JOURNAL OF VIROLOGY, JUlY 1990, p. 3447-3454

Vol. 64, No. 7

0022-538X/90/073447-08$02.00/0 Copyright © 1990, American Society for Microbiology

Expression and Biochemical Characterization of Human Immunodeficiency Virus Type 1 nef Gene Product J.

KAMINCHIK,1*

N.

BASHAN,1 D. PINCHASI,' B. AMIT,1 N. SARVER,2 M. I. JOHNSTON 2 M. FISCHER,' Z. YAVIN,1 M. GORECKI' AND A. PANET'

Biotechnology General (Israel) Ltd., Kiryat Weizmann, Rehovot, 76326 Israel,' and Developmental Therapeutics Branch, Basic Research and Development Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland 208922 Received 24 January 1990/Accepted 13 April 1990

nef genes from human immunodeficiency virus type 1 isolates BH10 and LAV1 (lymphadenopathy-associated virus type 1) were expressed in Escherichia coli under the deo operon promoter. The two proteins found in the soluble compartment of the bacterial lysate were purified by ion-exchange column chromatography to apparent homogeneity. Determination of the amino-terminal sequence revealed glycine as the first amino acid in the Nef protein, indicating removal of the initiator methionine during expression in E. coli. Under native conditions, the recombinant Nef protein is a monomer of 23 kilodaltons. In denaturing polyacrylamide gels, however, BH10 and LAV1 Nef proteins migrate as 28 and 26 kilodaltons, respectively. GTP binding and GTPase activity were monitored during Nef protein purification. These activities did not copurify with the recombinant Nef protein from either the BH10 or the LAV1 isolate. Purified recombinant BH10 Nef protein was used as an immunogen to elicit mouse monoclonal antibodies. A series of monoclonal antibodies were obtained which reacted with sequences at either the amino or carboxy terminus of Nef. In addition, a conformational epitope reacting with native BH10, but not LAV1, Nef was isolated.

The human immunodeficiency virus type 1 (HIV-1) nef gene was first identified as an open reading frame of 647 base pairs, at the 3' end of the viral genome. Expression of Nef protein was demonstrated by immunoprecipitation of a 27kilodalton (kDa) protein from extracts of infected cells by antisera of patients with acquired immunodeficiency syndrome (2). Substantial sequence polymorphism has since been detected among nef genes of different HIV isolates. Amino acid variations can be as high as 17%, and, in some HIV strains, an in-frame termination codon is present within the nef coding sequence (21, 23). Nef has been reported to downregulate viral replication, since a virus isolate harboring a nonfunctional nef gene appears to replicate faster than does its nondefective counterpart (18). On the basis of these observations, it was suggested that Nef participates in maintaining viral latency by restricting transcription from the viral long terminal repeat (1, 4, 19). However, this concept should be reevaluated in light of recent results indicating no effect by Nef on transcription or on viral replication (12, 16). Sequence similarities between Nef and other guanine nucleotide binding proteins, and the finding that Nef is N-myristoylated, led to the prediction that Nef acts in conjunction with other cellular regulatory proteins in a manner similar to that of cellular G proteins (22). The idea gained support by the work of Guy et al. (10), which demonstrated that GTP binding and GTPase activity are associated with partially purified Nef protein expressed in Escherichia coli. In an attempt to establish a correlation between biochemical activities and sequence diversity, we have expressed in E. coli nef from two independent HIV-1 isolates and we have characterized the protein products. Contrary to previously published data (10), the purified protein contained neither GTP nor GTPase activity. A series of monoclonal antibodies for different epitopes and conformational specificities was *

also generated; these antibodies can be used for studying cross-immunogenicity among different isolates of Nef protein. MATERIALS AND METHODS Bacterial strains and plasmids. E. coli S0930 (deoR mutant) was used to express recombinant proteins under the E. coli deo P1-P2 promoter system (11; M. Fischer, submitted for publication). HIV isolates BH10 (19) and pBENN-16 (7), a 3' terminus subclone of a genomic LAV1 (lymphadenopathy-associated virus type 1) isolate, were the source of nef genes. The nucleotide sequences of these genes were verified after subcloning. E. coli 169A3 expressing RASH p21 protein under control of the phage lambda PL promoter was a gift from A. Levitzki (The Hebrew University, Jerusalem, Israel). The plasmid is essentially similar to that described elsewhere (17). Construction of nef expression plasmids. A 1,100-base-pair DNA fragment was isolated from the BH10 clone (20) by BamHI endonuclease digestion. nef coding sequences encompass 618 bases (nucleotides 8374 through 8992) starting with an ATG 323 base pairs downstream of the BamHI site. The DNA was subcloned in a pBR322 derivative from which the NdeI and PvuII restriction sites were removed. To facilitate insertion of the deo promoter, the plasmid was digested with XhoI (at nucleotide 8476) and EcoRI endonucleases and was ligated to a synthetic DNA linker with XhoI and EcoRI sites at the termini. The inserted linker reconstituted the 5' terminus of nef downstream of the AUG initiation codon. The region upstream of AUG contained an internal NdeI restriction site and an EcoRI site at the 5' terminus of the linker which permitted cloning. The resulting plasmid, designated pN7 (Fig. 1), was digested by PstI and EcoRV endonucleases, and the 5' terminus of nef DNA was

gel purified. The nef gene of BH10 contains an in-frame termination codon at position 8740, resulting in a truncated peptide of

Corresponding author. 3447

3448

J. VIROL.

KAMINCHIK ET AL.

Bam H I

EcoRRI

Bam HI

Nds I Xho I

EcR I SsiA

pD-NEF-2

EcoR V

D

VXhoI

EtA-EoR

V EcoR PSI

Nda I

PSI Ij

V

PI D-Y-6111WEcoR V sc I H

FIG. 1. Construction of Nef expression plasmids. Plasmid pNl is a pBR322 derivative lacking PvuII (nucleotide 2069) and NdeI (nucleotide 2899) restriction sites. The BH10 nef gene was subcloned via the BamHI site. Linker I (shown below) was used to generate an NdeI restriction site adjacent to the first ATG (underscored) of the nef gene. The linker was inserted between the EcoRI site of pBR and the XhoI site of nef in pNl (A). Linker II (shown below) was used to correct termination within the BH10 nef coding sequence. The linker contains several changes to the original sequence. (i) The termination codon in nef (position 8740) was altered to TGG (underscored) which codes for tryptophan. (ii) An EcoRI restriction site was added to the 5' terminus. (iii) The sequence GGGCCAGGG (positions 8761 through 8770) was changed to GGGCCCGGG, generating unique Apal and SmaI restriction sites. (iv) The EcoRV recognition site at the 3' terminus of the linker was abolished by changing the sequence from GAT to GGT. Plasmid pNl was digested with EcoRV and EcoRI. A DNA fragment of 4 kilobases, which contained nef sequences downstream to the EcoRV site, was gel purified and ligated to linker II (B). The two plasmids pN7 and pEF1 were digested with PstI and EcoRV, and the 5' end of nef isolated from pN7 was ligated into pEF1 (C). The deo promoter was then inserted between the PstI and NdeI sites, resulting in the BH10 Nef expression plasmid pD-Nef-2. Most of the LAV1 nef gene was isolated from pBENN-16 by XhoI and Sacl digestion and was exchanged with the corresponding fragment in pD-Nef-2. The rest was prepared as a synthetic linker (linker III) and was exchanged with the NdeI-XhoI DNA fragment of BH10 (D), yielding a LAV1 Nef expression plasmid designated pD-YN-61. Linker I: EcoRI NdeI

(5'-AATTCCATATGGGTGGCAAGTGGTCAAAAAGTAGTG TGGTTGGATGGCCTGCTGTAAGGGAAAGAATGAGACGA GCTGAGCCAGCAGCAGATGGGGTGGGAGCAGCATC-3' OH) Linker II: EcoRI EcoRV

(5'-AATTCGATATCCTTGATCTGTGGATCTACCACACACA AGGCTACTTCCCTGATTGGCAGAACTACACACCAGGGC CCGGGATCAGGT-3' OH)

122 amino acids (20, 21). To restore a full coding capacity to the gene, a synthetic oligomer, in which TGG (tryptophan) replaced the TAG terminator, was synthesized. The oligomer contained an EcoRI cohesive sequence at its 5' terminus and a substituted EcoRV site (GGT) at the 3' end. ApaI and SmaI restriction sites were incorporated within the linker by replacing the sequence GGGCCAGGG (nucleotides 8761 through 8770) with GGGCCCGGG. All changes were made without modifying the amino acid coding capacity of nef. The linker was inserted between the EcoRI-EcoRV sites of pNl, yielding pEF1. Construction of the contiguous nef gene and insertion of the deo promoter are depicted in Fig. 1. Briefly, pEF1 was linearized by PstI and EcoRV endonucleases and the 5' end of nef (EcoRV-NdeI fragment), isolated from pN7, was ligated along with the deo promoter (PstI-NdeI restriction fragment isolated from plasmid pMF5534; M. Fischer, unpublished data). The resulting plasmid, pD-Nef-2, was used to express BH10 Nef protein. To construct the LAV1 nef expression vector, the plasmid pD-Nef-2 was first digested with XhoI and Sacl endonucleases and the nef region between those sites was exchanged with the corresponding pBENN-16 sequences. A synthetic DNA sequence upstream of the XhoI restriction site was prepared and ligated between the XhoI and NdeI restriction sites, yielding the plasmid pD-YN-61 (Fig. 1). The nef sequence in each construct was verified by dideoxynucleotide sequencing. Purification of Nef. An E. coli pellet (20 g) was suspended in 400 ml of 50 mM Tris buffer (pH 8.0) containing 50 mM NaCl, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, and 10% glycerol (wt/wt). Cells were treated with 0.5 mg of lysozyme per ml for 15 min at 4°C and were disrupted by sonication. Nef was precipitated from clarified supernatant by slow addition of ammonium sulfate to a final concentration of 250 mg/ml. The solution was stirred at 4°C for 1 h and centrifuged for 1 h at 10,000 x g. Precipitates were suspended in 800 ml of 20 mM Tris buffer (pH 7.6) containing 1 mM EDTA, passed through a 0.45-,um-pore-size filter, and loaded onto a Q-Sepharose column (30 by 50 cm; Pharmacia) equilibrated with 20 mM Tris (pH 7.6)-i mM EDTA. Unbound material was removed with equilibration buffer. Bound proteins were eluted stepwise by increasing concentrations of NaCl in equilibration buffer. Nef was eluted at 200 mM NaCl. The Nef-enriched Q-Sepharose fractions were further purified as follows: the LAV1 Nef protein was dialyzed against 1 mM Tris (pH 7.6) containing 0.5 mM EDTA and 5 mM NaCl, diluted in equilibration buffer (50 mM sodium acetate [pH 6.0], 0.5 mM EDTA), and then loaded onto a CM-Sepharose column (30 by 26 cm; Pharmacia) equilibrated in the same buffer. Nef protein was eluted from the column at increasing NaCl concentrations. BH10 Nef fractions were diluted in phenyl-Sepharose equilibration buffer (20 mM Tris (pH 7.4), 1 mM EDTA, 0.6 M ammonium sulfate) and loaded onto a phenyl-Sepharose column (2.6 by 18.5 cm; Pharmacia) equilibrated with the same buffer. Elution was done with 0.36 M ammonium sulfate. The purity of the Nef proteins was determined by sodium dodecyl Linker III:

NdeI (5'-TATGGGTGGCAAGTGGTCAAAAAGTAGTGTGGTTGG ATGGCCAACTGTAAGGGAAAGAATGAGACGAGCTGAGC CAGCAGCAGATGGGGTGGGAGCAGCATC-3' OH)

CHARACTERIZATION OF HIV Nef

VOL. 64, 1990

KD

1

94

2

.

3

.

,.. .i

67

4

3449

5

..

0 .10

m

X

MT W 0.4

C

0.5

~~~~~~~Kav

0.6

0

43

-

..Nmlmk.

.ww-

0.04 o0

wow 0.0

30

AP-,-.IV? ...p

20

-

FIG. 2. Gel electrophoresis of bacteria expressing Nef lysates and purified Nef protein. Bacteria expressing BH10 Nef (lane 2) or LAV1 Nef (lane 3) protein were grown in a 2-liter fermentor in minimal medium to an optical density of 0.2 (at 600 nm). Cells were pelleted, lysed, and analyzed on an SDS-12.5% polyacrylamide gel and stained with Coomassie blue. Purified BH10 Nef (4 ,ug) (lane 4) and LAV1 Nef (20 ,ug) (lane 5), prepared as described in Materials and Methods, were also included on the gel. Molecular size protein markers are shown in lane 1.

sulfate (SDS)-polyacrylamide gel electrophoresis (Fig. 2) and fast performance liquid chromatography gel filtration through Superose 12 (Fig. 3). Production of anti-Nef monoclonal antibodies. Female BALB/c mice were inoculated subcutaneously with 50 ,ug of purified recombinant BH10 Nef protein emulsified in complete Freund adjuvant. Fifteen days later, a second injection of Nef in incomplete Freund adjuvant was administered. Five days after the second injection, the mice were bled and titers of anti-Nef antibodies were determined by solid-phase enzyme-linked immunosorbent assay (ELISA). Hyperimmune animals were boosted 2 weeks after the second inoculum by an intraperitoneal injection of 50 ,ug of Nef in 0.5 ml of saline. Fusion of splenic lymphocytes (1 x 108) with myeloma cells (2 x 107) (line P3-NS1/1-Ag4-1; 8) was performed by addition of polyethylene glycol to 50% and plating the cells in a 24-well Costar culture plate in the presence of superHAT (hypoxanthine-aminopterin-thymidine) medium (15). Supernatant solutions from the growing hybridomas were screened for antibody production 10 days later by solidphase ELISA. Positive lines were further cloned by repeated limiting dilutions, and hybridoma clones were used for production of ascitic fluids in mice. Solid-phase ELISA. Microdilution culture plates (96 wells; Costar) were precoated with 0.1 ml of a 1-mg/ml aqueous solution of poly-L-lysine hydrobromide (molecular weight, 75,000 to 150,000) for 30 min at room temperature. Nonattached poly-L-lysine was removed and 0.5 pug of recombinant Nef in phosphate-buffered saline (PBS) (100 ,ul) was added into each well and incubated for 1 h at 37°C. The plates were centrifuged at 3,000 rpm for 10 min, excess antigen was discarded, and the wells were treated with 100 ,ul of PBS containing 1% skim milk for 30 min at

Retention Time (min) FIG. 3. Analysis of recombinant Nef protein by fast performance liquid chromatography gel filtration. Purified BH10 Nef (1 mg/ml) (---) and LAV1 Nef (0. 5 mg/ml) (---) protein in 20 mM Tris (pH 7.8)-150 mM NaCl were analyzed by chromatography through a Superose 12 column (Pharmacia). The protein profile was generated by continuous monitoring at 280 nM. The molecular size of Nef under native conditions was determined from a standard curve (insert) as follows: Marker proteins, bovine serum albumin (BSA) (1 mg/ml, 67 kDa) myoglobin from horse heart (2 mg/ml; 17.8-kDa and 35.6-kDa dimers) were chromatographed separately through the same column. The Ka, value of the column was determined from the formula Kav = (t, - t,,)I(t, - to), where to, equals time of void volume, tc equals time of column volume, and te equals retention time for each of the proteins on the column.

by 5 to 10 rinses of 0.05% Tween 20 in PBS plus 0.05%o Tris (TBS). Supernatants collected from hybridomas or PBS dilutions of ascitic fluids (100 ,ul) were placed into each well and incubated for 1 h at 37°C. Biotinylated anti-mouse antibody (100 ,ul at a dilution of 1:1,000 in TBS containing 15% skim milk) was added to each well and, after being incubated for an additional hour at 37°C, was rinsed as described above. ExtrAvidin peroxidase (100 ,uLl; BioMakor Israel) at a dilution of 1: 1,000 in PBS was added to the wells and incubated for 30 min at room temperature. After the plates were washed, the substrate solution (200 ,ul) of 2,2'azidoroom temperature followed

di-(3-ethylbenzthiazoline sulfonate) (ABTS) (1 mM)-H202 (0.002% [vol/vol]) in phosphate-citrate buffer (pH 4.3) was added to each well. After 30 min of incubation at 37°C, the reactions were stopped with 0. 1 M citric acid and the A405 of the plates was read in an ELISA reader. CNBr digestion of recombinant Nef. Nef protein (1 mg/ml) in PBS was adjusted to 2% CNBr-70% formic acid and was incubated for 16 h at room temperature (25). The digest was lyophilized and suspended in PBS. Analysis of peptides was carried out by elution from a reverse-phase high-pressure liquid chromatography (HPLC) column (PRO RPC RP8 300A; Pharmacia) with a linear gradient of acetonitrile (0 to 60%) in 0.1% trifluoroacetic acid and by separation on SDS-12% polyacrylamide gel. GTP binding. GTP binding assay was carried out as described previously (9) with the following modifications:

3450

J. VIROL.

KAMINCHIK ET AL.

the concentration of MgCI2 was reduced to 1 mM, and unlabeled ATP was added to a final concentration of 2.5 mM to suppress nonspecific binding. The assay (40 Rd) contained 80 mM Tris (pH 8.0), 100 mM NaCl, 1 mM MgCl2, 0.5 mg of bovine growth hormone (added as a protein carrier) per ml, 15 pmol of [y-35S]ThioGTP (8.3 x 104 cpm/pmol), and either 2 to 8 ,ug of crude bacterial lysate or samples collected during protein purification. Duplicate reactions were incubated for 20 min at 37°C and were filtered through nitrocellulose filters (0.45-,um pore size; Schleicher & Schuell). Filters were washed with 10 ml of 80 mM Tris (pH 8.0-100 mM NaCI-1 mM MgCl2, dried, and counted. Bacterial lysates were prepared from 10-ml cultures. Bacterial pellets were suspended in 2 ml of 20 mM Tris (pH 7.5)-0.1 mM EDTA-1 M MgCl2-0.1 mM ATP-1 mM 1Bmercaptoethanol, and 0.5 mg of fresh lysozyme was added. After incubation on ice for 30 min, phenylmethylsulfonyl fluoride (1 mM) was added to the samples and the bacteria were lysed by sonication. Debris were removed by centrifugation, and the protein concentration was determined by the method of Bradford (3). GTPase activity. GTPase activity was measured by the method of Hattori et al. (13) with minor modifications. The reaction mixture (20 Pld) contained 80 mM Tris (pH 8.0), 5 mM MgCl2, 0.5 mg of bovine growth hormone as protein carrier, 1 FM [-y-32PIGTP (105 cpm/pmol), 2.5 mM ATP, and 3-ul- samples containing 0.1 to 2 ,ug of protein. Reactions in duplicates were incubated at 37°C as indicated in the text. The inorganic phosphate byproduct was determined as described previously (5). Acid-washed charcoal (Norit A) in 10% trichloroacetic acid (1 ml) was added, and samples were left on ice for 10 min, filtered through nitrocellulose filters, and counted. Zero-time reaction mixtures, from which MgCl2 was omitted, were used as background and were subtracted from all subsequent time points. Protein sequencing. The amino-terminal sequence of recombinant Nef was determined by Edman degradation by using an Applied Biosystems (model 470A) gas-phase protein sequencer (14), followed by HPLC to monitor the phenylthiohydantoin of the cleaved amino acid residues.

RESULTS Expression of Nef in E. coli. Nef proteins from different HIV isolates exhibit a high degree of amino acid heterogeneity confined to distinct domains (21). To identify potential biochemical variations in different Nef proteins, two HIV-1 isolates, BH10 and LAV1, were compared. The BH10 nef gene contains a premature termination codon, and the protein is presumed to be inactive. The LAV1 Nef protein was reported to possess GTP binding and GTPase activities (10). Except for the termination codon, the two Nef proteins differ in seven amino acids (20, 21). Comparison of the nef gene sequence of several HIV isolates revealed that the in-frame TAG termination codon in BH10 (nucleotides 8740 through 8742) is replaced by TGG (tryptophan) in other strains. A TGG triplet was therefore incorporated instead of TGA in the synthetic oligomer designed for site-directed mutagenesis of BH10 nef. The construction of nef expression vector (pD-Nef-2) and the replacement of BH10 nef gene with the nef gene of the LAV1 plasmid pBENN-16 (pD-YN-61) are illustrated in Fig. 1. The two nef plasmids were introduced into E. coli S0930 lacking deoR repressor (M. Fischer, unpublished data). This genetic background supports constitutive expression of recombinant proteins from the combined deo promoters.

TABLE 1. Purification of recombinant LAV1 Nef from W. coli lysatea Purification step

Nef recovery (%

Nef purity Recovery ofToa (%) .(Nef! GTPase in recovtotal pro- Nef fc- ery of GTPase tion (% teins)

80 (80 mg) 14 (80 mg/ 576 mg) Q-Sepharose column 52 28 CM-Sepharose column 46.6 86

Ammonium sulfate

48.8

80

21.0 0

100 72

a Nef purification is described in Materials and Methods. Recovery and purity of Nef protein were determined by photometric scan of Coomassie blue-stained SDS-polyacrylamide gels. The material was assayed for Mg+dependent GTPase activity before being loaded onto the column, and each fraction of the chromatography was also assayed. GTPase activity (picomoles of Pi released in 20 min by 1 p.g of protein) in each fraction was used to compute total GTPase recovery and recovery in Nef-enriched fractions after every purification step.

Nef expression was analyzed by electrophoresis of bacterial lysate protein on SDS-polyacrylamide gels and photometric scans of Coomassie blue-stained gels. Recombinant Nef constituted up to 40% of the total bacterial protein and was confined mainly to the soluble fraction of the bacterial lysate. The recombinant Nef proteins migrate on SDSpolyacrylamide gels faster than does the 30-kDa protein marker (Fig. 2). A difference in migration rates between BH10 Nef (lanes 2 and 4) and that of LAV1 (lanes 3 and 5) is apparent. Since the two nef genes were sequenced and found to be identical in length, the difference in electrophoretic migration rates may be attributed to a variation in amino acid

composition. Purification of recombinant Nef proteins. The purification of the LAV1 Nef protein is summarized in Table 1. Following chromatography on Q-Sepharose and CM-Sepharose columns, the preparation contained 86% Nef. We tried replacing the CM-Sepharose with a phenyl-Sepharose column, which gave better results (95% purity) in the purification of the BH10 Nef protein. However, LAV1 Nef eluted from phenyl-Sepharose as a broad peak with no significant improvement in purity. Electrophoretic analysis of purified BH10 Nef (lane 4) and LAV1 Nef (lane 5) is presented in Fig. 2. Some minor protein bands are evident; however, only 28-kDa BH10 Nef and 26-kDa LAV1 Nef could be precipitated by anti-Nef antibodies, indicating that the minor contaminants are of bacterial origin. Chemical and physical characteristics of the recombinant Nef proteins were further analyzed by amino acid sequencing and fast performance liquid chromatography gel filtration. Protein sequencing of the BH10 Nef amino terminus revealed the sequence NH2Gly-Gly-Lys-Trp-Ser-Lys-Ser-Ser-Val-Val-Gly-Trp-Pro-AlaVal. This amino acid sequence corresponds to the sequence of the nef gene (21) and indicates efficient removal of the first methionine by an E. coli aminopeptidase. Fast performance liquid chromatography on a Superose 12 column (Pharmacia) revealed that, under native conditions, the two recombinant Nef proteins migrate as monomers of 23 kDa (Fig 3). The molecular weight determined by fast performance liquid chromatography is in agreement with that computed from the amino acid residues (i.e., 23,442). These proteins are not myristoylated, as was expected for expression in E. coli. Epitope mapping of Nef by monoclonal antibodies. Nef contains three methionine residues (positions 20, 79, and 173) which are potential cleavage sites for CNBr. Purified BH10 Nef protein was subjected to limited CNBr digestion

VOL. 64,

CHARACTERIZATION OF HIV Nef

1990

TABLE 2. Binding of monoclonal antibodies to Nef and CNBr cleavage products

A Met

Met

Met

COOH

NH21 20

1

3451

79

173

1

Peak no.

Amino acid sequence

NFlA1

1-19 20-78 79-172 173-206 Intact BH10 Nef Intact LAV1 Nef

0.20 0.19 0.25 (+) 0.26 (+) 0.61 (+)

207

Nef

B

I II III IV

0.19

A405 Of:a NF2B2 NF8D4

0.15 0.39(+) 0.19 0.17 2.19 (+) 2.09 (+)

0.16 0.18 0.19 0.15 2.22 (+) 0.18

NF3A3

0.24 0.28(+) 0.21 0.23 0.29 (+) 0.44 (+)

a Monoclonal antibody preparations and solid-phase ELISA are described in Materials and Methods. Ascitic fluids from mice bearing the four hybridoma cells were Nef positive in solid-phase ELISA at the following end-point dilutions: NF2B2, 1:20,000; NF8D4, 1:50,000; NFlA1 and NF3A3, 1:5,000. The actual dilutions used in the above experiment were as follows: NFlA1 and NF3A3, 1:200; NF2B2 and NF8D4, 1:10,000. The absorbance of the ELISA plates was read in an ELISA reader at 405 nm. The analysis was repeated several times and values above 0.240 are significantly positive (boldface numbers).

E c

0

CD

Coi

.0

0

,

0

,

10

20

,

,

30

,

40

50

Retention Time (min.)

FIG. 4. Chromatography of CNBr cleavage products of BH10 Nef. The putative CNBr cleavage sites in BH10 Nef protein are shown (A). The three methionine residues (Met) in the molecule are numbered relatively to the first glycine (1) in the mature protein. HPLC column chromatography was used to separate the CNBr degradation products (B). Recombinant BH10-Nef was cleaved with CNBr as described in Materials and Methods. Cleavage products were loaded onto a PRO RPC RP8 300A HPLC column and eluted at a flow rate of 0.7 ml/min with a linear gradient (0 to 60%) of acetonitrile in 0.1% trifluoroacetic acid. To assign each peptide (I through IV) to its location in the protein, each peak was collected separately and was analyzed by protein gel electrophoresis. Peptide I corresponds to amino acids 1 through 19, II to 20 through 78, III to 79 through 172, and IV to 173 through 206.

and was resolved by reverse-phase HPLC column as described in Materials and Methods. Under these conditions, 30% of Nef was cleaved into four peptides which migrated faster than did the uncleaved Nef protein on an RP8 HPLC column (Fig. 4). The eluted peptides were collected individually and assayed for reactivity with Nef monoclonal antibodies. The size of each peptide, assigned by electrophoresis on an SDS-polyacrylamide gel (data not shown), was in agreement with that predicted from the distribution of methionine residues in the protein (molecular weights for the peptides: I, 2,090; II, 6,490; III, 10,340; and IV, 3,740). Monoclonal antibodies NFlAl, NF2B2, NF3A3, and NF8D4 were tested for their ability to react with Nef protein and with purified Nef CNBr-peptides in solid-phase ELISA (Table 2). As expected, all monoclonal antibodies tested reacted with the intact BH10 Nef protein. NF8D4 was the only antibody which did not react with any of the CNBr

cleavage products, suggesting that the antibody is directed against a conformational structure in the native protein rather than a primary sequence. Except for NF8D4, each monoclonal antibody reacted equally well with Nef of the two isolates BH10 and LAV1. NF8D4 antibody, which was active against intact BH10 Nef, gave negative results with LAV1 Nef, further supporting its specificity in recognizing

the conformational structure of the native protein. NF2B2 and NF3A3 reacted with peptides derived from the amino terminus of Nef (Table 2), while NFlA1 reacted with a peptide derived from the carboxy terminus. No monoclonal antibody was found to react with a peptide derived from the middle portion of Nef (amino acids 80 through 173). It should be noted that NFlA1 and NF3A3 antibodies are of low affinity, and, therefore, ELISA values were relatively low. However, they gave significantly positive values in several repeated experiments. GTP binding and GTPase activity of recombinant Nef. The biochemical activities of Nef and a well-characterized G protein, RASH p21, were compared with respect to their GTP binding and GTPase activities. Total soluble protein from bacterial cells expressing either Nef or RASH p21 was assayed for GTP binding. Soluble lysates from the parental strain S0930 and uninduced RASH p21-169A3 cells were included as controls (Fig. 5). On the basis of SDS-polyacrylamide gel electrophoresis and scanning of the Coomassie blue-stained gels, the amounts of Nef and RASH p21 proteins in the soluble fractions of the bacterial lysates were found to be 40% (BH10), 20% (LAV1), and 5% (RASH p21). Since equal amounts of lysate protein were added to the GTP binding assays, the quantity of Nef in each sample was fourto eightfold greater than that of RASH p21. Nevertheless, only low levels of GTP binding could be detected in Nefcontaining lysates (data not shown). This low binding activity was completely abolished upon addition of 2.5 mM ATP (Fig. 5). In contrast, significant amounts of GTP were bound to RASH p21 and ATP had no effect upon GTP binding, indicating the specificity of RASH p21 for GTP (Fig. 5). High GTPase activity was present in all extracts, including those from the parental bacterium S0930 and uninduced RASH p21-169A3 cells. This high endogenous GTPase activity obscured any increase in RASH p21 GTPase subsequent to heat induction. GTP binding and GTPase activity were assayed at each step of the Nef purification process (Fig. 6; Table 1). No GTP binding was observed in Nef-enriched fractions, which is consistent with the results obtained with crude lysates. The GTPase activity measured in bacterial lysates expressing Nef did not copurify with the recombinant protein. Total GTPase activity and GTPase activity associated with Nefenriched fractions were monitored during purification. While total GTPase was recovered after each step, the activity associated with Nef declined (Table 1). Purified Nef of either

3452

J. VIROL.

KAMINCHIK ET AL. 2

D

75

1.5 -a

-5 E

E

1 (D

Ca Ca

cm

.5

0.5 C

CD

1 0.6

0

E 0

co N

x

E

0.4

.:t52:

a 0

0 o

0

< 0.2

0

0~co t-

Oco pD S0930 pD-Nef-2 pDYN-6169A3OO 169A3/42° FIG. 5. GTP binding and GTPase activity of crude bacterial lysates. GTP binding (stippled bars) and Mg2"-dependent GTPase activity (open bars) are shown. All reaction mixtures (except controls) containing 8 jig of clarified bacterial lysates were incubated at 37°C for 20 min (binding assays) or 30 min (GTPase assays). Mg2+-dependent GTPase activity was calculated from duplicate samples by substracting the activity obtained without Mg2+. Designations: Control, samples without bacterial lysate; S0930, parental E. coli strain; pD-Nef-2, S0930 cells harboring BH10 Nef expression plasmid pD-Nef-2; pD-YN-61, S0930 cells harboring LAV1 Nef expression plasmid pD-YN-61; 169A3/30°C, E. coli cells harboring RASH p21 expression plasmid grown at 30°C (uninduced); 169A3/42°C, E. coli harboring RASH p21 plasmid grown at 30°C up to an optical density of 0.8 and then induced for RASH p21 expression (2 h at 42°C). BH10 or LAV1 had no apparent GTP binding or GTPase activity. In a previously published work (10), Nef protein expressed in E. coli was sequestered in insoluble inclusion bodies and partial purification was facilitated by solubilization with SDS. To test whether SDS denaturation followed by refolding caused reactivation of Nef, purified Nef was treated with 0.2% SDS for 30 min. SDS was removed by precipitation with KCI (75 mM) and centrifugation in an Eppendorf centrifuge. The supernatant was dialyzed extensively against 10 mM sodium phosphate buffer (pH 7.4) and was assayed for GTPase activity. This treatment, however, did not result in reactivation of the recombinant Nef protein (data not shown). DISCUSSION The observations that some infectious isolates of HIV contain an in-frame termination codon within the nef gene and the findings that expression of nef suppresses HIV replication have led to the hypothesis that Nef protein is a negative regulator of HIV replication (1, 4, 18, 19, 24). To study the biochemical characteristics of this protein, the corresponding genes of two virus isolates (BH10 and LAV1) were expressed in E. coli and procedures for the purification of recombinant Nef were developed. Amino acid sequence analysis of the recombinant Nef has established the amino terminus Gly Gly Lys Trp Ser, which is identical to the predicted sequence based on nef codons. Lack of initiator methionine indicates efficient removal by an E. coli aminopeptidase. The sequence also conforms to the consensus signal for protein amino-terminal myristoylation in eucaryotic cells (26). Indeed, myristoylation of Nef has been demonstrated by expression of the gene in mammalian cells

(10). Sequence polymorphism among nef genes from independent HIV-1 isolates was previously described (21). How-

1

'D 0

1

-j

,2 1l3 4L5 Fraction No.

6

117 L8

co

0 >C 0

1 6 0.6

g

CD

SP E

0

0 CD

~ .4

0

I9-

05Z

0.2

laI 0

9

I1.

,,2

, 3 LJ 4ILjL6JLL 7 L

8 L

~~~~~Fraction No.

FIG. 6. Purification of LAV1 Nef protein by ion-exchange chromatography. (A) Q-Sepharose column; (B) CM-Sepharose column. Columns were developed by an NaCl step gradient (broken line), and the column fraction absorbance profile at 280 nm was recorded (solid line). Mg2+-dependent GTPase activity was assayed on each fraction (hatched bars). The Q-Sepharose column was loaded with Nef fraction after ammonium sulfate precipitation (see Table 1). Samples of column fractions were analyzed by SDS-polyacrylamide gel electrophoresis, and fraction number 6 (eluted at 200 mM NaCl) was found to be enriched with Nef protein. For further purification, fraction number 6 was applied to CM-Sepharose and a peak of Nef was eluted at 100 mM NaCl, as detected by SDS-polyacrylamide gel electrophoresis (Fig. 2, lane 5).

ever, no experimental evidence exists documenting any structural or functional differences among different Nef proteins. By generating a monoclonal antibody with specificity to native BH10, but not to LAV1, Nef, we were able to confirm the existence of structural differences between the two proteins. The availability of monoclonal antibodies against structural and conformational epitopes enables further exploration of Nef cellular compartmentalization and may shed light on its possible site of action. Close examination of nef open reading frames in both BH10 and LAV1 virus isolates reveals certain homologies with the GTP binding domain of G proteins (6). In G proteins, the GTP binding sequence is composed of the following three elements: (i) Gly X X X X Gly Lys, (ii) Asp X X Gly, and (iii) Asn Lys X Asp, with a consensus spacing of 40 to 80 amino acids between the first and second and between the second and third sequence elements. The first consensus element in Nef is Gly Phe Cys Tyr Lys Met Gly Gly Lys, located at amino acids -5 to +4 with respect to the initiator Met at position +1 (22). This sequence, however, contains nine amino acids, including the initiator Met at position +1, rather than the standard seven amino acids. To

CHARACTERIZATION OF HIV Nef

VOL. 64, 1990

include this putative element in the protein, translation ought to initiate upstream of Met at position +1. However, no ATG start codon is present within the 30 nucleotides (8344 to 8374; 20) upstream of the open reading frame. In addition, as the only myristoylation consensus signal in the nef open reading frame is adjacent to Met at position + 1, it is the most likely initiation site for nef translation. The second and third putative GTP binding elements are located at positions 28 through 31, Asp Gly Val Gly, and positions 157 through 160, Asn Lys Gly Glu. The latter sequence deviates from the consensus element Asn-Lys-X-Asp, which is conserved in most known G proteins. Thus, Nef sequences which exhibit some similarity to other G proteins do not conform well to the standard arrangement of GTP binding domain. To analyze the recombinant Nef for G-protein activities, Nef was compared with a well-characterized G protein, RASH p21. No increase in GTP binding was observed in bacteria expressing recombinant Nef. Furthermore, GTPase activity present in the crude bacterial extracts did not copurify with recombinant Nef. In contrast, extracts of bacteria expressing recombinant RASH p21 exhibited a 10-fold increase in GTP-binding activity. This was observed in spite of the lower expression levels of RASH p21 relative to Nef. In a previous work, the nef gene of a LAV1 virus isolate was expressed in E. coli and the recombinant protein was found sequestered in insoluble inclusion bodies (10). To facilitate partial purification of the recombinant protein, it was solubilized in SDS. Following removal of the detergent, GTP binding and GTPase activity were detected in the soluble fraction (10). Although the recombinant Nef described in this work was soluble and in monomeric form, similar reactivation attempts failed to result in active protein; no apparent GTP binding or GTPase activity was associated with the purified Nef after such treatment. Several possibilities may account for the differences between the data presented in this work and those described by others (10): (i) bacterial protein impurities present in a partially purified recombinant Nef preparation; (ii) different modes of expression in E. coli which resulted in a soluble monomeric Nef in our studies and in an insoluble protein in the work of Guy et. al. (10), which potentially affect the GTPase and GTP binding activities; (iii) different Nef aminoterminal sequence in the recombinant Nef protein, resulting from initiation at a putative start codon other than the authentic AUG (position 8374); and (iv) different nucleotide sequences in the cloned nef gene in the two studies, resulting in different amino acid sequences. In summary, the biochemical function of Nef, specifically regarding its G-protein-like functions, needs to be reevaluated in light of this work. Further, the availability of recombinant Nef protein and immunological reagents may facilitate resolution of the controversial role of Nef in HIV

replication (12, 16). ACKNOWLEDGMENTS We thank M. Tabachnik for assistance in the DNA sequencing of all of the nef clones, M. Azmon for the fermentation of Nefexpressing bacteria, and L. Nir for typing the manuscript. This work was supported by Public Health Service contract NO1-AI-82696 of the National Institute of Allergy and Infectious

Diseases. LITERATURE CITED 1. Ahmad, N., and S. Venkatesan. 1988. Nef protein of HIV-1 is a transcriptional repressor of HIV-1 LTR. Science 241:1481-1485.

3453

2. Allan, J. S., J. E. Coligan, T. H. Lee, M. F. McLane, P. J. Kanki, J. E. Groopman, and M. Essex. 1985. A new HTLVIII/LAV encoded antigen detected by antibodies from AIDS patients. Science 230:810-813. 3. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254. 4. Cheng-Mayer, C., P. lannello, K. Shaw, P. A. Luciw, and J. A. Levy. 1989. Differential effects of Nef on HIV replication: implications for viral pathogenesis in the host. Science 246: 1629-1632. 5. DePierre, J. W., and M. L. Karnovsky. 1974. Ecto-enzymes of the guinea pig polymorphonuclear leukocyte. J. Biol. Chem. 249:7111-7120. 6. Dever, T. E., M. J. Glynias, and W. C. Merrick. 1987. GTPbinding domain: three consensus sequence elements with distinct spacing. Proc. Natl. Acad. Sci. USA 84:1814-1818. 7. Folks, T., S. Benn, A. Rabson, T. Theodore, M. D. Hoggan, M. Martin, M. Lightfoote, and K. Sell. 1985. characterization of a continuous T-cell line susceptible to the cytopathic effects of the

acquired immunodeficiency syndrome (AIDS)-associated retrovirus. Proc. Natl. Acad. Sci. USA 82:4539-4543. 8. Galfre, G., S. C. Howe, C. Milstein, G. W. Butcher, and J. C. Howard. 1977. Antibodies to major histocompatibility antigens produced by hybrid cell lines. Nature (London) 266:550-552. 9. Gibbs, J. B., I. S. Sigal, M. Poe, and E. M. Scolnick. 1984. Intrinsic GTPase activity distinguishes normal and oncogenic ras p21 molecules. Proc. Natl. Acad. Sci. USA 81:5704-5708. 10. Guy, B., M. P. Kieny, Y. Riviere, C. Le Peuch, K. Dott, M. Girard, L. Montagnier, and J. P. Lecocq. 1987. HIV F/3' orf encodes a phosphorylated GTP-binding protein resembling an oncogene product. Nature (London) 330:266-269. 11. Hammer-Jesperson, K. 1983. Nucleoside catabolism, p. 203208. In A. Much-Petersen (ed.), Metabolism of nucleotides, nucleosides and nucleobases in microorganisms. Academic Press, Inc. (London), Ltd., London. 12. Hammes, S. R., E. P. Dixon, M. H. Malim, B. R. Cullen, and W. C. Greene. 1989. Nef protein of human immunodeficiency virus type 1: evidence against its role as a transcriptional inhibitor. Proc. Natl. Acad. Sci. USA 86:9549-9553. 13. Hattori, S., L. S. Ulsh, K. Halliday, and T. Y. Shih. 1985. Biochemical properties of a highly purified v-rasH p21 protein overproduced in Escherichia coli and inhibition of its activities by a monoclonal antibody. Mol. Cell. Biol. 5:1449-1455. 14. Hunkapiller, M. 1985. PTH amino acid analysis. Appl. Biosystems User Bull. 14:1-27. 15. Kennett, R. H., K. H. Davis, A. S. Tung, and N. R. Klinman. 1978. Hybrid plasmacytoma production: fusion with adult spleen cells, monoclonal spleen fragment, neonatal spleen cells, and human spleen cells. Curr. Top. Microbiol. Immunol. 81: 77-91. 16. Kim, S., K. Ikeuchi, R. Byrn, J. Groopman, and D. Baltimore. 1989. Lack of a negative influence on viral growth by the nef gene of human immunodeficiency virus type 1. Proc. Natl. Acad. Sci. USA 86:9544-9548. 17. Lacal, J. C., E. Santos, V. Notario, M. Barbacid, S. Yamazaki, H.-F. Kung, C. Seamans, S. McAndrew, and R. Crowl. 1984. Expression of normal and transforming H-ras genes in Escherichia coli and purification of their encoded p21 proteins. Proc. Natl. Acad. Sci. USA 81:5305-5309. 18. Luciw, P. A., C. Cheng-Mayer, and J. A. Levy. 1987. Mutational analysis of the human immunodeficiency virus: the orf-B region down-regulates virus replication. Proc. Natl. Acad. Sci. USA 84:1434-1438. 19. Niederman, T. M. J., B. J. Thielan, and L. Ratner. 1989. Human immunodeficiency virus type 1 negative factor is a transcriptional silencer. Proc. Natl. Acad. Sci. USA 86:1128-1132. 20. Ratner, L., W. Haseltine, R. Patarca, K. J. Livak, B. Starcich, S. F. Josephs, E. R. Doran, J. A. Rafalski, E. A. Whitehorn, K. Baumeister, L. Ivanoff, S. R. Petteway, Jr., M. L. Pearson, J. A. Lautenberger, T. S. Papas, J. Ghrayeb, N. T. Chang, R. C. Gallo, and F. Wong-Staal. 1985. Complete nucleotide sequence of the AIDS virus, HTLV-III. Nature (London) 313:277-284.

3454

KAMINCHIK ET AL.

21. Ratner, L., B. Starcich, S. F. Josephs, B. H. Hahn, E. P. Reddy, K. J. Livak, S. R. Petteway, Jr., M. L. Pearson, W. A. Haseltine, S. K. Arya, and F. Wong-Staal. 1985. Polymorphism of the 3' open reading frame of the virus associated with the acquired immune deficiency syndrome, human T-lymphotropic virus type III. Nucleic Acids Res. 13:8219-8229. 22. Samuel, K. P., A. Seth, A. Konopka, J. A. Lautenberger, and T. S. Papas. 1987. The 3'-orf protein of human immunodeficiency virus shows structural homology with the phosphorylation domain of human interleukin-2 receptor and the ATP-binding site of the protein kinase family. FEBS Lett. 218:81-86. 23. Sodroski, J., W. C. Goh, C. Rosen, A. Tartar, D. Portetelle, A. Burny, and W. Haseltine. 1986. Replication and cytopathic potential of HTLV-III/LAV with sor gene deletions. Science 231:1549-1553.

J. VIROL. 24. Terwilliger, E., J. G. Sodroski, C. A. Rosen, and W. A. Haseltine. 1986. Effects of mutations with the 3' orf open reading frame region of human T-cell lymphotropic virus type III (HTLV-III/LAV) on replication and cytopathogenicity. J. Virol. 60:754-760. 25. Tisdale, M., P. Ertl, B. A. Larder, D. J. M. Purifoy, G. Darby, and K. L. Powell. 1988. Characterization of human immunodeficiency virus type 1 reverse transcriptase by using monoclonal antibodies: role of the C terminus in antibody reactivity and enzyme function. J. Virol. 62:3662-3667. 26. Towler, D. A., S. P. Adams, S. R. Eubanks, D. S. Towery, E. Jackson-Machelski, L. Glaser, and J. I. Gordon. 1988. Myristoyl CoA: protein N-myristoyltransferase activities from rat liver and yeast possess overlapping yet distinct peptide substrate specificities. J. Biol. Chem. 263:1784-1790.