Appl Biochem Biotechnol DOI 10.1007/s12010-015-1627-x

Expression and Characterization of the Extracellular Domain of Human HER2 from Escherichia Coli, and Production of Polyclonal Antibodies Against the Recombinant Proteins Yong Sun 1 & Xue Feng 2 & Jiao Qu 1 & Wenqi Han 1 & Zi Liu 1 & Xu Li 2 & Ming Zou 2 & Yuhong Zhen 1 & Jie Zhu 3

Received: 23 November 2014 / Accepted: 8 April 2015 # Springer Science+Business Media New York 2015

Abstract Human epidermal growth factor receptor 2 (HER2) is a member of the epidermal growth factor receptor (EGFR) family. In this study, the whole extracellular domain gene of HER2 was amplified by RT-PCR from human breast cancer cell line SK-BR-3. The genes of membrane-distal region (A) and membrane proximal region (B) of HER2 extracellular domain were amplified from the cloned template, and then inserted into the expression vector pET-28a and pET-30a, respectively. The recombinant expression vectors were transformed into Escherichia coli BL21 (DE3) cells and induced by isopropyl-b-Dthiogalactopyranoside (IPTG) for expression of proteins His-A and His-B. The expressed proteins were detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) and western blot. The optimization of culture conditions led us to accomplish the recombinant protein induction with 1.0 mM IPTG at 37 °C for 8 h, and both proteins were expressed in the insoluble form. Both proteins were purified under the denaturing condition using Ni-NTA sepharose column. Balb/c mice were immunized with the purified proteins and then effectively produced polyclonal antibodies, which reached to a relatively high titer by ELISA testing and had good specificity by western blot detection. The HER2 ECD proteins His-A and His-B could be expressed in E. coli and were suitable for production of high titer antibodies against HER2 ECD.

* Yuhong Zhen [email protected] * Jie Zhu [email protected] 1

College of Pharmacy, Dalian Medical University, Dalian, Liaoning Province, China

2

Affiliated Zhongshan Hospital of Dalian University, Dalian, Liaoning Province, China

3

The Second Affiliated Hospital of Dalian Medical University, Dalian, Liaoning Province, China

Appl Biochem Biotechnol

Keywords Human epidermal growth factor receptor 2 . Expression . Purification . Polyclonal antibodies Abbreviations HER2 Human epidermal growth factor receptor 2 EGFR Epidermal growth factor receptor ECD Extracellular domain IPTG Isopropyl-b-D-thiogalactopyranoside

Introduction HER2/neu/c-erbB-2 is a 185-kDa membrane-bound tyrosine kinase receptor with extensive sequence homology to HER1, HER3, and HER4 in the growth factor receptor family [1]. Like other transmembrane proteins, HER2 consists of three domains: an extracellular domain, a hydrophobic transmembrane domain, and an intracellular tyrosine kinase domain [2]. HER2 functions as the preferred partner for heterodimerization with other members of the EGFR family and plays an important role in coordinating the complex ErbB signaling network which is responsible for regulating cell proliferation, differentiation, and survival in normal cells [3, 4]. Overexpression of HER2 was found in individuals with breast, ovarian, and gastrointestinal tumors [5, 6], especially in tumors of the breast and the ovary. It is known that approximately 20–30 % of breast cancer patients have overexpression of the HER2 protein, and these patients are known to show poor prognosis [7]. Furthermore, a HER2-positive status indicates a poor prognosis and shorter overall survival time [8]. Patients with HER2 amplification or over-expression are susceptible for treatment with trastuzumab, which is a humanized monoclonal antibody raised against the extracellular domain of the HER2 protein [9, 10]. The expression of HER2 has been regarded as a critical factor for diagnosis and effective treatment of breast cancer patients [11]. In tumors and derived cell lines, HER2 is often overexpressed and conditionally shed, releasing a soluble extra cellular domain, and the resulting ECD may have potential physiological and clinical effects on full-length receptors via extracellular competition for its cognate ligand [12, 13]. Many reports have shown that the increased serum HER2 ECD is one of the indicators for prognostic evaluation of malignant breast tissues [14–16]. Hence, detection of the elevated HER2 ECD is very useful and important in the diagnosis and prognosis of HER2overexpressing tumors. As the largest part of HER2, the N-terminal ECD contains approximately 600 residues which could be divided into four subdomains (I–IV), subdomain I and II constitute the membrane-distal region, and the membrane proximal region is composed by subdomains III and IV. Subdomains I and III can form a binding site for the receptor’s potential ligands [17]. The membrane proximal region contains a dimerization arm, is generally believed as the main contributor for dimerization [18]. Pertuzumab, a HER dimerization inhibitor, binds to the membrane-distal region and prevents the dimerization of HER2 with other HER family members. However, the membrane proximal region has been proven to be the critical binding site for trastuzumab [19]. The expression of heterologous proteins in bacteria often results in low levels of expression or formation of insoluble inclusion bodies. The misfolding problem can be resolved by

Appl Biochem Biotechnol

introducing eukaryotic expression systems [20]. However, these systems may have other disadvantages such as low yield of recombinant protein and high cost. Another method for the high-level production of a foreign protein in bacteria is to express the protein in an insoluble form and then solubilize and refold it [21]. Easy and convenient method is very important for obtaining large amounts of HER2 ECD. The considerable quantity of purified HER2 ECD is required for production of diagnostic antibodies and titer analysis of the antibodies in serum of patients. In addition, it is critical for the development of next-generation target drugs [22]. In this paper, we showed the expression, refolding and purification of His-tag fusion protein in Escherichia coli. We constructed two recombined vectors which contained a membrane proximal region (A) and a membrane-distal region (B) of HER2 extracellular domain respectively. Two HER2 extracellular domain proteins tagged with histamines were expressed in E. coli and purified by affinity chromatography. Mice were immunized with the purified proteins by intraperitoneal injection and the specificity of the antibodies to HER2 was tested by ELISA and Western blot.

Materials and Methods Materials and Animals SK-BR-3 human breast cancer cells were purchased from Nanjing KGI Biological Technology Company (Nanjing China), BL21 (DE3) and plasmid pET-28a, pET-30a were provided by Animal Biotechnology and nutrition Laboratory, Dalian University of Technology. Restriction endonucleases, T4 DNA ligase, DNA and Protein Markers, PCR kit, Agarose Gel DNA Fragment Recovery Kit Ver.2.0, Lysis Buffer for Microoganism to Direct PCR and TaKaRa LA Taq Kit were all purchased from Takara (Dalian, China). C57BL/6 female mice (18–22 g) were provided by the Experimental Animal Center of Dalian Medical University, Dalian, China. The animals were housed in a controlled environment at 23±2 °C under a 12-h dark/ light cycle with free access to food and water. All experimental procedures were approved by the Animal Care and Use Committee of Dalian Medical University and performed in strict accordance with the People’s Republic of China Legislation Regarding the Use and Care of Laboratory Animals.

Clone of the HER2 ECD Coding Region The cDNA fragment encoding extracellular domain of HER2 was obtained by reverse transcription-polymerase chain reaction (RT-PCR) from human breast cancer cell line SKBR-3. Total RNA was extracted from SKBR-3 cells, the purity and concentration of total RNA were calculated according OD value at 260/280 nm. For reverse transcription, 1 μg total RNA was used. Primer 1 and primer 2 (Table 1) were used for the amplification of the ECD of HER2 [23]. The total PCR reaction volume was 50 μL including 2 μL of the reverse transcription solution as a template. PCR conditions were as follows: initial denaturation at 94 °C for 1 min, then 30 cycles of denaturation at 98 °C for 10 s, primer annealing at 55 °C for 25 s, followed by primer extension at 72 °C for 2 min. A final extension step proceeded at 72 °C for 3 min. PCR products (5 μL) were electrophoresed on a 1 % agarose gel, treated with ethidium bromide and visualized by UV illumination.

Appl Biochem Biotechnol Table 1 Primers used for the subcloning and sequencing of recombinant plasmids Primers

Primer sequences

Restriction endonucleases

Primer 1

5′ CATATGGAGCTGGCGGCCTTGTGC 3′

NA

Primer 2

5′CTCGAGCGTCAGAGGGCTGGCTGGCTCTCT 3′

NA

Primer 3

5′CACAGTCCATATGATGGCATTTCTGCCGAGAGCTTTG 3′

Nde I

Primer 4 Primer 5

5′CTCCTCGAGAGGCTGGCATGCGCCCTCCTCATCT 3′ 5′CTAGCTAGCAGTGAGCTGGCGGCCTTGTG 3′

Xho I Nhe I

Primer 6

5′CCCAAGCTTTCATTACACGTCCGTAGAAA 3′

Hind III

T7

5′ TAATACGACTCACTATAGGG 3′

NA

The recognition sites for restriction endonucleases are underlined. The sites of restrictive enzyme were marked with a horizontal line under the bases. NA not available

Construction of two Expression Vectors The HER2 ECD protein was split into two truncated forms to be expressed in E. coli. The first truncated protein (A) contained 252 aa, ranging from the 375th to the 625th aa of HER2 protein; the second one (B) contained 308 aa, ranging from the 1st to the 308th aa of HER2 protein. Two DNA fragments corresponding to the proteins A and B were amplified respectively from the cDNA of HER2 ECD which were made previously using the PCR kit, according to the recommend conditions: 94 °C for 5 min, 30 cycles (94 °C for 30 s, 56 °C for 30 s and 72 °C for 45 s) and a final extension at 72 °C for 10 min. Primer 3/primer 4 and primer 5/ primer 6 (Table 1) were used for the amplification of fragments A and B, respectively. The PCR-amplified products were sequentially subjected to analysis with electrophoresis on a 1 % agarose gel. The PCR-amplified products encoding protein A were digested with Nde I and XhoI restriction enzymes and then inserted into the expression vector pET-30a. The other PCR-amplified products encoding protein B were digested with NdeIand Hind III restriction enzymes and then inserted into the expression vector pET-28a. The two recombinant vectors were transformed into E. coli BL21 (DE3) competent cells and plated on Lysogeny Broth (LB) agar containing 50 μg/mL kanamycin, incubated at 37 °C overnight. The next day, single colonies were inoculated into 5 mL of LB liquid media containing 50 μg/mL kanamycin and grown overnight at 37 °C with shaking at 200 rpm, followed by sequencing using the T 7 general primer on the vector.

Expression of Proteins and Optimization of Expression Conditions The E. coli BL21 (DE3) transformants were incubated in 5 mL LB liquid medium containing 50 μg/mL kanamycin overnight at 37 °C, shaking at 200 rpm. Fifty microliters of overnight preculture was cultured in fresh LB liquid medium (5 mL) containing kanamycin (50 μg/mL) until OD600nm reached 0.8. The expression of His-A and His-B fusion protein was induced by 1.0 mM IPTG for 5 h at 30 °C, shaking at 200 rpm. The bacterial culture was centrifuged at 6,000 rpm for 10 min at 4 °C. The pallets were resuspended in phosphate-buffered saline (PBS). The cell suspensions were mixed with 2× sample loading buffer and heated at 100 °C for 5 min. The denatured samples were analyzed by sodium dodecyl sulfate-polyacrylamide

Appl Biochem Biotechnol

gel electrophoresis (SDS-PAGE) in 15 % polyacrylamide gel. The control cultures were analyzed in parallel. For western blot, proteins were resolved by 15 % SDS-PAGE gel and incubated with rabbit polyclonal anti-HER2 antibody (Sigma) (v/v: 1/10,000) and HRP-conjugated goat anti-rabbit IgG (v/v: 1/2,000, Sigma) and then detected using electrochemiluminescence (ECL) reagent. The conditions of temperature, IPTG concentration, OD600nm and induction time for the expression of proteins His-A and His-B in E. coli BL21 (DE3) were optimized. In short, when OD600nm of the liquid culture reached 0.8 after shaking at 37 °C, the culture was divided to an average of four copies and then induced with IPTG (1.0 mM) under different temperature condition (21, 26, 30, and 37 °C) for an additional 5 h for temperature optimization. When OD600nm of the liquid culture reached different values (0.5, 0.8, 1.0, 1.2), the culture was induced with IPTG (1.0 mM) under a condition of optimized temperature for additional 5 h in order to optimize the optical density. Under the conditions of optimized temperature and optical density, IPTG was added to each fresh subculture with different final concentrations (0, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 mM) and the subculture was incubated for an additional 5 h in order to optimize the IPTG concentration. For optimization of induction time, subcultures were incubated for various additional times (0, 2, 4, 6, 8, 10, and 12 h) under optimal conditions of IPTG concentration, induction temperature and optical density. In order to select optimal culture parameters, all liquid subcultures were collected and mixed with 2× sample loading buffer, heated at 100 °C for 5 min, and then analyzed by SDS-PAGE.

Solubility Testing In order to test solubility of two recombinant proteins under optimal conditions, E. coli pellets were obtained from 300 mL of cell cultures induced with IPTG, resuspended in PBS, and then sonicated on ice for 10 min at 50 % duty cycle [24]. After sonication, the cell suspensions were centrifuged at 12,000 rpm for 10 min at 4 °C. The clear supernatant and pellet were collected and analyzed on 15 % SDS-PAGE followed by Coomassie brilliant blue staining.

Purification and Renaturation of Fusion Proteins According to the optimized expression conditions, the production was scaled up. The E. coli BL21 (DE3) transformants were cultured in 20 mL LB liquid culture containing 50 μg/mL kanamycin and then shook at 200 rpm, 37 °C overnight. And then, 10 mL of the overnight culture was incubated in 1 L liquid LB culture, and induced with IPTG with the optimized conditions. The bacterial culture was centrifuged at 5,000 rpm, 4 °C for 10 min before the supernatant was removed, and then the pellets were resuspended in PBS, and sonicated on ice 10 min at 50 % duty cycle. Inclusion bodies and cellular debris were collected by centrifugation at 12,000 rpm for 15 min at 4 °C. Then the pellets were resuspended in 50 mL washing buffer (20 mM Tris-HCl, 0.5 M NaCl, 2 M urea, 2 % Triton, pH 8.0) for 30 min on ice. The solution was centrifuged at 12,000 rpm for 15 min at 4 °C and then the pellet was resuspended in 50 mL denaturation lysis buffer (20 mM Tris-HCl, 0.5 M NaCl, 8 M urea, 0.2 mM DTT, pH 8.0) and incubated in ice bath for 5 h to completely dissolve the proteins. The insoluble cellular components were removed after centrifugation at 12,000 rpm at 4 °C for 20 min, and the supernatant was filtered using 0.45 μm membrane filters to obtain the protein A and protein B body solution. His-bind resin columns were used to purify the fusion proteins, each

Appl Biochem Biotechnol

was previously charged and equilibrated with three column volumes of sterile deionized water, five column volumes of charge buffer (100 mM NiSO4) and three column volumes of binding buffer (20 mM Tris-HCl, 0.5 M NaCl, 8 M urea, pH 8.0). The pretreated inclusion body solution was loaded into the column at a flow rate of 0.2 mL/min, and then the column was washed with binding buffer until a baseline UV reading was reached. Then non-specifically bound proteins were washed with elution buffer (20 mM Tris-HCl, 0.5 M NaCl, 8 M urea, 40 mM imidazole pH 8.0), and the target proteins were eluted with elution buffer (20 mM TrisHCl, 0.5 M NaCl, 8 M urea, 500 mM imidazole pH 8.0). Purified proteins His-A and His-B were renatured by dialysis. The dialysis cassette containing the target protein solution was successively placed into beakers either containing 500 mL dialysis buffer I (20 mM Tris-HCl, 0.5 M NaCl, 8 M urea, pH 8.0), dialysis buffer II (20 mM Tris-HCl, 0.5 M NaCl, 6 M urea, pH 8.0), dialysis buffer III(20 mM Tris-HCl, 0.5 M NaCl, 4 M urea, 0.1 mM Oxidized Glutathione[GSSG], 0.9 mM glutathione[GSH], pH 8.0), dialysis buffer IV (20 mM Tris-HCl, 0.5 M NaCl, 3 M urea, 0.1 mM GSSG, 0.9 mM GSH, pH 8.0), dialysis buffer V (20 mM Tris-HCl, 0.2 M NaCl, 2 M urea, 0.1 mM GSSG, 0.9 mM GSH, pH 8.0), dialysis buffer VI (20 mM Tris-HCl, 0.1 M NaCl, 0 M urea, 0.1 mM GSSG, 0.9 mM GSH, pH 8.0), dialysis buffer VII (20 mM Tris-HCl, 0.1 M NaCl, pH 8.0), dialysis bufferVII(20 mM Tris-HCl, 0.9 % NaCl, pH 8.0), and stirred at 4 °C for 4 h. The purified HisA and His-B were analyzed by SDS-PAGE and the recombinant proteins purity was detected by Gel-Pro Analyzer.

Production of Polyclonal Antibodies Against Protein A and B The purified fusion proteins were used for production of polyclonal antibodies in fifteen 5weeks old female Balb/c mice which were divided into three groups. Mice in one group were used to prepare sera as negative control. Mice in other two groups were respectively immunized with purified proteins His-A and His-B (100 μg) assisted with complete Freund’s adjuvant (v/v:1/1) by intraperitoneal injection. Two additional booster injections with the mixture of corresponding protein (100 μg) and incomplete Freund’s adjuvant were respectively given at 2-week intervals. One week after the third injection, blood samples were obtained by tail vein injection under anaesthesia after an overnight fasting. The antiserum was obtained by centrifugation at 3,500 rpm for 10 min at 4 °C.

Antiserum Titer Determination by ELISA Titer of antiserum was assayed using indirect enzyme-linked immunosorbent assay (ELISA). Briefly, the wells of ELISA plates were respectively coated with purified protein His-A and His-B (10 μg/ mL) in coating buffer (15 mM Na2CO3, 35 mM NaHCO3, pH 9.6) overnight at 4 °C. The wells were washed three times with PBS-Tween 20 (PBST) for every 5 min. The plates were blocked with 5 % bovine serum albumin (BSA) at 37 °C for 2 h, washed 3 times with PBST for every 5 min and then incubated with 100 μL polyclonal antibodies respectively against purified protein His-A and His-B with different consecutive deliquations (from 1,000 to 51,200) at 37 °C for 2 h. After incubation, the wells were washed 3 times with PBST for every 5 min and then incubated with 100 μL peroxidase conjugated rabbit anti-mouse IgG (1:10,000 dilution) at 37 °C for 1 h. Following five washes with PBST, the wells were reacted with 3, 3′, 5, 5′-Tetramemethylbenzidine (TMB) at room temperature in dark room for 20 min. The reaction was stopped by 50 μL 2 M H2SO4. Absorbance was measured at 450 nm.

Appl Biochem Biotechnol

Western Blot and Immunofluorescence Total proteins from SK-BR3 cells were extracted using cell lysis buffer containing phenylmethanesulfonyl fluoride (PMSF). Lysates were centrifuged at 12,000 rpm for 10 min at 4 °C and the total proteins were obtained. The proteins were mixed with sample loading buffer and heated at 100 °C for 5 min. The denatured samples were analyzed by SDS-PAGE in a 7.5 % polyacrylamide gel with a prestained protein marker (Takara, Dalian, China). After electrophoresis, the gels were used for western blot with the prepared mouse polyclonal antibodies as the primary antibody and HRP-conjugated rabbit anti-mouse IgG as secondary antibody. The purified proteins His-A and His-B were also subjected to the western blot analysis with the same primary and secondary antibodies as described above. HER2/neu-negative MCF-7 cells and HER2/neu-positive SK-BR-3 cells were seeded in six-well plates and cultured in d minimum essential medium with low carbohydrates containing 10 % fetal bovine serum at 37 °C in 5 % CO2 for 24 h. The cells were washed with PBS, fixed with 4 % paraformaldehyde for 15 min at 4 °C, and then washed with PBS again. Nonspecific binding was blocked by incubating cells in 3 % BSA for 45 min at 37 °C, and the cells were incubated with the polyclonal antibodies against His-A or His-B and IgG against HER2 overnight at 4 °C. Then, the plates were washed twice with PBS. The cells were incubated with secondary antibody for 1 h at 37 °C, washed with PBS and stained with DAPI (5 μg/mL) for 5 min. The images of the cells were obtained using an inverted fluorescence microscopy (OLYMPUS, Osaka, Japan).

Statistical Analysis Each experiment was performed for at least three times. Data were analyzed by Graphpad Prism 4.0 through one-way ANOVA and Tukey post hoc test. A difference was considered significant when P