ISSN 00124966, Doklady Biological Sciences, 2013, Vol. 452, pp. 320–324. © Pleiades Publishing, Ltd., 2013. Original Russian Text © O.Yu. Antonova, M.M. Yurinskaya, S.Yu. Funikov, M.B. Evgen’ev, M.G. Vinokurov, 2013, published in Doklady Akademii Nauk, 2013, Vol. 452, No. 5, pp. 581–585.

CELL BIOLOGY

Exogenous Heat Shock Protein HSP70 Modulates LipopolysaccharideInduced Macrophage Activation O. Yu. Antonova, M. M. Yurinskaya, S. Yu. Funikov, M. B. Evgen’ev, and M. G. Vinokurov Presented by Academician Yu.V. Il’in February 21, 2013. Received March 5, 2013

DOI: 10.1134/S0012496613050141

Innate immunity cells, including macrophages, play an important role in the defense of a mammalian body against pathogenic bacteria. Lipopolysaccha rides (LPS) produced by Gramnegative bacteria acti vate macrophages. They begin to produce reactive oxygen species (ROS), synthesize and secrete proin flammatory cytokines, and raise the production of heat shock proteins (HSP), including HSP70 [1]. After entering the bloodstream, LPSs interact with LPSbinding protein and, subsequently, with the CD14 receptor of target cells. Then, LPSs are trans ferred from CD14 to lymphocyte antigen 96 (MD2) to form two identical complexes including Tolllike receptor 4 (TLR4), MD2, and LPS. Then, a het erodimeric receptor complex is formed in target cell membranes through interaction of the phosphate moi eties of LPS from one complex with TLR4 of the other complex [2]. The next step is the transduction of the signal from the receptor to transcription factors of tar get cells to elicit the cell response. Early steps of the response are characterized by elevated ROS produc tion and adhesion factor expression. Then, proinflam matory cytokines are produced. The first of them to be secreted is TNFα [3]. Most enterobacteria E. coli contain the S form of LPSs. It includes hydrophobic lipid A, an oligosaccha ride core, and Oantigen. In addition to the S form, enterobacteria produce coredeficient LPS molecules (R chemotypes) containing lipid A and cores of differ ent lengths. The molecules with abnormal cores are designated as Rb–Re chemotypes, and molecules with a fullsize external core, as the Ra chemotype [4].

Institute of Cell Biophysics, Russian Academy of Sciences, Pushchino, Moscow oblast, Russia Pushchino State Institute of Natural Sciences, Pushchino, Moscow oblast, Russia Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russia

It is supposed that the LPS receptor complex can also bind heat shock proteins with Mr = 70 kDa (HSP70) [5]. Our earlier results indicate that administration of exogenous recombinant HSP70 increases the survival of animals in the septic shock model and suppresses the activation of neutrophils and macrophages induced by the S form of LPS [6]. By now, the effect of S LPSs on myeloid cells has been studied in detail, but little is known about the action of R forms. Previously, we found an effect of various LPS chemotypes on ROS production and apo ptosis in neutrophils [7]. Here, we studied the effect of exogenous HSP70 on ROS and TNFα production by macrophages exposed to various LPS chemotypes. We also studied the effect of exogenous HSP70 and LPSs on the TLR2 and TLR4 expression in macrophages. Earlier studies showed that administration of exog enous HSP70 reduced phagocyte activation by S LPSs. However, it remained unknown whether HSP70 acted via cell receptors or penetrated into the cells to affect the expression of TLR2 and TLR4. Here, we have demonstrated that exogenous HSP70 reduces the production of ROS and TNFα by RAW264.7 mac rophages induced by various LPS chemotypes. In this process, HSP70 not only binds to the membrane, but also penetrates into the cell. We have shown that exog enous HSP70 does not affect of the mRNA expression of TLR2 and TLR4 receptors in RAW264.7. MATERIALS AND METHODS Lipopolysaccharide chemotypes from the follow ing E. coli strains were used in the study: O55:B5 (S form), EH100 (Ra mutant), J5 (Rc mutant), F583 (Rd mutant), and R515 (Re mutant). The first four chemotypes were purchased from Sigma and the fifth, from Alexa. The growth medium RPMI 1640, fetal bovine serum (FBS), Crystal Violet dye, Hanks’ solu

320

EXOGENOUS HEAT SHOCK PROTEIN HSP70

tion (HBSS), phosphatebuffered saline, and Phorbol 12myristate 13acetate (PMA) were purchased from Sigma. We used the following monoclonal antibodies: primary antiHSP70 antibodies from US Biological (United States) and secondary antibodies labeled with Alexa488 from Invitrogen (United States). Recombinant human HSP70 was isolated as in [6]. The culture of RAW264.7 mouse macrophages was obtained from the American Type Culture Collection (ATCC). Cells were grown in RPMI1640 supplemented with heatinactivated 10% FBS, 1% glutamine, 1% pen icillin, and 1% streptomycin in the atmosphere with 5% CO2 at 37°C. In the preliminary study of the effect of the time of RAW264.7 exposure and LPS concentration on ROS production, the best result was achieved by incubation of 106 cells/mL with 5% FBS for 10 h followed by addition of LPS chemotypes and HSP70 and incuba tion for 16 h (data not shown). The culture medium was replaced with Hanks’ solution, 300 μM luminol was added, and the mixture was incubated at 37°C for 25 min. Samples were placed into a 1250 luminometer (LKB, Sweden) and stimulated with 200 nM PMA. Chemiluminescence was recorded for 10 min. The value for control cells was taken to be 100%. Production of TNFα by macrophages was assessed from the cytotoxic action of samples on target murine fibroblasts L929 [8]. RAW264.7 cells were placed into a 24well plate, 5 × 105 cells/mL, in RPMI 1640 with 10% FBS in 5% CO2 at 37°C. Materi als to be investigated were added, and the mixtures were incubated for 24 h. The supernatant of RAW264.7 cells was added to target cells. In studies of the cell location of exogenous HSP70, RAW264.7 cells were placed into 8well LabTek II chambers (Nunc), 4 × 105 cells/mL in 5% medium, and incubated in 5% CO2 at 37°C for 16 h. The medium was replaced with a fresh portion, HSP70 was added, and the mixture was incubated for another 8 h. Cells were stained with antibodies (Abs) under differ ent conditions. To investigate intracellular HSP70, cells were treated with Triton X100 prior to staining. The HSP70 fraction located on the cell membrane was visualized with Abs without detergent treatment. The expression of the TLR4 and TLR2 macroph age receptors was assayed by quantitative realtime PCR. Total RNA was isolated from 106 cells with Tri reagent (Sigma Aldrich, United States). The RNA concentration was measured with a NanoDrop ND_1000 spectrometer (NanoDrop Technologies, United States). To obtain singlestranded cDNA, 1 μg of total RNA pretreated with DNase I (Ambion, United States), hexanucleotide primers, and reverse transcriptase from the Revert Aid H Minus Reverse Transcriptase kit (Fermentas, Lithuania) were added to the reaction mixture. DOKLADY BIOLOGICAL SCIENCES

Vol. 452

2013

321

The levels of mRNA were assessed using the B2m gene (beta2 microglobulin) as a reference one. This gene is the most suitable for LPSstimulated mono cytes, as reported in [9] and confirmed by our experi ence. The experiment was conducted with an ABI PRISM 7500 Sequence Detection System (Applied Biosystems, United States). The reaction volume was 25 μL. Each reaction was done in triplicate. Amplifi cation products were visualized by staining with the SYBR Green I dye with the presence of the reference dye ROX (Sintol, Russia). The PCR protocol for all genes assayed was as follows: denaturation at 95°C for 5 min followed by 40 cycles of 20 s at 95°C, 20 s at 60°C, and 30 s at 72°C and for the ending synthesis at 72°C for 5 min. The comparative or Ct method used in this study allows the assessment of mRNA levels by double com parison: The gene under study is compared with the control gene in exposed cells in comparison with nor mal samples. The relative quantification (RQ) value is the log change of the mRNA level determined with a proprietary software from Applied Biosystems. Primer sequences for the B2m gene were 5'TGC TACTCGGCGCTTCAGTC3' and 5'AGGCG GGTGGAACTGTGTTAC3'; those for the TLR2 gene were 5'GGGTAAAGTAGAAACAGTCAC3' and 5'CTTGCTGTTCTCTACTGTGAT3'; and those for TLR4 were 5'ACTGTTCTTCTCCTGC CTGA3' and 5'AATGTCATCAGGGACTTTGCT 3'. The primers were chosen from different exons to improve specificity. The reaction efficiency was deter mined for each primer pair. It was no less than 90%. Images were processed with the ImageJ software (v. 1.46k). Experimental data were evaluated with Sig maPlot. RESULTS AND DISCUSSION Our study of ROS production by RAW264.7 cells exposed to various LPS chemotypes showed that all chemotypes significantly increased chemilumines cence (Fig. 1a). The S form of LPS caused the greatest ROS production: 433.0 ± 19.6% relative to the control. As the length of the polysaccharide chain decreased, the activation degree decreased to the minimum value characteristic of the Re chemotype, 275.3 ± 20.9%. Thus, the ability of LPS chemotypes to enhance ROS production decreases in the order S > Ra > Rc > Rd > Re. Incubation of neutrophils with HSP70 for 5 min prior to LPS addition reduced the LPSinduced ROS production dramatically, thereby demonstrating a protection effect. This effect of HSP70 was observed with all LPS chemotypes, but it also depended on LPS structure. Macrophages exposed to LPS produced consider able amounts of TNFα, depending on the LPS struc ture (Fig. 1b). The LPS form enhanced the TNFα

322

ANTONOVA et al. CL, % of control 500

TNFα, pg/mL 6000

(a)

1 2

400

(b)

5000 4000

300 3000 200

2000

100 0

1000 С

S

Ra

Rc

Rd

Re

0

С

S

Ra

Rc

Rd

Re

Fig. 1. Effect of exogenous HSP70 on the production of (a) ROS and (b) TNFα by RAW264.7 macrophages exposed to various LPS chemotypes (1 μg/mL): 1, without HSP70; 2—5 μg/mL HSP70. (a) Comparison of bars 1 and 2 in group C: p = 0.009 (n = 3); (b) comparison of bars 1 and 2 in group Re: p = 0.01 (n = 3).

production to 5.0 ± 0.1 ng/mL compared to control cells (0.15 ± 0.01 ng/mL) more than any other chemo type studied. The effect of Re LPSs on the TNFα production was the lowest, 4.15 ± 0.04 ng/mL. The greatest protection effect of HSP70 was recorded with S LPSs, where the TNFα production decreased to 3.35 ± 0.05 ng/mL. The smallest effect was exerted by Rc LPSs: the TNFα production decreased from 4.70 ± 0.05 to 4.00 ± 0.07 ng/mL. The protection effect of exogenous HSP70 on various LPS chemotypes decreased in the order S > Ra > Re > Rd > Rc. Thus, exogenous HSP70 exerts a protection effect, reducing the ROS and TNFα production induced by various LPS chemotypes. Fluorescence, % 2500 a b

2000 1500 1000 500 0

1

2

Fig. 2. Interaction of exogenous HSP70 with RAW264.7 cells: 1, control cells; 2, cells incubated with 5 μg/mL HSP70. (a) Samples not pretreated with Triton X100 (assay of HSP70 attached to the cell surface); (b) samples pretreated with Triton X100 (assay of intracellular HSP70). The values are presented as percentage of values for control cells not pretreated with Triton X100. The assay was done by cell staining with antibodies against HSP70.

To understand the mechanism by which exogenous HSP70 interacts with cells, we investigated its cell location. We found HSP70 located on the surface of plasma membranes of control cells (Fig. 2, 1a). Incu bation of macrophages with exogenous HSP70 increased the amount of HSP70 located on the cell surface (Fig. 2, 2a) to 220.2 ± 19.9%. It was incorpo rated into the plasma membrane or bound by cell receptors [10]. RAW264.7 macrophages had a high level of intracellular constitutive HSP70 at 37°C (1371.7 ± 89.3%, Fig. 2, 1b). After incubation with exogenous HSP70, the intracellular protein level was increased by penetration of extracellular HSP70 inside the cell (2052.0 ± 118.8%, Fig. 2, 2b). It is known that sepsis is accompanied by elevated HSP70 levels in blood [1]. Moreover, it is presently thought that HSP70 is an agonist of TLR2 and TLR4 receptors. Agonists of TLR are also conjectured able to modulate expression of these receptors [12]. In this connection, it was of special interest to investigate the effects of LPSs and heat shock (HS) on the regulation of the TLR2 and TLR4 expression. Our previous studies demonstrated that monocyte pretreatment with exogenous HSP70 exerted a protec tion effect, decreasing the LPSinduced TLR4 expres sion [8]. Our results led us to the suggestion that the increase in the level of the receptors under study on monocyte cell membranes [8] was mediated by an increase in the intracellular level. It prompted us to investigate the mRNA expression of TLR2 and TLR4 receptors at 37°C and HS. Exogenous HSP70 insignificantly increased the mRNA expression of TLR2 at 37°C (Fig. 3a, II, 1). The increase in the mRNA level of TLR2 by LPS was significant (Fig. 3a, III, 1), which was consistent with [13]. Pretreatment of macrophages with HSP70 prior to LPS treatment also increased the mRNA level of TLR2 (Fig. 3a, IV, 1). DOKLADY BIOLOGICAL SCIENCES

Vol. 452

2013

EXOGENOUS HEAT SHOCK PROTEIN HSP70 RQ 6 1 2

5

RQ 2.5

(a)

323

(b)

2.0

4 1.5 3 1.0

2

0.5

1 0

I

II

III

IV

0

I

II

III

IV

Fig. 3. Effects of exogenous and endogenous HSP70 on the production of (a) TLR2 and (b) TLR4 by RAW264.7 macrophages: I, control; II, HSP70, 1 μg/mL; III, LPS, 1 μg/mL; IV, addition of HSP70 and LPS after 10 min; 1, cells incubated at 37.5°C; 2, cells exposed to heat shock at 42.5°C for 30 min; RQ, relative quantification.

Heat shock reduced the expression of TLR2 mRNA (Fig. 3a, I, 2) compared to control cells with out HS (Fig. 3a, I, 1). Incubation of RAW264.7 cells with exogenous HSP70 also reduced the TLR2 mRNA levels in comparison to the control (Fig. 3a, II, 2). Heat shock lowered the TLR2 mRNA levels in cells exposed to LPS and in cells pretreated with HSP70 prior to LPS addition (Figs. 3a, III, 2 and 3a, IV, 2, respectively) in comparison with cells not exposed to HS. It is seen from Fig. 3b, II, 1 that exogenous HSP70 exerts practically no effect on the TLR4 mRNA expression at 37°C. Action of LPSs on RAW264.7 cells causes a significant decrease in the level of TLR4 mRNA (Fig. 3b, III, 1) in comparison with control values (Fig. 3b, I, 1). This observation agrees with data reported in [14]. Pretreatment with HSP70 prior to stimulation with LPSs reduced the TLR4 expression (Fig. 3b, IV, 1), suggesting the predominant influence of LPSs on the TLR4 mRNA expression. Heat shock caused a significant increase in the level of TLR4 mRNA in RAW264.7 cells in comparison with control cells at 37°C (Figs. 3b, I, 2 and 3b, I, 1, respectively). Incubation of macrophages with extra cellular HSP70 under HS conditions also increased the TLR4 mRNA level (Fig. 3b, II, 2). At 42.5°C, ele vated TLR4 mRNA expression was observed with LPS treatment and with pretreatment with HSP70 prior to LPS addition (Figs. 3b, III, 2 and 3b, IV, 2, respec tively) in comparison with macrophages incubated at 37°C under the otherwise identical conditions (Figs. 3b, III, II, 1 and 3b, IV, 1, respectively). These results suggest that exogenous HSP70 does not affect the activation of genes controlling TLR4 production. On the other hand, HS enhances the TLR4 gene transcription and moderates the LPS DOKLADY BIOLOGICAL SCIENCES

Vol. 452

2013

induced decrease in TLR4 expression regardless of the presence of exogenous HSP70. Earlier, we demonstrated an effect of structural diversity of LPS chemotypes on the interaction with blood phagocytes [8]. Here, we have shown that all LPS chemotypes under study can elicit a “respiratory burst” and TNFα secretion by macrophages. The stimulating potential of LPS chemotypes is deter mined by the LPS molecule structure. The greatest activity is characteristic of the S form, whereas Re caused the smallest increase in the parameters under study (ROS and TNFα production) among LPS chemotypes. Exogenous HSP70 can attenuate the macrophage activation induced by LPS chemotypes, and this attenuation depends on the structural features of the LPS molecule, too. Studies of putative pathways of the protection action of exogenous HSP70 showed that the protein could not only bind the cell membrane of macroph ages, but also penetrate into the cells (Fig. 2, 2b). Cor respondingly, in addition to receptor binding, the pro tection action of HSP70 may be mediated by activa tion of intracellular signaling pathways. This study shows that exogenous HSP70 can increase the intracellular HSP70 level, probably, by penetrating into the cell or regulating HSP70 produc tion, in accordance with [11]. Another conclusion is that exogenous HSP70 is not involved in the regula tion of the mRNA expression of TLR2 . Although recent studies provide increasing evidence that TLR4 is a receptor for HSP70 binding to cells, we found no data confirming the action of exogenous HSP70 on the TLR4 mRNA level.

324

ANTONOVA et al.

ACKNOWLEDGMENTS This study was supported by the Russian Founda tion for Basic Research, project 120431331 mol_a. REFERENCES 1. Zhou, J., An, H., Xu, H., et al, Immunology, 2005, vol. 114, no. 4, pp. 522–530. 2. Park, B.S., Song, D.H., Kim, H.M., et al., Nature, 2009, vol. 458, no. 7242, pp. 1191–1195. 3. Buttenschoen, K., Radermacher, P., and Bracht, H., Langenbecks Arch. Surg., 2010, vol. 395, no. 6, pp. 597– 605. 4. Christian, A. and Ulrich, Z., Trends Glycosci. Glycoth echnol., 2002, vol. 14, no. 76, pp. 69–86. 5. Schmitt, E., Gehrmann, M., Brunet, M., et al., J. Leu kocyte Biol., 2007, vol. 81, no. 1, pp. 15–27. 6. Rozhkova, E., Yurinskaya, M., Zatsepina, O., et al., Ann. N.Y. Acad. Sci., 2010, vol. 1197, pp. 94–107.

7. Vinokurov, M.G., Yurinskaya, M.M., Prokhorenko, I.R., et al., Bull. Eksp. Biol. Med., 2006, vol. 147, no. 8, pp. 136–138. 8. Antonova, O.Yu., Yurinskaya, M.M., Evgen’ev, M.B., et al., Dokl. Biol. Sci., 2012, vol. 447, no. 1, pp. 392– 396. 9. Piehler, A.P., Grimholt, R.M., Ovstebo, R., et al., BMC Immunol., 2010, vol. 4, no. 11, p. 21. 10. De Maio, A., Cell Stress Chaperones, 2011, vol. 16, no. 3, pp. 235–249. 11. Lee, K.H., Jeong, J., and Yoo, C.G., Exp. Cell Res., 2013, vol. 319, no. 1, pp. 88–95. 12. Nhu, Q.M., Cuesta, N., and Vogel, S.N., J. Endotoxin Res., 2006, vol. 12, no. 5, pp. 285–295. 13. Yao, Y.W., Zhang, G.H., Zhang, Y.Y., et al., Cell Stress Chaperones, 2011, vol. 16, no. 3, pp. 287–296. 14. Akashi, S., Shimazu, R., and Ogata, H., J. Immunol., 2000, vol. 164, no. 7, pp. 3471–3475.

Translated by V. Gulevich

DOKLADY BIOLOGICAL SCIENCES

Vol. 452

2013