Ecotoxicology DOI 10.1007/s10646-015-1508-7

Exogenous glycinebetaine alleviates the detrimental effect of Cd stress on perennial ryegrass Yanhong Lou1 • Yong Yang2 • Longxing Hu1 • Hongmei Liu1 • Qingguo Xu1

Accepted: 6 June 2015  Springer Science+Business Media New York 2015

Abstract Glycinebetaine (GB) is an important organic osmolyte that accumulates in many plant species in response to abiotic stresses including heavy metals. The objective of this study was to investigate whether exogenous GB would ameliorate the adverse effect of cadmium (Cd) stress on perennial ryegrass (Lolium perenne). Fifty-three days old seedlings were exposed to hydroponic culture for 7 days with six treatments: T1 (control), T2 (0 mM Cd ? 20 mM GB), T3 (0 mM Cd ? 50 mM GB), T4 (0.5 mM Cd ? 0 mM GB), T5 (0.5 mM Cd ? 20 mM GB), T6 (0.5 mM Cd ? 50 mM GB). Cd stress resulted in a remarkable decrease in turf quality, vertical shoot growth rate (VSGR), normalized relative transpiration (NRT) and Chlorophyll (Chl) content; with significant increases in electric conductivity (EL), malondialdehyde (MDA) content, superoxide dismutase (SOD), catalase (CAT), peroxidase (POD) activity, oxalic and tartaric acid content. Exogenous application of GB decreased EL and MDA content in Cd stressed plants, and increased turf quality, VSGR, NRT, Chl content, SOD, CAT, POD activity, oxalic, tartaric acid content, and the gene expression level of SOD and POD when compared with Cd stressed without GB. Perennial ryegrass with 20 mM GB application suppressed the Cd accumulation in both shoots

Yanhong Lou and Yong Yang have equally contributed to this work. & Qingguo Xu [email protected] 1

College of Agriculture, Hunan Agricultural University, Changsha 410128, Hunan, People’s Republic of China

2

Golf College, Hunan International Economics University, Changsha 410205, Hunan, People’s Republic of China

and roots. A lower translocation factor of Cd was found in GB treated plants than non-GB treated plants, and the lowest translocation factor was observed in the 20 mM GB application. These results suggested that GB could alleviate the detrimental effect of Cd on perennial ryegrass and the amelioration was mainly related to the elevation in SOD, CAT, and POD at enzyme and gene expression levels, which reduced Cd content in shoots and improved cell membrane stability by reducing oxidation of membrane lipids. These findings lead us to conclude that application of GB with 20 mM is the best strategy to ameliorate the detrimental impacts of Cd stress on perennial ryegrass. Keywords Cadmium toxicity  Glycinebetaine  Perennial ryegrass  Antioxidant enzymes  Gene expression

Introduction With the modern industrial development, the production and emission of heavy metals have rapidly increased, and soil pollution by heavy metal has became a significant environmental problem worldwide (Hu et al. 2013). The soil contaminated by heavy metals can attributed to industrial dischargement, vehicle exhaustion, smelting and mining, insecticides or pesticides utilization, industrial and municipal wastes in agriculture, and excessive use of fertilizers (Mohammad et al. 2008). Cadmium (Cd) is a highly toxic environmental pollutant, which is difficult to degrade and is readily taken up by certain plants (De Maria et al. 2013). Many researchers have demonstrated that Cd may inhibit plant growth, and directly or indirectly inhibit the physiological processes of plants by disturbing their metabolism (Yourtchi and Bayat 2013).

123

Y. Lou et al.

The overproduction of reactive oxygen species (ROS) is considered as an early response of plant to Cd stress (Lin et al. 2007), and excessive ROS could lead to cellular damage through oxidation of membrane lipids, protein, and nucleic acids (Flora 2009). Previous reports suggested that Cd could induce oxidative stress in plant tissues, but plant cells have evolved a complex antioxidant system to ameliorate these detrimental effects (Sandalio et al. 2001). The antioxidant enzymes are superoxide dismutase (SOD), catalase (CAT), peroxidase (POD), ascorbate peroxidase (APX) (Apel and Hirt 2004). Meloni et al. (2003) reported that SOD catalyzes the dismutation of O2- to molecular O2 and H2O2. However, H2O2 is also toxic to cells and has to be further detoxified by CAT and/or POD or detoxified in the ascorbate–glutathione cycle, which involves the oxidation and re-reduction of ascorbate and glutathione through the APX (Mittler 2002). The antioxidant systems can be induced both at enzyme and gene levels under Cd stress. Pawlak et al. (2009) reported that copper-zinc superoxide dismutase (Cu, Zn-SOD) mRNA accumulation in roots was induced in soybean (Glycine max) seedlings subjected to 5–25 mg L-1 Cd. Tzure-Meng et al. (2009) indicated that induction in the activities of FeSOD, APX, and GR occurred in the marine macroalga Ulva fasciata to prevent the occurrence of oxidative damage under Cd stress. Organic acids (such as malic acid, tartaric acid, acetic acid, and citric acid) are also overproduced under severe Cd stress, and this was observed in numerous plant species (Mariano et al. 2005). Previous reports indicated that organic acids could sequester Cd and protect the roots from toxicity effects (Schwab et al. 2005; Hossain et al. 2012). Glycinebetaine (GB) as a quaternary ammonium compound, is abundant mainly in the chloroplast to protect thylakoid membranes and to maintain photosynthetic efficiency (Genard et al. 1991). Previous studies reported that exogenous application of GB could enhance stress tolerance in different crops (Mansour 1998). GB is also known to accumulate in response to heavy metal stress in many plants, including wheat (Triticum aestivum L.) (Bhatti et al. 2013), maize (Zea mays L.) (Hussain et al. 2013a, b), tobacco (Islam et al. 2009) and the aquatic plant Lemna gibba L. (Duman et al. 2011). Foliar application of GB was the suggested and effective way to induce tolerance against stress conditions in plants with poor solute accumulation (Bhatti et al. 2013). Notably, type of species, concentration of GB, and the applied period were the main factors that determined the effectiveness of exogenously GB application (Ashraf and Foolad 2007). The GB improved heavy metal tolerance in plants has been attributed to stabilization of the quaternary structures of enzymes and complex proteins, and protection of membranes (Sakamoto and Murata 2001). Exogenous

123

application of GB improves germination and seedling growth of many plants under stressful environment (Gadallah 1999), and could maintain higher antioxidative enzyme activities and minimize oxidative stress (Ma et al. 2006). However, how GB improves Cd tolerance in perennial ryegrass (Lolium perenne L.) has not been well understood. Perennial ryegrass is a dominant forage and turf grass species in temperate regions due to its quickly establishment, good grazing tolerance, extraordinarily high digestibility and adequate seed production (Lou et al. 2013). In this study, we determined the effects of Cd on perennial ryegrass, and investigated whether exogenous application of GB would alleviate the detrimental effects of Cd stress, and, if so, the physiological basis for this increased Cd tolerance.

Materials and methods Plant materials and growth conditions Fifteen seeds of perennial ryegrass ‘‘Lark’’ were sowed in a disposable plastic cup (6.8 cm in upper diameter, 4.8 cm in lower diameter, and 7.4 cm height) filled with sand (\1 mm). The sand was initially washed thoroughly with 5 % HCl (v/v), then rinsed with tap water and finally with double deionized water and air dried. A drainage hole (5 mm diameter) was drilled at the bottom of each cup to ensure the drainage of excessive water and soil aeration. All plastic cups were kept in a walk-in growth room with the temperature of 24 C/20 C (day/night), a 16-h photoperiod, and a photosynthetic active radiation of 300 lmol photons m-2s-1 at the canopy level. After germination, the seedlings were irrigated daily with 30 mL half-strength Hoagland nutrient solution (pH = 5.08, Fe was added by EDTA-Fe) (Hoagland and Arnon 1950). After 50 days of cultivation, the roots were rinsed thoroughly using deionized water, and all seedlings were transplanted into an individual 250-mL Erlenmeyer flasks filled with 240 mL half-strength Hoagland’s nutrient solutions with CaO2, which provided oxygen, and the nutrient solution was refreshed every week. All flasks were sealed with preservative film and wrapped with silicone rubber at the crown of plants to prevent water or chemicals from escaping, and wrapped with aluminum foil to prevent potential growth of algae. All flasks were placed in growth chambers for 3 days to adapt to the new environmental conditions. Before the treatment began, the plant-flask system was weighed individually and weighed again after 24 h, to determine water loss (i.e., transpiration rate) according to the method described by Yu et al. (2010). Plants with similar transpiration rates (Tr) were grouped into the same

Exogenous glycinebetaine alleviates the detrimental effect of Cd stress on perennial ryegrass

replication for Cd and GB treatment to maintain random error within replications, so the average Tr for all treatments was similar. The grass was hand-clipped two times weekly at about 6 cm height. Treatments After 3 days of adaptation, the nutrient solution was replaced with spiked solution, except for the controls. Two Cd levels (0 and 0.5 mM CdCl2) and three GB levels (0, 20, and 50 mM) were applied. Six treatments were as follows: T1 (control), T2 (0 mM Cd ? 20 mM GB), T3 (0 mM Cd ? 50 mM GB), T4 (0.5 mM Cd ? 0 mM GB), T5 (0.5 mM Cd ? 20 mM GB), T6 (0.5 mM Cd ? 50 mM GB). All the plant-flask systems were arranged in a randomized with complete block design, and kept in growth chambers. The GB that was used in our study was bought from Xi’an Lyphar Biotech Co. Ltd., and was an artifical synthesized compound with 98 % purity.

Leaf chlorophyll (Chl) content was determined following the procedure described by Yu et al. (2007a, b) with slightly modifications. Fresh leaves (0.1 g) were cut into small pieces and soaking in 15 mL of dimethyl sulfoxide in the dark for 72 h. The absorption of leaf extracts at 663 and 645 nm was measured with a spectrophotometer [UV2600; UNICO (Shanghai) Instruments, Shanghai, China]. Electrolyte leakage (EL) was determined according to the method described by Blum and Ebercon (1981). Fully expanded leaves (0.1 g FW) were excised and washed thoroughly with deionized water, then cut into 0.5-cm segments. The leaf segments were placed into 50 mL vials containing 20 mL distilled water and shaking for 24 h. The initial conductivity (Ci) of the incubation solution was measured with a conductance meter (JENCO-3173; Jenco Instruments, San Diego, CA). Leaf tissues were killed in an autoclave at 120 C for 30 min. The conductance of the incubation solution with killed tissues (Cmax) was determined after 24 h incubation on a shaker at room temperature. The relative EL was calculated as (Ci/Cmax) 9 100. Antioxidant enzymes and MDA content

Measurements Plant growth Turf quality was assessed visually based on a 1–9 scale according to Fagerness et al. (2000), with 9 being excellent, 6 acceptable, and 1 dead. Plant transpiration, a reliable and rapid hint of toxic effects (Yu et al. 2007a, b), was measured. Plant-flask systems were weighed at the beginning and the termination of the study. Water loss was determined by weighting the plant-flask systems. To compare the effect of Cd and/or GB on plants with different initial transpiration rate, the normalized relative transpiration (NRT) was calculated according to the equation described by Yu and Gu (2006). P ð1=nÞ ni¼1 Ti ðC; tÞ=Ti ðC; 0Þ P NRTðC; tÞð%Þ ¼  100; ð1=mÞ m i¼1 Tj ðC; tÞ=Tj ðC; 0Þ where C is the concentration in solution (mM), t is the time period (1, 2, 3 days, etc.), T is absolute transpiration of the plants, i is the replicate 1, 2, …, n, and j is the control 1, 2, …, m. The NRT of controls is always set at 100 %. Values lower and higher than 100 % NRT indicate the inhibition and stimulation of transpiration, respectively. Vertical shoot growth rate (VSGR) was observed according to the method describe by Huang and Liu (2009). Canopy height was measured by ruler three times in each container. The difference in average turf canopy height before and after treatment was obtained. At the end of the experimental period (7 days), shoots and roots were harvested separately and fresh weights were weighed.

The activities of SOD, CAT, POD, and MDA content were determined according to the methods as described by Fu and Huang (2001). Fully expanded leaves (0.3 g FW) were homogenized in 4 mL of 50 mM ice-cold phosphate buffer solution (pH 7.0) with a pre-chilled mortar and pestle. The homogenate was centrifuged at 15,0009g for 15 min at 4 C. The supernatant was collected for enzyme activities and MDA content determination. The content of MDA was measured using the reaction solution (2 mL) according to the method described by Heath and Packer (1968) with modifications. Briefly, a reaction solution (2 mL) was made containing 20 % (v/v) trichloroacetic acid, 0.5 % (v/v) thiobarbituric acid, and 1 mL of enzyme extraction. The mixture solution was placed in a water bath at 95 C for 30 min, and then quickly cooled in an ice-water bath to room temperature. Finally, the solution was centrifuged at 10,000 for 10 min, the absorbance of the supernatant was recorded at 532 and 600 nm. Absorbance at 600 nm was subtracted from that at 532 nm, and MDA content was calculated using this adjusted absorbance and the extinction coefficient of 155 mM-1 cm-1 (Heath and Packer 1968). The activity of SOD was determined using the reaction solution (3 mL) containing 50 lM of NBT, 1.3 lM of riboflavin (7,8-dimethyl-10-ribityliso alloxa-zine), 13 mM of methionine, 75 mM of ethylene diaminetetra acetic acid (EDTA), 50 mM of phosphate buffer (pH 7.8), and 100 lL of enzyme extract. Non-enzyme solution was employed as control. The reaction medium was placed in a 50-mL beaker and illuminated with a set of 40-W fluorescent tubes

123

Y. Lou et al.

(Philips, Amsterdam, the Netherlands) for 20 min. The absorbance of the irradiated solution at 560 nm was determined with a spectrophotometer (UV-2600). SOD activity was defined as the amount of SOD required to cause 50 % inhibition of the rate of NBT reduction at 560 nm. Catalase activity (CAT) was determined using the reaction solution (3 mL) containing 50 mM of phosphate buffer (pH 7.0), 15 mM of H2O2, and 100 lL of enzyme extract. The enzyme extract was added to initiate the reaction. Because of the linear decline of absorbance at 240 nm within the first 3 min, changes of the absorbance were read every minute. One unit CAT activity was defined as the absorbance change of 0.01 units per minute. Peroxidase activity was assessed using the reaction solution mixture (3 mL) containing 1.85 mL 0.1 M HAc– NaAc buffer (pH 5.0), 1 mL 50 % guaiacol solution, and 50 lL enzyme extraction. The reaction was started by adding 100 lL 0.75 % H2O2. Absorption at 460 nm was recorded once every 1 min within the first 3 min. One-unit POD activity was defined as the absorbance change of one unit per minute. Organic acids The culture solution was collected after 7 day’s treatment, and the roots of perennial ryegrass were washed thoroughly with distilled water to ensure all the root excretion was contained in the culture solution. The collected solution was filtered on Whatman paper, and then concentrated to 200 lL. Reversed-phase, high-performance liquid chromatography (RP-HPLC) with an Agilent 1100 Series (Agilent Technologies, Atlanta, GA, USA) was employed according to the method described by Hu et al. (2015) for organic acid determination. Roots (0.2 g FW) were homogenized in 1 mL doubledistilled water and diluted 1: 5 with 10 mM KH2PO4, pH 2.6 after centrifuged at 20,0009g for 25 min. The supernatant was filtered through a 0.45 lm membrane filter and analyzed by HPLC–DAD. The Agilent HPLC 1100 series equipped with a diode array detector and mass detector in series (Agilent Technologies, Waldbornn, Germany) was employed for organic acids analysis. Samples were injected into a Luna C18 column (150 9 1.0 mm, 3 lm particle size; Phenomenex, Macclesfield, UK) operating at 25 C. Mobile phase (10 mM KH2PO4, pH 2.6) was pumped with a 0.6 mL min-1 flow rate. Organic anions were detected at 210 nm. Peaks corresponding to malic acid, oxalic acid, tartaric acid, were identified by comparison of their retention times with those of known standards from BioRad and Sigma (St. Louis). Quantification was made with known amounts of each organic anion using peak areas (Scherer et al. 2012).

123

GB content Glycinebetaine was determined according to the method described by Grieve and Grattan (1983) with slight modifications. Plant samples collected from each flask after 7 days of treatment were washed thoroughly with distilled water, and dried to a constant weight at 80 C. The dry tissues (&0.15 g) was extracted with distilled water and the extract (1 mL) was mixed with 1 mL of 2 N H2SO4 and 0.4 mL of potassium tri-iodide solution, and then kept in 4 C for 24 h. The mixture was centrifuged at 15,0009g at 0 C for 15 min. Then the supernatant was carefully aspirated with a fine-tipped glass tube and the periodide crystals were dissolved in 9 mL of 1, 2-dichloroethane; after 2 h, absorbance was measured spectro-photometrically at 365 nm (UV-2600). The GB content (milligrams per gram DW) was determined from a standard curve prepared using GB as the standard. Cd content To determine the Cd content, the plant materials (shoots and roots) were killed at 105 C for 30 min, dried to constant weight at 80 C, and then grounded with a mortar and pestle. Samples (about 0.5 g dry weight) were ashed and then subjected to wet digestion with a mixture of concentrated HNO3 and concentrated HClO4 at 5: 1 (v/v) (Lou et al. 2013), then redissolved in nitric acid. The Cd content was determined by atomic absorption spectroscopy (Shimadzu, Model AA-7000, Japan) (Neugschwandtner et al. 2008). The concentration of Cd was defined as the Cd content (mg) per unit plants (kg). The translocation factor was calculated as follows: Translocation factor = metal concentration in plant shoot/metal concentration in plant root (Baker and Whiting 2002). Gene expression (RT-qPCR) Gene expression was measured according to the method described by Yu et al. (2014). Fully expanded leaves (0.1 g FW) were selected and detached from the plant of each treatment for RNA isolation. Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA) and the RNA concentration and purity were determined spectrophotometrically at 260 nm. Then, the RNA was treated with RNase-free DNase I to remove DNA contamination. RNA (2 lg) was reversely transcribed with oligo (dT) primer using first strand cDNA synthesis kit according to the user manual (Fermentas Canada, Burlington, ON, Canada). Primers of different genes were synthesized according to the previous reports for use in Q-PCR (Table 1). The PCR amplification data were analyzed with Option Monitor version 2.03 (MJ Research).

Exogenous glycinebetaine alleviates the detrimental effect of Cd stress on perennial ryegrass Table 1 Primer sequences used for quantitative polymerase chain reaction analyses of perennial ryegrass subjected to 0, 20 and 50 mM GB in a hydroponic system using half-strength Hoagland’s solution with 0.5 mM Cd application Gene

Primera

Primer sequence (50 –30 )

Product size (base pair)

References

CytCu/ZnSOD

F

GACACMACAAATGGHTGCAT

221

Bian and Jiang (2009)

R

TCATCBGGATCGGCATGGACAAC 271

Bian and Jiang (2009)

297

Kim et al. (2007)

ChlCu/ZnSOD FeSOD MnSOD POD

F

ATGGGTGCATATCDAYAG

R

GCCAGTCTTCCACCAGCAT

F

TGCACTTGGTGATATTCCACTC

R

CGAATCTCAGCATCAGGTATCA

F R

CAGRGBGCCATCAAGTTCAACG TACTGCAGGTAGTACGCATG

338

Bian and Jiang (2009)

F

AGGCCCAGTGCTHCAMCTTC

220

Bian and Jiang (2009)

R

TTGGTGTAGTAGGCGTTGTC

CytCu/ZnSOD, cytosolic Cu/ZnSOD; ChlCu/ZnSOD, chloroplastic Cu/ZnSOD; POD, peroxidase a

F and R represent forward and reverse

Statistical analysis All data were subjected to analysis of variance (ANOVA; SAS 9.0 for windows, SAS Institute Inc., Cary, NC) to determine the effects of Cd, GB, and Cd 9 GB interaction on turf quality, VSGR, NRT, Chl a ? b, EL, MDA, Cd and GB content, SOD, CAT and POD activities and gene expressions, organic acid content. These parameters were analyzed using two way ANOVA and found that NRT, Chl a ? b, EL, MDA, SOD, POD, CAT, oxalic acid and tartaric acid content in roots and solutions had Cd 9 GB interactions, and the effect on these parameters were induced by both Cd and GB. Treatment means were separated using the LSD test at P \ 0.05. The data for enzyme activities were analyzed separately for each time period.

treatment without GB, while 50 mM GB had no effect on the reduction in Chl a ? b due to Cd (Table 2). Cd stress caused a significant increase in EL content regardless of GB. Plants treated with 0 and 50 mM GB exhibited a significant increase in MDA content, while 20 mM GB application had no significant increase in MDA content under Cd-stressed conditions relative to non-Cd conditions (Table 3). Exogenous GB at 20 mM decreased the EL and MDA content under Cd stress, when compared with the non-GB treatment (Table 3). There was no significant difference in EL or MDA contents between nonGB treated plants and 50 mM GB treated plants under Cdstressed conditions (Table 3). However, exogenous of GB had no effects on EL content for non-Cd stressed plants regardless of GB concentration (Table 3). Cd and glycinebetaine content

Results Plant growth Cd stress (0.5 mM) reduced turf quality, VSGR and NRT remarkably regardless of GB application (Table 2). However, application of 20 mM GB significantly alleviated the reduction of turf quality, VSGR and NRT; while 50 mM GB had no significant alleviate effects on the Cdstressed plants, when compared with the non-GB treatment under Cd stress (Table 2). Application of 20 mM GB increased the NRT for the non-Cd treated plants (Table 2). A great reduction was observed in Chl a ? b for Cdstressed plants when compared to the control with no GB. The Cd-stressed plants treated with 20 mM GB had no change in Chl a ? b content when compared to the no Cd

Cd accumulated in roots was higher than in shoots regardless of the GB application. The Cd content was reduced both in shoots and roots at 20 mM GB application levels, when compared to the non-GB application treatments (Table 4). There was no difference in Cd concentration of roots or shoots between 20 and 50 mM GB treated plants under 0.5 mM Cd stressed conditions (Table 4). Meanwhile, there was no significant difference in Cd concentration of roots and shoots between 50 and 0 mM GB treated plants under 0.5 mM Cd stressed conditions. Perennial ryegrass subjected to 20 mM GB exhibited a lower translocation factor relative to the nonGB treated plants, and no significant difference in translocation factor was found between 20 and 50 mM GB treated plants (Table 4).

123

Y. Lou et al. Table 2 Effect of glycinebetaine (GB) on turf quality and normalized relative transpiration (NRT) of perennial ryegrass under Cd stressed or non-stressed conditions

GB treatment (mM)

Cd treatment (mM) Turf Quality

VSGRy (cm d-1)

NRT (%)

0

0.5

0

0.5

0

0.5

0

8.5aA

5.7bB

2.8aA

1.9bB

100.0aB

20

8.7aA

7.2bA

2.7aA

2.4bA

118.7aA

50

8.5aA

6.2bB

2.5aB

2.1bB

92.2aB

Chl a ? b 0

0.5

38.4bC

9.9aA

6.5bB

71.1bA

10.4aA

10.9aA

59.7bB

9.4aA

6.8bB

Data are expressed as means of four replicates (n = 4) Means in a column followed by the same upper-case letter for each measurement are not significant; means in a row followed the same lower-case letters for each measurement are not significant at Fisher’s protected least significant difference teat at P = 0.05

Table 3 Effect of glycinebetaine (GB) on EL and MDA under Cdstressed or non-stressed conditions

Table 5 Glycinebetaine (GB) content in shoots and roots of perennial ryegrass under Cd stressed or non-Cd stressed conditions

GB treatment (mM)

GB level (mM)

Cd treatment (mM) EL (%)

MDA (mM g

-1

FW)

Cd treatment (mM) Shoots (mg g-1 DW)

Roots (mg g-1 DW)

0

0.5

0

0.5 1.4aC

0

0.5

0

0.5

0

20.1bA

65.2aA

8.4bB

13.6aA

0

2.5bC

6.6aC

0.9bC

20

18.5bA

56.7aB

9.6aA

9.8aB

20

23.6aB

11.7bB

12.5aB

10.7bB

50

19.3bA

62.1aAB

9.1bAB

12.4aA

50

30.5aA

15.3bA

36.8aA

27.4bA

Data are expressed as means of four replicates (n = 4)

Data are expressed as means of four replicates (n = 4)

Means in a column followed by the same upper-case letter for each measurement are not significant; means in a row followed the same lower-case letters for each measurement are not significant at Fisher’s protected least significant difference teat at P = 0.05

Means in a column followed by the same upper-case letter for each measurement are not significant; means in a row followed the same lower-case letters for each measurement are not significant at Fisher’s protected least significant difference teat at P = 0.05

Activity of antioxidant enzymes Table 4 Effects of glycinebetaine (GB) on Cd content in shoots and roots of perennial ryegrass under Cd stressed conditions Organs

GB level (mM) 0

20

50

Shoots (mg g-1 DW)

0.76aB

0.56bB

0.62bB

Roots (mg g-1 DW)

11.2aA

9.8bcA

10.4abA

Translocation factor

0.068a

0.057b

0.060ab

Data are expressed as means of four replicates (n = 4) Means in a column followed by the same upper-case letter for each measurement are not significant; means in a row followed the same lower-case letters for each measurement are not significant at Fisher’s protected least significant difference teat at P = 0.05

Exogenous GB application increased endogenous GB content in both Cd-stressed and non-stressed plants, and the induction was dose dependent (the GB content was increased along with the GB application level) (Table 5). Cd stress induced GB accumulation both in shoots and roots under non-GB conditions (Table 5), but the endogenous GB levels decreased both in shoots and roots for Cdstressed plants as compared with the non-Cd stressed plants after 20 or 50 mM GB application (Table 5).

123

The Cd treatment (0.5 mM) increased the activity of SOD, POD and CAT regardless of GB application (Table 6). There was no significant change in SOD, POD and CAT activity among the three GB application levels under non-Cd stressed conditions. The Cd-stressed plants treated with GB exhibited greater SOD activity relative to the plants treated without GB, particularly for the plants treated with 20 mM GB (Table 6). Great improvement in CAT activity was observed in Cdstressed plants treated with GB compared to the non-GB treated plants, with no difference between the 20 and 50 mM treatments. The Cd-stressed plants treated with 20 mM GB increased the POD activity relative to the plants with non-GB treated. There was no significant difference in POD activity between the 20 and 50 mM GB application treatments under Cd-stressed conditions (Table 6). Organic acids Perennial ryegrass exposed to 0.5 mM Cd exhibited similar malic acid contents both in roots and culture solutions regardless of GB application (Table 7). Meanwhile, plants with exogenously applied GB showed similar malic acid

Exogenous glycinebetaine alleviates the detrimental effect of Cd stress on perennial ryegrass Table 6 Effect of glycinebetaine (GB) on activities of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) in leaves under Cdstressed or non-stressed conditions GB treatment (mM)

Cd treatment (mM) SOD (U min-1 mg-1 protein)

CAT (U min-1 mg-1 protein)

POD (U min-1 mg-1 protein)

0

0.5

0

0.5

0

0.5

0

4.7bA

6.6aC

198.1bA

266.2aB

1473.6bA

2504.2aB

20

4.5bA

8.5aA

210.5bA

345.7aA

1542.4bA

3247.5aA

50

4.4bA

7.4aB

189.4bA

378.1aA

1507.9bA

2856.1aAB

Data are expressed as means of four replicates (n = 4) Means in a column followed by the same upper-case letter for each measurement are not significant; means in a row followed the same lowercase letters for each measurement are not significant at Fisher’s protected least significant difference teat at P = 0.05

Table 7 Effects of glycinebetaine (GB) on organic acid in roots and culture solution under Cd-stressed and non-stressed conditions

GB treatment (mM)

Cd treatment (mM) Malic acid

Oxalic acid

Tartaric acid

0

0.5

0

0.5

0

0.5

0

0.28aA

0.26aA

2.41bB

2.96aB

0.25bC

0.49aC

20

0.29aA

0.28aA

2.82bA

3.75aA

0.39bA

0.82aA

50

0.26aA

0.27aA

2.79bA

3.86aA

0.32bB

0.68aB

0

0.46aA

0.48aA

3.24bB

4.41aB

0.48bC

0.92aC

20 50

0.45aA 0.47aA

0.50aA 0.49aA

4.18bA 4.21bA

5.54aA 5.43aA

0.61bB 0.75bA

1.15aB 1.32aA

Roots (mg g

-1

FW)

Culture solution (mg L-1)

Data are expressed as means of four replicates (n = 4) Means in a column followed by the same upper-case letter for each measurement are not significant; means in a row followed the same lower-case letters for each measurement are not significant at Fisher’s protected least significant difference teat at P = 0.05

contents regardless of Cd application (Table 7). Cd stress induced greater oxalic acid and tartaric acid contents both in roots and culture solution (Table 7). Perennial ryegrass with GB application exhibited greater oxalic acid contents than non-GB treated plants both in roots and culture solutions regardless of Cd application (Table 7). No significant difference in oxalic acid content was observed between 20 and 50 mM GB treatment both in roots and culture solution regardless of Cd application (Table 7). Exogenous GB application increased the tartaric acid contents when compared to the non-GB application treatment both in roots and culture solution regardless of Cd application, and the induction effect was greater in the 50 mM GB treatment than in the 20 mM GB treatment in culture solution (Table 7).

The expression level of MnSOD, FeSOD, CytCu/ZnSOD, ChlCu/ZnSOD and POD increased at 2 h and peaked at 48 h, and still maintained higher expression level at 7 days in GB treated plants when compared to the non-GB treated plants under Cd stressed conditions (Table 8). Perennial ryegrass treated with 20 mM GB exhibited a higher expression level of MnSOD at 2, 48 h and 7 days relative to the 50 mM GB treatment and the non-GB treated control. Exogenous GB induced a similar increase in the expression level of FeSOD, CytCu/ZnSOD, ChlCu/ZnSOD and POD for 20 and 50 mM GB under Cd stressed conditions, except for FeSOD and POD in 50 mM GB treated plants at 7 days and ChlCu/ZnSOD in 50 mM GB treated plants at 48 h (Table 8).

Gene expression of antioxidant enzymes

Discussion

Cd stress induced an increase in the expression levels of MnSOD, FeSOD, CytCu/ZnSOD, ChlCu/ZnSOD and POD regardless of GB treatment, particularly at 48 h (Table 8).

The results of this study indicated that application of 20 mM GB is the appropriate concentration to ameliorate the detrimental impacts of Cd stress on perennial ryegrass,

123

Y. Lou et al. Table 8 Effect of glycinebetaine (GB) on different types of superoxide dismutase (SOD), POD gene expression levels in perennial ryegrass subjected to 0.5 mM Cd stressed conditions at different times after the treatment GB level (mM)

Sampling time after Cd (0.5 mM) treatment 0h

2h

48 h

7 days

0

0.58dA

1.07cC

3.40aC

1.56bC

20

0.65dA

1.52cA

4.72aA

2.35bA

50

0.61dA

1.28cB

4.07aB

1.87bB

0

0.76dA

1.24cB

3.47aB

1.69bC

20

0.83dA

3.12bA

4.61aA

2.35cA

50

0.84dA

2.91bA

4.48aA

2.17cB

0 20

1.62dA 1.54dA

2.99cB 4.20bA

5.38aB 6.49aA

2.58bB 3.46cA

50

1.49dA

4.13bA

6.25aA

3.42cA

0

1.73dA

3.23cB

6.42aC

2.68bB

20

1.86dA

4.74bA

9.44aA

3.66cA

50

1.89dA

5.15bA

8.19aB

3.27cA

0

1.51dA

2.54cB

7.32aB

3.27bC

20

1.61dA

3.95cA

8.74aA

5.79bA

50

1.53dA

3.79cA

8.68aA

4.52bB

MnSOD

FeSOD

CytCu/ZnSOD

ChlCu/ZnSOD

POD

Data are expressed as means of four replicates (n = 4) Means in a column followed by the same upper-case letter for each measurement are not significant; means in a row followed the same lower-case letters for each measurement are not significant at Fisher’s protected least significant difference teat at P = 0.05 CytCu/ZnSOD, cytosolic Cu/ZnSOD; ChlCu/ZnSOD, chloroplastic Cu/ZnSOD

and the possible role of exogenous GB application in modulation of plant growth and the antioxidant defense system both at physiological and gene expression levels against Cd stress. Many other researchers also have reported that GB showed beneficial effects on the growth and development of numerous plants under stressed conditions (Bharwana et al. 2014). Plant growth parameters such as VSGR and NRT have been shown to be very sensitive to heavy metals in plants (Arun et al. 2005). Our research has clearly illustrated that Cd inhibited plant growth. Both VSGR and NRT were decreased regardless of GB application under Cd stressed condition, and the turf quality was also decreased significantly (Table 2). Cd affects roots more than shoots, and roots accumulated greater amount of Cd than shoots (Table 4). The phenomenon can be attributed to the fact that roots are the first organs receiving Cd from soil via apoplastic transport, leading to a greater Cd accumulation

123

there (Dra_zkiewicz et al. 2003). As the roots were subjected Cd stress, the absorption of available water and essential nutrient were inhibited by Cd stress, and the higher accumulation of toxic intermediate compounds such as ROS, leading to low growth rate and poor turf quality (Liu et al. 2011). Perennial ryegrass treated with 20 mM GB exhibited greater turf quality, and increased VSGR, NRT and Chl a ? b contents relative to non-GB treatment under Cd stressed conditions. Additional application of GB had no positive effects on this alleviation. These results suggested that exogenous GB with proper concentration (20 mM) could alleviate the detrimental effects of Cd stress on the growth of perennial ryegrass. However, a higher level of GB (50 mM) had no effect on this alleviation, and in some cases, resulted in the similar response as 0 mM GB. This phenomenon could be attributed to the phytotoxicity by GB (Wilson 2001; Mickelbart et al. 2006; Hu et al. 2013). A lower translocation factor, with more Cd2? were accumulated in roots, was another mechanism employed by exogenous GB application to alleviate detrimental effects by Cd on plant growth such as turf quality, NRT, VSGR and Chl a ? b. Plants are equipped with a defense mechanism for repairing the ROS-induced damage to protect from heavy metal injury (Dzobo and Naik 2013). In the present study, antioxidant enzymes such as SOD, CAT and POD activity, that scavenge free radicals to protect against oxidant damage (Kapoor et al. 2014), increased remarkably under Cd stress (Table 6). However, exogenous GB application enhanced the activity of all enzymes. The fact that the maximum increase in the activity of these enzymes except CAT was found in plants treated with 20 mM GB indicated that exogenous GB could contribute to detoxifying H2O2 by enhancing antioxidant enzyme activity under Cd stress (Xu et al. 2015). This is consistent with the research conducted by Bharwana et al. (2014), who illustrated that GB improved the antioxidative defense of cotton plants exposure to Pb stress. In addition, by comparing expression levels of MnSOD, FeSOD, CytCu/ZnSOD, ChlCu/ZnSOD and POD genes under Cd, and Cd ? GB treatments (Table 8), we hypothesize that GB may play an important physiological role in detoxifying plants from Cd stress. Alterations of gene expression induced by heavy metals in plants have been observed by Sharma et al. (2004) and Li et al. (2012). Our results indicated that GB upregulated all gene expressions, which could create more antioxidant enzymes and scavenge excessive ROS. The trigger of molecular responses at various SOD and POD genes by exogenous GB application suggested that the antioxidant system was employed to scavenge the excessive ROS. Duman et al. (2011) revealed that Cd-induced oxidative damages were ameliorated by exogenous GB, as reflected by the decreased accumulation of H2O2 and MDA. MDA

Exogenous glycinebetaine alleviates the detrimental effect of Cd stress on perennial ryegrass

and EL are generally considered as an indicator of the degree of plant cell membrane damage (Fan and Sokorai 2005). Exogenous GB lowered the EL and MDA under Cd stressed conditions, and the maximum decrease was observed in plants treated with 20 mM GB. The GB-induced inhibition of EL and MDA indicated that GB could significantly alleviate the detrimental damage of Cd stress on membrane stability in perennial ryegrass (Bharwana et al. 2014; Hossain et al. 2010). Organic acids excreted from roots play an important role in solubility and availability of Cd (Clemens 2006). Organic acids such as oxalic acid and malic acid can chelate with Cd to prevent its entrance into roots, and the cadmium phosphate complex that formed by the combination of organic phosphate acid and ions was unavailable to plants (Nazar et al. 2012). In the present study, the relative composition of organic acids in the culture solution is the same as in the roots, with oxalic acid dominant, and it is likely that both types of acids have the same function (Setyaningsih et al. 2012). This was consisted with the research conducted by Xie et al. (2009), who reported that oxalic acid exceeded 98 % of total acids in perennial ryegrass. In addition, tartaric and oxalic acid chelated the heavy metal ions which are detrimental to plants (Li et al. 2007). Our results also illustrated that tartaric acid and oxalic acid were increased after GB application and were correlated with the heavy metal stress tolerance in perennial ryegrass (Lu et al. 2013). Organic acids excreted by roots could reduce the bio-availability of Cd, and protect the roots from toxicity effects (Liao and Xie 2004; Schwab et al. 2005). Therefore, a decrease in Cd contents was found with 20 mM GB in the roots and with both GB levels in the shoots compared with the non-GB treatment (Table 4). Similar results were observed by Pinto et al. (2008), who reported that the presence of organic acid reduced the percentage of free Cd2? in the solution greatly, and contributed to the Cd-Resistant mechanism in sorghum and maize. Meanwhile, the excessive oxalic and tartaric acids in roots under Cd stress may contribute to a lower translocation factor with 20 mM GB application plants to non-GB treatment. Furthermore, GB played an important role in effective protection against lead and chromium (Ali et al. 2015; Bhatti et al. 2013). In summary, exogenous application of a proper concentration of GB was effective in alleviating the detrimental effect to perennial ryegrass from Cd stress. The beneficial effects of exogenous GB to plants may be attributed to improvement of antioxidant systems at enzyme and gene expression levels to alleviate the peroxidation-linked membrane damage caused by ROS, and increased oxalic acid and tartaric acid concentrations which could chelate more heavy metal ions, leading to less Cd2? translocation from roots to shoots. It can be expected that exogenous GB

would be an applicable approach to deal effectively with Cd toxicity in perennial ryegrass. However, information about the effects of exogenous GB application on diverse plant species and the mechanism of tolerance are still limited and must be further investigated. Acknowledgments This work was financially supported by the Changsha Municipal Science and Technology Project (K1403026-31). Conflict of interest of interest.

The authors declare that they have no conflict

References Ali S, Chaudhary A, Rizwan M, Anwar HT, Adrees M, Farid M, Irshad MK, Hayat T, Anjum SA (2015) Alleviation of chromium toxicity by glycinebetaine is related to elevated antioxidant enzymes and suppressed chromium uptake and oxidative stress in wheat (Triticum aestivum L.). Environ Sci Pollut Res Int. doi:10.1007/s11356-015-4193-4 Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu Rev Plant Biol 55:373–399 Arun KS, Carlos C, Herminia LZ, Avudainayagam S (2005) Chromium toxicity in plants. Environ Int 31:739–753 Ashraf M, Foolad MR (2007) Roles of glycine betaine and proline in improving plant abiotic stress resistance. Environ Exp Bot 59:206–216 Baker AJM, Whiting SN (2002) In search of the holy grail: a further step in understanding metal hyperaccumulation? New Phytol 155:1–4 Bharwana SA, Ali S, Farooq MA, Iqbal N, Hameed A, Abbas F, Ahmad MSA (2014) Glycine betaine-induced lead toxicity tolerance related to elevated photosynthesis, antioxidant enzymes suppressed lead uptake and oxidative stress in cotton. Turk J Bot 38:281–292 Bhatti KH, Anwar S, Nawaz K, Hussain K, Siddiqi EH, Sharif RU, Talat A, Khalid A (2013) Effect of exogenous application of glycinebetaine on wheat (Triticum aestivum L.) under heavy metal stress. Middle-East J Sci Res 14:130–137 Bian SM, Jiang YW (2009) Reactive oxygen species, antioxidant enzyme activities and gene expression patterns in leaves and roots of Kentucky bluegrass in response to drought stress and recovery. Sci Hortic 120:264–270 Blum A, Ebercon A (1981) Cell membrane stability as a measure of drought and heat tolerance in wheat. Crop Sci 21:43–47 Clemens S (2006) Toxic metal accumulation, responses to exposure and mechanisms of tolerance in plants. Biochimie 88:1707–1719 De Maria S, Puschenreiter M, Rivelli AR (2013) Cadmium accumulation and physiological response of sunflower plants to Cd during the vegetative growing cycle. Plant Soil Environ 59:254–261 Dra_zkiewicz M, Tukendorf A, Baszyn´ski T (2003) Age-dependent response of maize leaf segments to cadmium treatment: effect on chlorophyll fluorescence and phytochelation accumulation. J Plant Physiol 160:247–254 Duman F, Aksoy A, Aydin Z, Temizgul R (2011) Effects of exogenous glycinebetaine and trehalose on cadmium accumulation and biological responses of an aquatic plant (Lemna gibba L.). Water Air Soil Poll 217:545–556 Dzobo K, Naik YS (2013) Effect of selenium on cadmium-induced oxidative stress and esterase activity in rat organs. S Afr J Sci 109:1–8

123

Y. Lou et al. Fagerness MJ, Yelverton FH, Isgrigg J, Cooper RJ (2000) Plant growth regulators and mowing height affect ball roll and quality of creeping bentgrass putting greens. HortScience 35:755–759 Fan XT, Sokorai KJB (2005) Assessment of radiation sensitivity of fresh-cut vegetables using electrolyte leakage measurement. Postharvest Biol Technol 36:191–197 Flora SJS (2009) Structural, chemical and biological aspects of antioxidants for strategies against metal and metalloid exposure. Oxid Med Cell Longev 2:191–206 Fu JM, Huang BR (2001) Involvement of antioxidants and lipid peroxidation in the adaptation of two cool-season grasses to localized drought stress. Environ Exp Bot 45:105–114 Gadallah MMA (1999) Effects of proline and glycinebetaine on Vicia faba responses to salt stress. Biol Plant 42:249–257 Genard H, Le Saos J, Billard JP, Tremolieres A, Boucaud J (1991) Effect of salinity on lipid composition, glycine betaine content and photosynthetic activity in chloroplasts of Suaeda maritime. Plant Physiol Biochem 29:421–427 Grieve CM, Grattan SR (1983) Rapid assay for the determination of water soluble quaternary ammonium compounds. Plant Soil 70:303–307 Heath RL, Packer L (1968) Photoperoxidation in isolated chloroplasts: I. Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem Biophys 125:189–198 Hoagland DR, Arnon DI (1950) The water-culture method for growing plants without soil. Calif Agric Exp Stn Circ 347:1–32 Hossain MA, Hasanuzzaman M, Fujita M (2010) Up-regulation of antioxidant and glyoxalase systems by exogenous glycinebetaine and proline in mung bean confer tolerance to cadmium stress. Physiol Mol Biol Plants 16:259–272 Hossain MA, Piyatida P, Silva JATD, Fujita M (2012) Molecular mechanism of heavy metal toxicity and tolerance in plants: central role of glutathione in detoxification of reactive oxygen species and methylglyoxal and in heavy metal chelation. J Bot. doi:10.1155/2012/872875 Hu YA, Liu XP, Bai JM, Shih KM, Zeng EY, Cheng HF (2013) Assessing heavy metal pollution in the surface soils of a region that had undergone three decades of intense industrialization and urbanization. Environ Sci Pollut Res Int 20:6150–6159 Hu LX, Zhang PP, Jiang Y, Fu JM (2015) Metabolomic analysis revealed differential adaption to salinity and alkalinity stress in Kentucky bluegrass (Poa pratensis). Plant Mol Biol Rep 33:56–68 Huang B, Liu X (2009) Physiological responses of creeping bentgrass to heat stress affected by phosphonate fungicide application. Int Turfgrass Soc Res J 11:799–806 Hussain I, Akhtar S, Ashraf MA, Rasheed R, Siddiqi EH, Ibrahim M (2013a) Response of maize seedlings to cadmium application after different time intervals. ISRN Agron. doi:10.1155/2013/169610 Hussain I, Akhtar S, Ashraf MA, Rasheed R, Siddiqi EH, Ibrahim M (2013b) Response of maize seedlings to Cadmium application after different time intervals. ISRN Agron. doi:10.1155/2013/169610 Islam MM, Hoque MA, Okuma E, Banu MN, Shimoishi Y, Nakamura Y, Murata Y (2009) Exogenous proline and glycinebetaine increase antioxidant enzyme activities and confer tolerance to cadmium stress in cultured tobacco cells. J Plant Physiol 166:1587–1597 Kapoor D, Kaur S, Bhardwaj R (2014) Physiological and biochemical changes in Brassica juncea plants under Cd-induced stress. Biomed Res Int. doi:10.1155/2014/726070 Kim DW, Shibato J, Agrawal GK, Fujihara S, Iwahashi H, du Kim H, Shim leS, Rakwal R (2007) Gene transcription in the leaves of rice undergoing salt-induced morphological changes (Oryza sativa L.). Mol Cells 24:45–59 Li WC, Ye ZH, Wong MH (2007) Effects of bacteria on enhanced metal uptake of the Cd/Zn-hyperaccumulating plant, Sedum alfredii. J Exp Bot 58:4173–4182

123

Li HY, Luo HJ, Li DY, Hu T, Fu JM (2012) Antioxidant enzyme activity and gene expression in response to lead stress in perennial ryegrass. J Am Soc Hortic Sci 137:80–85 Liao M, Xie XM (2004) Cadmium release in contaminated soils due to organic acids. Pedosphere 14:223–228 Lin AJ, Zhang XH, Chen MM, Cao Q (2007) Oxidative stress and DNA damages induced by cadmium accumulation. J Environ Sci 19:596–602 Liu DL, Hu KQ, Ma JJ, Qiu WW, Wang XP, Zhang SP (2011) Effects of cadmium on the growth and physiological characteristics of sorghum plants. Afr J Biotechnol 10:15770–15776 Lou YH, Luo HJ, Hu T, Li HY, Fu JM (2013) Toxic effects, uptake, and translocation of Cd and Pb in perennial ryegrass. Ecotoxicology 22:207–214 Lu LL, Tian SK, Yang XE, Peng HY, Li TQ (2013) Improved cadmium uptake and accumulation in the hyperaccumulator Sedum alfredii: the impact of citric acid and tartaric acid. J Zhejiang Univ Sci B 14:106–114 Ma QQ, Wang W, Li YH, Li DQ, Zhou Q (2006) Alleviation of photo-inhibition in drought-stresses wheat (Triticum aestivum) by foliar-applied glycinebetaine. J Plant Physiol 163:165–175 Mansour MMF (1998) Protection of plasma membrane of onion epidermal cells by glycinebetaine and proline against NaCl stress. Plant Physiol Biochem 36:767–772 Mariano ED, Jorge RA, Keltjens WG, Menossi M (2005) Metabolism and root exudation of organic acid anions under aluminium stress. Braz J Plant Physiol 17:157–172 Meloni DA, Oliva MA, Martinez CA, Cambraia J (2003) Photosynthesis and activity of superoxide dismutase, peroxidase and glutathione reductase in cotton under salt stress. Environ Exp Bot 49:69–76 Mickelbart MV, Chapman P, Collier-Christian L (2006) Endogenous levels and exogenous application of glycinebetaine to grapevines. Sci Hortic 111:7–16 Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7:405–410 Mohammad IL, He ZL, Stoffella PJ, Yang XE (2008) Phytoremediation of heavy metal polluted soils and water: progresses and perspectives. J Zhejiang Univ Sci B 9:210–220 Nazar R, Iqbal N, Masood A, Khan MIR, Syeed S, Khan NA (2012) Cadmium toxicity in plants and role of mineral nutrients in its alleviation. Am J Plant Sci 3:1476–1489 Neugschwandtner RW, Tlustosˇ P, Koma´rek M, Sza´kova´ J (2008) Phytoextraction of Pb and Cd from a contaminated agricultural soil using different EDTA application regimes: laboratory versus field scale measures of efficiency. Geoderma 144: 446–454 Pawlak S, Firych A, Rymer K, Deckert J (2009) Cu, Zn-superoxide dismutase is differently regulated by Cadmium and lead in roots of soybean seedlings. Acta Physiol Plant 31:741–747 Pinto AP, Simo˜es I, Mota AM (2008) Cadmium impact on root exudates of sorghum and maize plants: a speciation study. J Plant Nutr 31:1746–1755 Sakamoto A, Murata N (2001) The use of bacterial choline oxidase, a glycinebetaine synthesizing enzyme, to create stress-resistant transgenic plants. Plant Physiol 125:180–188 Sandalio LM, Dalurzo HC, Go´mez M, Romero-Puertas MC, Rı´o LAD (2001) Cadmium-induced changes in the growth and oxidative metabolism of pea plants. J Exp Bot 52:2115–2126 Scherer R, Rybka ACP, Ballus CA, Meinhart AD, Filho JT, Godoy TH (2012) Validation of a HPLC method for simultaneous determination of main organic acids in fruits and juices. Food Chem 135:150–154 Schwab AP, He YH, Banks MK (2005) The influence of organic ligands on the retention of lead in soil. Chemosphere 61:856–866

Exogenous glycinebetaine alleviates the detrimental effect of Cd stress on perennial ryegrass Setyaningsih L, Setiadi Y, Sopandie D, Budi SW (2012) Organic acid characteristics and tolerance of Sengon (Paraserianthes falcataria L Nielsen) to lead. JMHT 3:177–183 Sharma SS, Kaul S, Metwally A, Goyal KC, Finkemeier I, Dietz KJ (2004) Cadmium toxicity to barley (Hordeum vulgare) as affected by varying Fe nutritional status. Plant Sci 166:1287–1295 Tzure-Meng WU, Yi-Ting HSU, Lee Tse-Min (2009) Effects of cadmium on the regulation of antioxidant enzyme activity, gene expression, and antioxidant defenses in the marine macroalga Ulva fasciata. Bot Stud 50:25–34 Wilson S (2001) Frost management in cool climate vineyards. Final report to grape and wine research & development corporation, Australia p 34 Xie MJ, Yan CL, Ye J, Wei L (2009) Impact of phenanthrene on organic acids secretion and accumulation by perennial ryegrass, Lolium perenne L., Root. Bull Environ Contam Toxicol 83:75–80 Xu P, Zeng GM, Huang DL, Dong HR, Lai C, Chen M, Tang WW, Li FL, Leng Y, Cheng M, He XX, He Y (2015) Cadmium induced hydrogen peroxide accumulation and responses of enzymatic

antioxidants in Phanerochaete chrysosporium. Ecol Eng 75: 110–115 Yourtchi MS, Bayat HR (2013) Effect of cadmium toxicity on growth, cadmium accumulation and macronutrient content of durum wheat (Dena CV.). Int J Agric Crop Sci 6:1099–1103 Yu XZ, Gu JD (2006) Uptake, metabolism, and toxicity of methyltertbutyl ether (MTBE) in weeping willows. J Hazard Mater 137:1417–1423 Yu XZ, Trapp S, Zhou PH, Chen L (2007a) The effect of temperature on uptake and metabolism of cyanide by weeping willows. Int J Phytoremediation 9:243–255 Yu XZ, Gu JD, Huang SZ (2007b) Hexavalent chromium induced stress and metabolic responses in hybrid willows. Ecotoxicology 16:299–309 Yu XZ, Peng XY, Xing LQ (2010) Effect of temperature on phytoextraction of hexavalent and trivalent chromium by hybrid willows. Ecotoxicology 19:61–68 Yu XZ, Zhang XH, Yue DM (2014) Alternation of antioxidative enzyme gene expression in rice seedlings exposed to methylene blue. Environ Sci Pollut Res 21:14014–14022

123