and TdT enzyme (New England Biolabs). To generate 50 end labelled substrates, the indicated ssDNA oligonucleotide was labelled using [γ -32 P] dATP and T4 polynucleotide kinase (New England Biolabs). To obtain dsDNA substrates, complementary ssDNA oligonucleotides (as indicated in Supplementary Table 3) were mixed in an equimolar ratio and annealed by heating at 100 ◦ C for 5 min followed by gradual cooling to room temperature. Where indicated DNA substrates with biotin label at the 30 end were used and pre-incubated for 5 min at room temperature with a tenfold molar excess of streptavidin (Sigma). Exonuclease assays were performed as described53 with some modifications. Briefly, reactions were carried out in a buffer containing 20 mM HEPES-KOH, pH 7.5, 50 mM KCl, 0.5 mM DTT, 10 mM MnCl2 , 0.05% Triton-X, 0.1 mg ml−1 BSA, 5% glycerol and 50 ng of EXD2 protein, initiated by adding the indicated amount of substrate and incubated at 37 ◦ C for the indicated lengths of time. Reactions were stopped by addition of EDTA to a final concentration of 20 mM and 1/5 volume of formamide. The samples were resolved on denaturing 20% polyacrylamide TBE–urea gels. Gels were fixed, dried and visualized using a Typhoon FLA 9500 instrument (GE Healthcare). Thin layer chromatography was performed as described54. Briefly, exonuclease reactions were terminated by addition of stop solution (2% SDS, 120 mM EDTA) and 1 µl of reaction mixtures was spotted on polyethylenimine cellulose thin layer plates (Merck). Plates were developed in 1.0 M sodium formate at pH 3.4 and subsequently visualized using a Typhoon FLA 9500 instrument (GE Healthcare). The 8X174 circular single-stranded substrate (30 µM nucleotides) from New England Biolabs was incubated with MRN complex (50 nM) in the presence or absence of His–EXD2 (Lys76–Ser589) (350 nM) or corresponding mutant protein in buffer containing 20 mM HEPES-KOH, pH 7.5, 50 mM KCl, 0.5 mM DTT, 5 mM MnCl2 , 0.05% Triton-X, 0.1 mg ml−1 BSA, 5% glycerol and 1 mM ATP. After 2 h the reaction was stopped by adding 1/5 volume of stop solution (2% SDS, 50 mM EDTA). Reactions were resolved on agarose gels, stained with SYBR Gold and visualized using a Typhoon FLA 9500 instrument (GE Healthcare).

ER-AsiSI resection assay. The level of resection adjacent to a specific DSB (Chr 1: 89231183) was measured as described40 with some modifications. Briefly ER-AsiSI U2OS cells were treated with 300 nM of 4-OHT (Sigma) for 1 h to allow the AsiSI enzyme to enter the nucleus and induce DSBs. Cells were then collected and genomic DNA was extracted as previously described40. Genomic DNA was then digested with the BsrGI enzyme or mock digested and was used as a template for qPCR performed using iTaq Universal SYBR Green Mix (Bio-Rad) and a Rotor-Gene (Corbett Research) qPCR system. Primers used are listed in Supplementary Table 4 (ref. 40). The percentage of ssDNA was calculated as previously described40. All data were then related to the control siRNA treated sample, which was set to 100%. Statistical significance was determined with Student’s t-test. Generation of EXD2−/− cells by CRISPR/Cas9. The following guide RNA sequences targeting the first exon of EXD2 were selected using the Optimized CRISPR Design tool (http://crispr.mit.edu; ref. 55): gRNA1 AAGGCATCCAGCGCCGCCGA, gRNA2 CCCTACAGCCACACCCAGAA. DNA oligonucleotides were purchased from IDT and cloned into pX335-GFP vector48 to generate targeting constructs that were subsequently co-transfected in an equimolar ratio into HeLa cells using Lipofectamine. 24 h after transfection, cells were sorted using a MoFlo cell sorter (Beckman Coulter) for cells expressing Cas9 nickase (GFP-positive cells) and left to recover for 6 days before sorting for single cells and allowing colonies to form. EXD2 expression was analysed by western blotting. Two clones showing loss of all detectable EXD2 were selected for subsequent analysis. Chromatin fractionation. HeLa cells were treated with 500 µM phleomycin for 1 h, washed with ice cold PBS and scraped into PBS, and the chromatin fractionation was performed as described56,57. Briefly, cells were resuspended in buffer A (10 mM HEPES-KOH at pH 7.9, 10 mM KCl, 1.5 MgCl2 , 340 mM sucrose, 10% glycerol, 1 mM DTT, protease inhibitors) and Triton-X100 was added to final concentration 0.1%. After 5 min incubation on ice, nuclei were spun down at 1,300g for 4 min. Pelleted nuclei were washed with buffer A, resuspended in buffer B (3 mM EDTA, 0.2 mM EGTA, 1 mM DTT, protease inhibitors) and lysed for 20 min on ice before centrifugation at 1,700g for 5 min. The supernatant (nuclear soluble fraction) was saved, and the pellet (chromatin fraction) was washed with buffer B, resuspended in urea buffer (9 M urea, 50 mM Tris-HCl, pH 7.3) and sonicated. Statistics and reproducibility. Microsoft Excel or Prism 6 software was used to perform statistical analyses. Detailed information (statistical tests used, number of independent experiments, P-values) are listed in individual figure legends. All experiments were repeated at least twice unless stated otherwise. 47. Iacovoni, J. S. et al. High-resolution profiling of γH2AX around DNA double strand breaks in the mammalian genome. EMBO J. 29, 1446–1457 (2010). 48. Cong, L. et al. Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823 (2013). 49. Savitsky, P. et al. High-throughput production of human proteins for crystallization: the SGC experience. J. Struct. Biol. 172, 3–13 (2010). 50. Tuschl, T. Cotransfection of luciferase reporter plasmids with siRNA duplexes. CSH Protoc. http://dx.doi.org/10.1101/pdb.prot4342 (2006). 51. Blackford, A. N. et al. TopBP1 interacts with BLM to maintain Genome stability but is dispensable for preventing BLM degradation. Mol. Cell 57, 1133–1141 (2015). 52. Bhaskara, V. et al. Rad50 adenylate kinase activity regulates DNA tethering by Mre11/Rad50 complexes. Mol. Cell 25, 647–661 (2007). 53. Sengerova, B. et al. Characterization of the human SNM1A and SNM1B/Apollo DNA repair exonucleases. J. Biol. Chem. 287, 26254–26267 (2012). 54. Zhu, L. & Halligan, B. D. V(D)J recombinational signal sequence DNA binding activities expressed by fetal bovine thymus. Veter. Immunol. Immunopathol. 71, 277–289 (1999). 55. Hsu, P. D. et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 31, 827–832 (2013). 56. Mendez, J. & Stillman, B. Chromatin association of human origin recognition complex, cdc6, and minichromosome maintenance proteins during the cell cycle: assembly of prereplication complexes in late mitosis. Mol. Cell. Biol. 20, 8602–8612 (2000). 57. Wang, Q. et al. Rad17 recruits the MRE11-RAD50-NBS1 complex to regulate the cellular response to DNA double-strand breaks. EMBO J. 33, 862–877 (2014).

NATURE CELL BIOLOGY


S U P P L E M E N TA R Y I N F O R M AT I O N DOI: 10.1038/ncb3303

1

1

1

1

1

1 1

1 1

1

1 1

1

1

1 1

1

1

1 1

1 1 1

1

1

1

1

1 1

1

1

1 1

0

1

1

1

1

1 1 1

1

1

1

1

1

1

1 1 1 1

1

1

1

1

N

0

Caenorhabditis elegans

1

Drosophila melanogaster

1

Dasypus novemcinctus

1

Choloepus hoffmanni

1

Pan troglodytes

1

Gorilla gorilla gorilla

1

Homo sapiens

1

Pongo abelii

1

Nomascus leucogenys

1

Chlorocebus sabaeus

1

Macaca mulatta

1

Papio anubis

1

Callithrix jacchus

2

Tarsius syrichta

1

Microcebus murinus

1

Otolemur garnettii

1

Rattus norvegicus

1

Mus musculus

2

Dipodomys ordii

1

Ictidomys tridecemlineatus

1

Cavia porcellus

1

Oryctolagus cuniculus

1

Ochotona princeps

1

Tupaia belangeri

1

Pteropus vampyrus

2

Myotis lucifugus

1

Sorex araneus

1

Erinaceus europaeus

1

Ailuropoda melanoleuca

1

Mustela putorius furo

1

Canis lupus familiaris

1

Felis catus

1

Bos taurus

1

Ovis aries

1

Sus scrofa

1

Tursiops truncatus

1

Vicugna pacos

1

Equus caballus

1

Procavia capensis

1

Loxodonta africana

1

Echinops telfairi

1

Macropus eugenii

1

Sarcophilus harrisii

1

Monodelphis domestica

2

Ornithorhynchus anatinus

1

Ficedula albicollis

1

Taeniopygia guttata

1

Gallus gallus

1

Meleagris gallopavo

1

Anas platyrhynchos

1

Pelodiscus sinensis

1

Anolis carolinensis

1

Xenopus tropicalis

1

Latimeria chalumnae

1

Poecilia formosa

1

Xiphophorus maculatus

1

Oryzias latipes

1

Oreochromis niloticus

1

Tetraodon nigroviridis

1

Takifugu rubripes

1

Gasterosteus aculeatus

1

Gadus morhua

1

Danio rerio

1

Astyanax mexicanus

1

Lepisosteus oculatus

1

Petromyzon marinus

0

Ciona savignyi

1

Ciona intestinalis

0

Saccharomyces cerevisiae

N number of members

Supplementary Figure 1 Cartoon illustrating the phylogenetic tree for the EXD2 gene.

WWW.NATURE.COM/NATURECELLBIOLOGY

1 © 2016 Macmillan Publishers Limited. All rights reserved

S U P P L E M E N TA R Y I N F O R M AT I O N a

70

EXD2

53

siEXD2 - 2

kDa

siControl

siEXD2 - 1

kDa 70

siControl

b

EXD2

53

α-Tubulin

c

α-Tubulin

d

DAPI RPA

DAPI RPA

Untreated

Cells with >15 RPA foci/nucleus (%)

siControl

siEXD2

8 Gy IR

DAPI RPA

DAPI RPA

Untreated

p < 0.0001

60

40

siControl siEXD2

20

0

8 Gy IR

Untreated

8 Gy IR

f

e siControl kDa 70

0

30 60

siEXD2 0

30 60 IR (min)

EXD2

G1

53

Chk2-pT68

30

RPA2 pS4/S8

30

RPA2

18

18

S

G2/M

siControl 37.3 ± 0.7

43.5 ± 0.9

21.6 ± 0.5

siEXD2

45.2 ± 0.9

21.5 ± 0.5

35.7 ± 0.8

γH2AX H3

Supplementary Figure 2 Additional characterisation of resection defect in EXD2-depleted cells. a and b) Western blotting confirming depletion Niedzwiedz_Supplementary figure of endogenous EXD2 72h post-transfection with either control siRNA 2 (siControl) or siRNAs targeting EXD2 (siEXD2-1 and 2). a-Tubulin acts as a loading control. These experiments were carried out three times independently. RPA foci in U2OS cells 72h post-transfection with control siRNA (siControl) or an siRNA oligo targeting EXD2 (siEXD2). Cells were either untreated or were exposed to 8 Gy IR and left to recover for 1h prior to fixation and then stained for RPA and DAPI as indicated. Scale bar = 20mm.Quantification of the percentage of cells treated as in (c), exhibiting greater than 15 RPA foci per nucleus. n=300 cells (siControl untreated), 390 cells (siEXD2 untreated), 355 cells (siControl 8Gy IR) and 403 cells (siEXD2 8gy IR) respectively, pooled from three independent experiments.

. Bars represent mean values +/- SEM. The Chi-square test was used to determine statistical significance. Western blotting of various DDR proteins in U2OS cells 72h post-transfection with control siRNA (siControl) or an siRNA oligo targeting EXD2 (siEXD2) with cells treated with 8 Gy IR. Samples were acquired at the indicated time points post-IR treatment. Chk2-p T68 acts as a control for ATM activation, RPA2 pS4/S8 acts to indicate resection efficiency, gH2AX serves to indicate DSB induction with RPA and histone H3 serving as loading controls. This experiment was carried out two times independently. Quantification of the percentage of G1, S or G2/M U2OS cells as analysed by propidium iodide staining and FACS analysis. Cells were analysed 72h post-transfection with control siRNA (siControl) or siRNA targeting EXD2 (siEXD2) (mean values +/- SEM, n= 5 independent experiments).

2

WWW.NATURE.COM/NATURECELLBIOLOGY © 2016 Macmillan Publishers Limited. All rights reserved

S U P P L E M E N TA R Y I N F O R M AT I O N

a

D108 E110

kDa 140 115 80 70

EXD2 WT

c

EXD2 D108A/E110A

kDa 235 170 130

EXD2 WT

b

M

EXD2 D108A/E110A

Human EXD2 Mouse EXD2 Chicken EXD2 Xenopus EXD2 Human WRN

d EXD2 WT

e EXD2 D108A/E110A

50

93 70

40 30

53

25

f

EXD2 WT

0

15 30

EXD2 WT 0

15

30

EXD2 mut 0

15 30

degradation products

Time (min) 0 15 30 50-mer

EXD2 mut

*

* ssDNA3’

3’

dsDNA

Supplementary Figure 3 Additional characterisation of purified EXD2. Alignment of the partial amino acid sequences of EXD2 proteins from various vertebrate organisms (human, mouse, chicken and xenopus are depicted) with a partial amino acid sequence of the exonuclease domain of human Werner helicase protein (WRN). Highly conserved residues shown to mediate the exonuclease activity of WRN protein which are also conserved in human EXD2 and its vertebrate homologues are indicated with red arrows. Coomassie stained SDS-PAGE gel of EXD2 WT or D108A E110A mutant protein ectopically expressed in E. coli and purified to homogeneity for use in in vitro biochemistry

experiments. InstantBlue stained SDS-PAGE gel of the truncated EXD2 proteins (WT and D108A E110A mutant) used in this study. Mass spectrum of truncated EXD2 (K76 - V564) WT protein confirming sample purity. Mass spectrum of truncated EXD2 (K76 - V564) D108A E110A protein confirming sample purity. f) 5’ radiolabeled ssDNA or dsDNA substrate (10 nM molecules) was incubated for indicated amounts of time with EXD2 WT (K76 - V564) or EXD2 (K76 - V564) D108A E110A (EXD2 mut) protein (100 nM). Samples were resolved on a 20% TBE-Urea polyacrylamide gel and visualised by phosphorimaging. This experiment was carried out two times independently.

Niedzwiedz_Supplementary figure 3



3

+

+

MCM2 FLAG-HA-EXD2 Endogenous EXD2

NS

kDa 93

siEXD2

p = 0.027

siMRE11

40

siControl siEXD2 siMRE11 siEXD2/siMRE11

siControl

p < 0.0001 60

MRE11

70

20

EXD2

130

0

EXD2

d

0

siEXD2/siMRE11

c

b

Cells with RAD51 foci (%)

+

U2OS + FLAG-HA-EXD2 D108A/E110A cl.2

+

U2OS + FLAG-HA-EXD2 WT cl.2

+

U2OS + FLAG-HA-EXD2 WT cl.1

siEXD2(3’UTR) -

U2OS

U2OS

a

U2OS + FLAG-HA-EXD2 D108A/E110A cl.1


MCM2

360 Time post IR (min)

e Time (min) 50-mer

EXD2 WT

EXD2 WT

0

0

30 60

30

Time (min)

60

EXD2 WT 0

30

60

EXD2 WT 0

30

60

30-mer



ssDNA

f

5’*

3’

*

3’

*

dsDNA nick

dsDNA

5’*

dsDNA 1nt gap

MRE11 70

70

EXD2 130

MCM2

siEXD2/siMRE11

siMRE11

siEXD2

kDa

siControl

siEXD2/siMRE11

siMRE11

siEXD2

kDa

siControl

g

MRE11 EXD2

130

Supplementary Figure 4 Western blots confirming EXD2 knockdown efficiency and additional characterisation of EXD2 in vivo and in vitro. Western blotting determining the relative levels of expression of FLAGfigure HA-EXD2 WT or D108ANiedzwiedz_Supplementary E110A mutant proteins in U2OS cells stably 4 expressing these fusion proteins. Two independent clones for each construct are shown. Cells were transfected with control siRNA (siControl) or siRNA targeting endogenous EXD2 (siEXD2 3’UTR) as indicated and harvested for western blotting. MCM2 serves as a loading control. This experiment was carried out three times independently. Quantification of the frequency of RAD51 focus-positive U2OS cells 72h post-transfection with the indicated siRNA. Cells were either untreated or exposed to 8 Gy IR and left to recover for 6h prior to fixation. Cells were stained with DAPI and RAD51 as indicated. The percentage of cells exhibiting RAD51 foci was quantified. n=366 cells (siControl 0 min), 386 cells (siEXD2 0 min), 337 cells (siMRE11 0 min), 315 cells (siEXD2/siMRE11, 0 min), n=308 cells (siControl 360 min), 321 cells (siEXD2 360 min), 337 cells (siMRE11 360 min), 374 cells (siEXD2/siMRE11, 346 min),

MCM2

respectively, pooled from three independent experiments. Bars represent mean values +/- SEM. The Chi-square test was used to determine statistical significance. Western blotting confirming the depletion of EXD2 and MRE11 in U2OS cells 72h post-transfection with control siRNA (siControl) or siRNA targeting EXD2 or MRE11 as indicated. MCM2 serves as a loading control. This experiment was carried out three times independently. d and e) 5’ radiolabeled ssDNA or dsDNA 50-mer substrates (1 nM molecules) (d) or 5’ radiolabeled dsDNA substrates (1 nM molecules) containing a nick or 1 nucleotide gap (e) were incubated for the indicated amounts of time with EXD2 WT protein (70 nM). Samples were resolved on a 20% TBE-Urea polyacrylamide gel and visualised by phosphorimaging. These experiments were carried out once. f and g) Western blotting confirming the depletion of EXD2 and MRE11 in ER-AsiSI U2OS cells (f) and DR-GFP U2OS cells (g) 72h post-transfection with control siRNA (siControl) or siRNA targeting EXD2 or MRE11 as indicated. MCM2 serves as a loading control. These experiments were carried out three times independently.

4



a

Cut site TGACTACCCTTCTGGGTGTGGCTGTAGGGGGGTTTGTCCTCTGGAAAGGCATCCAGCGCCGCCGAAGGAGTAAA AAGGCATCCAGCGCCGCCGA ACTGATGGGAAGACCCACACCGACATCCCCCCAAACAGGAGACCTTTCCGTAGGTCGCGGCGGCTTCCTCATTT AAGACCCACACCGACATCCCC

Cut site

c

b

d p < 0.0001

HeLa

HeLa EXD2-/- cl.1

DAPI RPA

Cells with >15 RPA foci/nucleus (%)

40

kDa 70

20

+

MCM2

+

eL H

D

eL

2

4

CPT (nM)

2 -/ cl . D 2 -/ 1 cl .2

53

6

EX

D 70

eL

a

EX 130

HeLa HeLa EXD2-/- cl.1 HeLa EXD2-/- cl.2

H

a eL a

eL

70

80

H

H

kDa

0

CPT EXD2

EX a eL H

100

0

+

RPA2 pS4/S8

f

20

-

a 2 -/ a cl EX .1 D 2 -/ cl .2

+

e

40

+

30

DAPI RPA

60

-

+

130

0 CPT

HeLa EXD2-/- cl.2

-

H

CPT (1μM)

DAPI RPA

Survival (%)

HeLa EXD2-/HeLa cl.1 cl.2

p < 0.0001

EXD2 CtIP MRE11 α-Tubulin

8

Supplementary Figure 5 Generation and characterisation of EXD2 knockout cell lines. EXD2 knockout generation strategy usingfigure the CRISPRNiedzwiedz_Supplementary 5 Cas9 nickase. Schematic representation of the human EXD2 genomic locus with guide RNAs sequences highlighted in green and predicted cut sites marked by red arrows. Representative images of RPA foci in HeLa control cells and in two independent clones of HeLa EXD2-/- cells treated with 1mM CPT for 1h. Scale bar = 5mm. Quantification of the percentage of HeLa or HeLa EXD2-/- cells treated as in b. exhibiting greater than 15 RPA foci per nucleus. Data from two independent HeLa EXD2-/- clones are represented. n= 617 cells (HeLa), 433 cells (HeLa EXD2-/- cl.1) and 429 (HeLa EXD2-/- cl.2) respectively, pooled from three independent

experiments. Bars represent mean values +/- SEM. The Chi-square test was used to determine statistical significance. Western blot of HeLa EXD2-/- clones and parental cells treated with 1 mM CPT for 1h. RPA2 pS4/S8 acts as an indicator of resection, MCM2 acts as a loading control. This experiment was carried out two times independently. Survival of HeLa control cells and HeLa EXD2-/- cells treated with the indicated doses of CPT. Survival data from two independent EXD2-/- clones is depicted. Survival data represent mean +/- SEM, (n= 3 independent experiments). Western blot of HeLa EXD2-/- clones and parental cells probed with antibodies against MRE11 and CtIP. a-Tubulin acts as a loading control. This experiment was carried out three times independently.




b

siControl

si

kDa 70

C on si trol EX D 2

a

53

EXD2 α-Tubulin

siEXD2

γH2AX

GFP-CtIP

Merge

c

Hela

HeLa EXD2-/- cl.1

HeLa EXD2-/- cl.2

γH2AX

MRE11

Supplementary Figure 6 EXD2 is not required for CtIP or MRE11 recruitment to site of DNA damage. Immunofluorescence microscopy of U2OS cells stably expressing GFP-CtIP treated with control siRNA (siControl) or siRNA targeting EXD2 (siEXD2) following the induction of localized DSBs by microirradiation. DAPI serves as a marker for the cell nucleus and gH2AX 6 serves as aNiedzwiedz_Supplementary marker for DSB induction. Scale bar = 20mm. figure This experiment was carried out three times independently. Western blotting confirming

Merge

EXD2 knock down efficacy in samples from (a). a-Tubulin serves as a loading control. This experiment was carried out three times independently. Immunofluorescence microscopy of WT HeLa and HeLa EXD2-/- clones stained for MRE11 using an antibody recognising the endogenous protein following the induction of localized DSBs by microirradiation. gH2AX serves as a marker for DSB induction. Scale bar = 20mm. This experiment was carried out three times independently.

6


S U P P L E M E N TA R Y I N F O R M AT I O N Fig. 1c

Fig. 1b FLAG

Mre11

GFP (CtIP)

70-

170

BRCA1 235-

70EXD2

70

Mre11

FLAG

170

235-

70-

EXD2

70

BRCA1

70-

GFP (CtIP)

CtIP

130CtIP 130Fig. 2c

RPA2 pS4/S8

Chk2-pT68

RPA2

30-

53-

30-

H3

18-

EXD2

γH2AX

70-

18-

Fig. 2f

130

70 NBS1

93

RPA2 pS4/S8

CtIP

MRE11

70

γH2AX 18

30 RPA2

EXD2 30-

H3

18

Niedzwiedz_Supplementary figure 7 Supplementary Figure 7 Original uncropped images of western blots.




Antibodies for Western blotting α-Tubulin γH2AX BRCA1 CHK2 p-T68 CtIP EXD2 GFP Histone H3 MCM2 NBS1 RPA2 RPA2 pS4/S8

Company Sigma Millipore n/a Cell Signalling n/a Sigma Roche Abcam Abcam BD Biosciences Calbiochem Bethyl

Accession Number/Clone ID B-5-1-2; T5168 JBW301; 05-636 n/a 2661 n/a HPA005848 11814460001 ab4461 ab214 34/NBS1; 611871 Ab-2; NA18 A-300 245A

Antibodies for Immunofluorescence γH2AX γH2AX BrdU MRE11 RAD51 RPA2

Company Accession Number/Clone ID Millipore 07-627 Millipore JBW301; 05-636 GE Healthcare Life Sciences BU-1; RPN202 Abcam ab214 Santa Cruz H-‐92 Calbiochem Ab-‐2; NA18

Dilution Gifted by 1 in 100000 1 in 2000 1 in 1000 Dr F. Esashi 1 in 500 1 in 2000 Dr. G. Stewart 1 in 1000 1 in 1000 1 in 100000 1 in 1000 1 in 1000 1 in 1000 1 in 1000 Dilution 1 in 200 1 in 500 1 in 200 1 in 200 1 in 100 1 in 200

Gifted by

Supplementary Table 1. Antibodies.

8



Name siEXD2-1 siEXD2-2 siEXD2 (3’ UTR) siMRE11-1 siMRE11-2 siControl siLuciferase

Sequence or catalog number L-020899-02-0005, Dharmacon (ON-TARGETplus EXD2 siRNA) CAGAGGACCAGGUAAUUUA GAACAAGGAGUCAAAUUUA L-009271-00-0005, Dharmacon (ON-TARGETplus MRE11A siRNA) GGAGGUACGUCGUUUCAGA CGAAAUGGUCACUACUAAGA D-00180-10-20, Dharmacon (ON-TARGETplus Non-targeting Pool) CGTACGCGGAATACTTCGA

Supplementary Table 2. siRNA sequences.




Name BS40 UA1 BS401 BS402 BS403 UA1_10

Sequence ATAAATATTTTTTATTAATAATAGATCACCTTTCTTTCTCTTCTCCCCTT AAGGGGAGAAGAGAAAGAAAGGTGATCTATTATTAATAAAAAATATTTAT ATAAATATTTTTTATTAATAATAGATCACC TTTCTTTCTCTTCTCCCCTT TTCTTTCTCTTCTCCCCTT AAGGGGAGAAGAGAAAGAAAGGTGATCTATTATTAATAAAAAATATTTATAGTCTGGTAA

Substrate (* indicates labeled strand) ssDNA*; dsDNA*; 5'overhang* dsDNA; dsDNA nick; dsDNA 1nt gap dsDNA nick *; dsDNA 1nt gap* dsDNA nick dsDNA 1nt gap 5'overhang

Supplementary Table 3. DNA oligonucleotides used in in vitro nuclease assays.

10



Name DSB-335 FW DSB-335 REV DSB-1618 FW DSB-1618 REV NoDSB FW NoDSB Rev

Sequence GAATCGGATGTATGCGACTGATC TTCCAAAGTTATTCCAACCCGAT TGAGGAGGTGACATTAGAACTCAGA AGGACTCACTTACACGGCCTTT ATTGGGTATCTGCGTCTAGTGAGG GACTCAATTACATCCCTGCAGCT

Supplementary Table 4. qPCR primer sequences used in ER-AsiSI resection assay.



SAMHD1 Promotes DNA End Resection to Facilitate DNA Repair by Homologous Recombination.

DNA End Resection: Nucleases Team Up with the Right Partners to Initiate Homologous Recombination.

Nuclear TRADD prevents DNA damage-mediated death by facilitating non-homologous end-joining repair.

Pre-exposure to ionizing radiation stimulates DNA double strand break end resection, promoting the use of homologous recombination repair.

Hepatoma-derived growth factor-related protein 2 promotes DNA repair by homologous recombination.

Removal of H2A.Z by INO80 promotes homologous recombination.

MutS2 Promotes Homologous Recombination in Bacillus subtilis.

Involvement of ATM in homologous recombination after end resection and RAD51 nucleofilament formation.

Tetratricopeptide repeat factor XAB2 mediates the end resection step of homologous recombination.

The human SRCAP chromatin remodeling complex promotes DNA-end resection.

KAP1 Deacetylation by SIRT1 Promotes Non-Homologous End-Joining Repair.

PHRF1 promotes genome integrity by modulating non-homologous end-joining.

EEPD1 Rescues Stressed Replication Forks and Maintains Genome Stability by Promoting End Resection and Homologous Recombination Repair.

Autophagy is critically required for DNA repair by homologous recombination.

Creating chimeric molecules by PCR directed homologous DNA recombination.

DNA sequence alignment by microhomology sampling during homologous recombination.

Wilms' tumor gene WT1 promotes homologous recombination-mediated DNA damage repair.

A PHF8 homolog in C. elegans promotes DNA repair via homologous recombination.

A second DNA binding site in human BRCA2 promotes homologous recombination.

The purine scaffold Hsp90 inhibitor PU-H71 sensitizes cancer cells to heavy ion radiation by inhibiting DNA repair by homologous recombination and non-homologous end joining.

RECQL4 Promotes DNA End Resection in Repair of DNA Double-Strand Breaks.

NuMA promotes homologous recombination repair by regulating the accumulation of the ISWI ATPase SNF2h at DNA breaks.

SIRT7 promotes genome integrity and modulates non-homologous end joining DNA repair.

TDP1 promotes assembly of non-homologous end joining protein complexes on DNA.