Plant Science 214 (2014) 106–112
Contents lists available at ScienceDirect
Plant Science journal homepage: www.elsevier.com/locate/plantsci
Expression of Arabidopsis glycine-rich RNA-binding protein AtGRP2 or AtGRP7 improves grain yield of rice (Oryza sativa) under drought stress conditions Deok Hee Yang, Kyung Jin Kwak, Min Kyung Kim, Su Jung Park, Kwang-Yeol Yang, Hunseung Kang ∗ Department of Plant Biotechnology, College of Agriculture and Life Sciences, Chonnam National University, 300 Yongbong-dong, Buk-gu, Gwangju 500-757, South Korea
a r t i c l e
i n f o
Article history: Received 7 September 2013 Received in revised form 8 October 2013 Accepted 10 October 2013 Available online 20 October 2013 Keywords: Abiotic stress Rice RNA-binding protein RNA chaperone Yield improvement
a b s t r a c t Although posttranscriptional regulation of RNA metabolism is increasingly recognized as a key regulatory process in plant response to environmental stresses, reports demonstrating the importance of RNA metabolism control in crop improvement under adverse environmental stresses are severely limited. To investigate the potential use of RNA-binding proteins (RBPs) in developing stress-tolerant transgenic crops, we generated transgenic rice plants (Oryza sativa) that express Arabidopsis thaliana glycine-rich RBP (AtGRP) 2 or 7, which have been determined to harbor RNA chaperone activity and confer stress tolerance in Arabidopsis, and analyzed the response of the transgenic rice plants to abiotic stresses. AtGRP2- or AtGRP7-expressing transgenic rice plants displayed similar phenotypes comparable with the wild-type plants under high salt or cold stress conditions. By contrast, AtGRP2- or AtGRP7-expressing transgenic rice plants showed much higher recovery rates and grain yields compared with the wild-type plants under drought stress conditions. The higher grain yield of the transgenic rice plants was due to the increases in filled grain numbers per panicle. Collectively, the present results show the importance of posttranscriptional regulation of RNA metabolism in plant response to environmental stress and suggest that GRPs can be utilized to improve the yield potential of crops under stress conditions. © 2013 Elsevier Ireland Ltd. All rights reserved.
1. Introduction With the increasing information on the genome sequences of diverse plant species, it is imperative to utilize the wealth of genomic information for the enhancement of crop yield potentials. A variety of strategies, including conventional hybridization and selection, F1 hybrid breeding, modification of plant architecture, and enhancement of plant growth and development by genetic transformation, can be used to increase the yield potential of crops [1]. Considering the fact that climate changes encountered during recent years cause adverse environmental conditions that greatly diminish crop yields, it is particularly challenging to utilize these strategies to develop economic crops that can maintain high yield potentials under stressful conditions. Plant response and adaptation to changing environmental conditions as well as the maintenance of high yield potentials under adverse conditions are the
Abbreviations: CSP, cold shock protein; GRP, glycine-rich RNA-binding protein; RBP, RNA-binding protein. ∗ Corresponding author. Tel.: +82 62 530 2181; fax: +82 62 530 2069. E-mail address: [email protected] (H. Kang). 0168-9452/$ – see front matter © 2013 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.plantsci.2013.10.006
results of regulated gene expression in plants, which includes both transcriptional and posttranscriptional regulation. In recent years, posttranscriptional regulation of RNA metabolism is increasingly recognized as a key regulatory process in plant growth, development, and stress responses [2,3]. The regulation of RNA metabolism at the posttranscriptional level includes mRNA splicing, capping, polyadenylation, transport, turnover, and translation. These posttranscriptional events have been shown to play important roles in the response of plants to a variety of environmental stresses [2,4]. The regulation of posttranscriptional RNA metabolism is largely achieved by diverse RNA-binding proteins (RBPs), and identification and characterization of RBPs from different plant species is an indispensible step to better understand a variety of cellular processes. RBPs consist of one or more RNA-binding domains and a variety of auxiliary motifs, such as glycine-rich, arginine-rich, RD-repeat, SR-repeat, and CCHC-type zinc finger motifs, at the Cterminus [5,6]. Among the various types of RBPs, proteins that contain an RNA-recognition motif (RRM) at the N-terminus and a glycine-rich region at the C-terminus, thus named as glycine-rich RNA-binding proteins (GRPs), were found ubiquitously in diverse plant species [7], and the stress-responsive expression of GRPs has been investigated in plants under different environmental stress
D.H. Yang et al. / Plant Science 214 (2014) 106–112
conditions [8–15]. The highly modulated expression of GRPs in plants under different stress conditions suggests that GRPs may be involved in plant response to changing environmental conditions [16,17]. With their discovery from diverse plant species, the biological functions of several GRPs have been increasingly demonstrated in recent years. It has been shown that several family members of GRPs in Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa) enhanced seed germination, seedling growth, and freezing tolerance of plants under stress conditions [18–22]. Moreover, it has been demonstrated that certain family members of GRPs exhibit RNA chaperone activity during cold adaptation [21–24]. In addition, GRP from Limonium bicolor was demonstrated to enhance salt tolerance in transgenic tobacco [15], and OsGRP4 from rice has been shown to be involved in high temperature stress response [25]. Although these studies greatly contributed to our understanding of the biological roles of RBPs in Arabidopsis and tobacco under stress conditions, reports demonstrating the functional roles of RBPs in crops under stress conditions are severely limited. The possible utilization of RBPs possessing RNA chaperone activity to develop stress-tolerant crops has recently been demonstrated; cold shock protein (CSP) CspA and CspB, the bacterial RNA chaperones, could be used to improve the cold or drought stress tolerance of rice and maize [26], which opened new avenues of research involving the use of RNA chaperones as a means to improve crop performance under stress conditions. It has been shown that Arabidopsis AtGRP2 and AtGRP7 contribute to enhance seed germination and seedling growth of the plants under cold stress, and also confer freezing tolerance [19,20]. In particular, it was demonstrated that the ability of AtGRP2 and AtGRP7 to enhance cold tolerance is closely related with their RNA chaperone activity [20,24]. Given that AtGRP2 and AtGRP7 possess RNA chaperone activity and contribute to enhance stress tolerance in Arabidopsis, we attempted to determine whether these AtGRPs can confer stress tolerance in rice. This study provides evidences that AtGRP2 and AtGRP7 can be used as a potential modulator to improve rice performance under drought stress conditions.
107
maintaining green leaves were decided as surviving plants. For drought stress treatment for the plants grown in pots, water was withheld for 2 days, and water was supplied and recovery rates were measured 3–4 days after recovery. For the measurement of chlorophyll contents, leaf samples were cut into small pieces and were heated at 80 ◦ C for 20 min in 95% ethanol solution to extract chlorophyll. Chlorophyll contents were calculated based on the absorbance at 648 and 664 nm [27]. 2.3. Measurement of growth and grain yield under stress conditions The wild-type and transgenic rice plants expressing AtGRP2 or AtGRP7 were grown in soil until bolting stage under normal growth conditions. Two days after bolting, the rice plants were subjected to drought stress by withholding water for 3 days. The plants were recovered with the addition of water and grown under normal growth conditions. Several parameters, including culm length, panicle length, number of panicle per hill, number of grains per panicle, filled grain number, and grain weight per plantlet, were measured to compare yield potentials between the wild-type and transgenic plants. 2.4. RNA extraction and quantitative real-time RT-PCR Total RNA was extracted from the rice plants using a Plant RNeasy extraction kit (Qiagen, USA). The real-time quantification of RNA targets was performed in the Rotor-Gene Q real-time thermal cycling system (Qiagen) using QuantiTect SYBR Green RT-PCR kit (Qiagen) as previously described [28]. The reaction mixture contained 200 ng of total RNA, 0.5 M of each primer listed in Table 1, and appropriate amounts of enzymes and fluorescent dyes as recommended by the manufacturer. Control RT-PCR was performed with the same amount of total RNA using the primer pair specific to the ubiquitin gene. The experiments were repeated three times with different batches of RNA samples.
2. Materials and methods 2.5. Statistical analysis 2.1. Plant materials The wild-type rice plant used in this study was Donjin variety. To generate transgenic rice plants expressing Arabidopsis AtGRP2 or AtGRP7, the cDNAs encoding AtGRP2 or AtGRP7 were cloned into the pGA1611 vector which expresses target genes under the control of ubiquitin promoter. After selecting the transgenic plants in the medium containing hygromycin (50 mg/L), the insertion of AtGRP2 or AtGRP7 was verified by gDNA PCR analysis. Gnomic DNAs were extracted from the plant tissues using Genomic DNA extraction kit (iNtRON), and PCR was performed using the gene-specific primer pairs listed in Table 1. The T3 transgenic lines were selected and utilized for phenotype analysis. The expression of AtGRP2 or AtGRP7 in each transgenic rice plant was confirmed by RT-PCR analysis using the primer pairs listed in Table 1. 2.2. Drought stress treatment The wild-type and transgenic rice plants expressing AtGRP2 or AtGRP7 were grown in either 1/20 Hoagland solution or soil at 25 ± 2 ◦ C under 16-h-light/8-h-dark photocycle. For drought stress treatment for the plants grown in Hoagland solution, fifteen seedlings at 2–3 leaf stage were removed from the nutrient solution and were placed on filter paper for 9 h. The plants were resupplied with 1/20 Hoagland solution, and recovery rates (no. of surviving plants/no. of total plants) and chlorophyll contents were measured 1 week after recovery. For recovery rate measurement, the plants
Data were square root-transformed prior to analysis, and differences between the samples were compared by t-test (P ≤ 0.05; SIGMAPLOT software; Systat Software Inc.). 3. Results 3.1. Generation and selection of transgenic rice plants To examine whether Arabidopsis AtGRP2 and AtGRP7 can enhance stress tolerance in rice, transgenic rice plants expressing AtGRP2 or AtGRP7 under the control of ubiquitin promoter were generated. Multiple transgenic lines were selected in the medium containing hygromycin, and the insertion of AtGRP2 or AtGRP7 was verified by gDNA PCR analysis (Fig. 1A). The stressresponsive phenotypes of the wild-type and multiple transgenic lines were first analyzed in Hoagland solution. Among drought, high salt, or cold stress tested in this study, no significant differences in seedling growth were observed between the wild-type and transgenic plants under high salt or cold stress conditions (data not shown). By contrast, when the seedlings were subjected to drought stress by withholding water for 9 h, the recovery rates (no. of surviving plants/no. of total plants) of the plants were significantly different in that several transgenic lines, including GRP2-3, GRP2-16, GRP2-22, GRP2-33, GRP7-31, GRP7-33, GRP7-37, and GRP7-42, were more tolerant against drought stress than the wildtype plants (Fig. 1B). Among the multiple transgenic lines showing
108
D.H. Yang et al. / Plant Science 214 (2014) 106–112
Table 1 Gene-specific primer pairs used in RT-PCR experiments. Genes
Primers (5 –3 )a
AtGRP2 AtGRP7 OsRab21 OsDip1 OsOSE2 OsPBZ1 OsNAC10 NCED KUP3 HAK5 MutS4 LRR PER OsUbi
F; ATGGCTTTCTGTAACAAACTCGGTG F; TTACCATCCTCCACCACCACC F; GATGGGAGGAAGGAGGAAGAA F; GTGAGACCAGGCCATGGTTG F; TCAGTTGCCATCCCCATACA F; GCGATGGCTCCTGTGTGG F; TTCTCCTCGACGGCTCATCC F; ACGGCGGAGAAGTTCATCTA F; GGTCACCGGAGGAAGAGATG F; GTCTATTCCACGCCGCAAGT F; CGCGTATTCACACGGATTGG F; GCGGTTATCCAACTGAACCA F; TCACTGCCAAGTGGATGAAG F; CCCTGACTGGCAAGACCATCACAC
a
R; TTAGAAACCACCACCACCATCACCAC R; ATGGCGTCCGGTGATGTTGAG R; TGCTGGTTGTTGCCCTTGT R; TGCAGTGCAGAAAAAGCACC R; CGCAACTAGGCTACTGCCG R; CTCCGGCGACAGTGAGCT R; ATGGATGGCTCAGCAGATTG R; AATGAAGGTGCCGTGCAATC R; CTTGTACAGCATGCCGATCT R; ATGGAGAGTCACGCAAGCAA R; TCACAGCAGCTCCATGCAAT R; GGTTGACCAAGAGTCACTAC R; GTGTCGTGCGATGAATCCTA R; TTGACGAAGATCTGCATACCACCC
F, forward primers; R, reverse primers.
drought-tolerant phenotype, four lines (GRP2-16, GRP2-22, GRP731, and GRP7-42) were selected for further analysis. 3.2. Drought stress tolerance of the transgenic rice plants To further investigate whether AtGRP2 and AtGRP7 enhance drought stress tolerance in rice, the stress-responsive phenotypes of the four selected lines (GRP2-16, GRP2-22, GRP7-31, and GRP742) were analyzed in more detail. The expression of AtGRP2 or AtGRP7 in the transgenic rice plants was confirmed by RT-PCR analysis (Fig. 2A). When the wild-type and transgenic rice plants were grown under normal growth conditions, no differences in seedling growth were observed between the genotypes (Fig. 2B). The wildtype and transgenic rice plants were subjected to drought stress by withholding water for 9 h, and recovery rates were measured 1 week after re-watering. The recovery rates of the wild-type plants
Fig. 1. Generation and selection of transgenic rice plants. (A) Genomic DNA PCR was conducted to verify the insertion of Arabidopsis AtGRP2 or AtGRP7 in each transgenic rice plant. WT, wild-type plant. (B) The wild-type (WT) and transgenic rice plants expressing AtGRP2 or AtGRP7 were grown in Hoagland solution until 2–3 leaf stage and subjected to drought stress for 9 h. The recovery rates were measured 1 week after re-watering. The experiments were repeated three times, and the values are means ± SE (n = 15).
were approximately 4%, whereas the recovery rates of the transgenic plants were approximately 19–24% (Fig. 2B), indicating that the transgenic plants expressing AtGRP2 or AtGRP7 were more tolerant to drought stress than the wild-type plants. The stress-responsive phenotypes of the four selected lines were also analyzed in soil. When grown under normal growth conditions, no differences in plant growth were observed between the wild-type and transgenic rice plants (Fig. 3). Next, the wild-type
Fig. 2. Drought-responsive phenotypes of the transgenic rice plants. (A) Expression of AtGRPs in four transgenic lines (GRP2-16, GRP2-22, GRP7-31, and GRP7-42) selected for further phenotype analysis was confirmed by RT-PCR analysis. (B) The wild-type (WT) and transgenic rice plants expressing AtGRP2 or AtGRP7 were grown in Hoagland solution until 2–3 leaf stage and subjected to drought stress for 9 h. The recovery rates were measured 1 week after re-watering. The experiments were repeated three times, and the values under each transgenic line number represent mean recovery rate ± SE (n = 15).
D.H. Yang et al. / Plant Science 214 (2014) 106–112
109
drought stress by withholding water for 3 days, during which the soil humidity was decreased to 12 ± 1%. The plants were recovered with resupplying water and grown under normal growth conditions until maturity. Several parameters, including culm length, panicle length, panicle number per hill, filled grain number per panicle, and grain yield per plant, were used to determine the severity of drought stress at the time of maturity. No significant differences in culm length, panicle length, and panicle number per hill were observed between the wild-type and transgenic rice plants subjected to drought stress (Fig. 4). However, the filled grain numbers per panicle of the transgenic plants were significantly higher than those of the wild-type plants (Fig. 4). The wild-type rice plants grown under normal growth conditions contained approximately 70 filled grains per panicle. When subjected to drought stress, the wild-type rice plants contained approximately 15 filled grains per panicle, whereas the transgenic rice plants contained approximately 40–60 filled grains per panicle (Fig. 4). The grain yields of the wild-type and transgenic rice plants were approximately 10 g per plant under normal growth conditions. When subjected to drought stress, the grain yield of the wild-type plants was decreased significantly down to approximately 1 g per plant. By contrast, the grain yield of the transgenic rice plants expressing AtGRP2 or AtGRP7 was approximately 4–6 g per plant under drought stress conditions (Fig. 4). These results indicate that expression of AtGRP2 or AtGRP7 contributed to the increases in filled grain number per panicle, which resulted in enhanced grain yield of the transgenic rice plants under drought stress conditions. 3.4. AtGRP2 and AtGRP7 affected the expression of drought stress-responsive genes
Fig. 3. Drought-tolerant phenotypes of the transgenic rice plants. The wild-type (WT) and transgenic rice plants expressing AtGRP2 (2–16 and 2–22) or AtGRP7 (7–31 and 7–42) were grown in soil until 2–3 leaf stage, and the seedlings were subjected to drought stress by withholding water until half of the leaves became dry or wilt. After recovery with re-watering, the severity of damage was investigated and the chlorophyll contents were measured. The experiments were repeated three times, and the values are means ± SE (n = 10). Asterisks above the columns indicate values that are statistically different from the control (WT) values (p < 0.05).
and transgenic rice plants were subjected to drought stress by withholding water until half of the leaves became dry or wilted, and the severity of damage was investigated after recovery with re-watering. As shown in Fig. 3, the transgenic plants expressing AtGRP2 or AtGRP7 were much healthier that the wild-type plants after recovery. As another measure of stress tolerance, chlorophyll contents were analyzed in the plants. Results showed that chlorophyll contents in the transgenic lines were much higher than those in the wild-type plants (Fig. 3), indicating that the transgenic plants expressing AtGRP2 or AtGRP7 were more tolerant to drought stress than the wild-type plants. 3.3. AtGRP2 and AtGRP7 enhanced grain yield under drought stress conditions To further determine whether AtGRP2 and AtGRP7 contribute to enhance grain yield of rice under drought stress conditions, the growth and productivity of the four selected lines were analyzed at maturation stage in soil. The wild-type and transgenic rice plants expressing AtGRP2 or AtGRP7 were grown in soil until bolting stage under normal growth conditions, and then subjected to
To get some clues on how AtGRP2 and AtGRP7 contributed to enhance grain yield of the transgenic rice plants under drought stress conditions, the expression levels of several drought stressresponsive genes were analyzed by real-time RT-PCR. The drought stress-responsive genes investigated in this study include NAC10, P450, KUP3, HAK5, MutS4, LRR, Rab21, Dip1, OSE2, and PBZ1, the expression of which is highly modulated in rice under drought stress conditions [29,30]. The expression levels of these stressresponsive genes were similar in the wild-type and transgenic plants under normal growth conditions (data not shown). However, the transcript levels of several genes, including OSE2, Dip1, PBZ1, and LRR, were marginally up-regulated in the AtGRP2- or AtGRP7expressing transgenic plants compared with the wild-type plants under drought stress conditions (Fig. 5). These results suggest that modulation of the expression of a subset of stress-responsive genes was related to the increased drought tolerance of the transgenic rice plants. 4. Discussion This study demonstrates that RBPs possessing RNA chaperone activity can be utilized as a potential means to develop stresstolerant crops. The present data clearly showed that AtGRP2 and AtGRP7 contribute to enhance drought stress tolerance of rice at both vegetative and reproductive stages with enhanced grain yield. Compared with many other transgenic approaches, e.g. utilizing transcription factors, which could increase stress tolerance but resulted in undesirable side effects such as diminished plant height and development, our approach utilizing AtGRP2 or AtGRP7 possessing RNA chaperone activity did not result in any detrimental effects on plant size and productivity under normal growth conditions (Fig. 4). The potential utilization of the proteins harboring RNA chaperone activity for the generation of transgenic crops without any detrimental effects has previously been demonstrated for CspA
110
D.H. Yang et al. / Plant Science 214 (2014) 106–112
Fig. 4. Growth parameters and grain yield of the transgenic rice plants under drought stress conditions. The wild-type (WT) and transgenic rice plants expressing AtGRP2 (2–16 and 2–22) or AtGRP7 (7–31 and 7–42) were grown in soil until bolting, and the plants at 2 days after bolting were subjected to drought stress by withholding water until soil humidity decreased down to 12%. After recovery with re-watering, the growth parameters and grain yield of each plant were measured. The values are means ± SE (n = 10), and asterisks above the columns indicate values that are statistically different from the control (WT) values under drought stress conditions (p < 0.05). WT-Norm; wild-type grown under normal conditions.
and CspB, the bacterial RNA chaperones, in maize and rice under drought, heat, or cold stress conditions [26]. Clearly, engineering the proteins with RNA chaperone activity can be a potential means to develop multiple stress-tolerant crops. Although the molecular mechanism underlying AtGRP2- or AtGRP7-mediated stress tolerance in transgenic rice is unclear at present, the RNA chaperone activity of GRPs should be necessary for improving stress tolerance in rice. In a previous study by Castiglioni et al. [26], expression of the mutant CspB protein that does not exhibit RNA chaperone activity resulted in no beneficial effects on
grain yield of maize under water-deficit conditions, which emphasizes the requirement of effective RNA chaperone activity to confer yield benefits under water stress. RNA chaperones are nonspecific RNA-binding proteins that aid RNA folding process by structural rearrangement of RNA molecules [31,32]. The functional roles of RBPs possessing RNA chaperone activity have been demonstrated in diverse plant species including Arabidopsis, rice, and winter wheat [18,19,33–39]. In particular, it has been determined that AtGRP2 and AtGRP7 possess RNA chaperone activity during stress tolerance in Arabidopsis and E. coli [20,24]. It is likely that the
D.H. Yang et al. / Plant Science 214 (2014) 106–112
2.5 2
OSE2 *
2.5
*
*
Expresssion (fold control)
1.5
*
0.5
0.5
0
0
2
*
*
*
*
2.5 2
1.5
1.5
1
1
0.5
0.5
0
*
1.5 1
PBZ1
Dip1
2
1
2.5
111
*
*
*
*
*
LRR *
*
0
WT 2-16 2-22 7-31 7-42
WT 2-16 2-22 7-31 7-42
Fig. 5. Transcript levels of the drought stress-responsive genes in the transgenic rice plants under drought stress conditions. Three-week-old wild-type (WT) and transgenic rice plants expressing AtGRP2 (2–16 and 2–22) or AtGRP7 (7–31 and 7–42) were subjected to drought stress, and the expression of the drought stress-responsive genes was analyzed 24 h after drought treatment by real-time RT-PCR. The experiments were repeated three times, and the values are means ± SE. Asterisks above the columns indicate values that are statistically different from the control (WT) values (p < 0.05).
RNA chaperone activity of AtGRP2 and AtGRP7 is involved in the regulation of RNA metabolism in rice, which results in increased yield benefits of rice plants under drought stress conditions. Next remaining question is to determine the target mRNAs in rice regulated by AtGRP2 or AtGRP7 under drought stress conditions. Our target-oriented analysis showed that the transcript levels of several drought stress-responsive genes, including OSE2, Dip1, PBZ1, and LRR, were marginally up-regulated in the AtGRP2- or AtGRP7expressing transgenic plants compared with the wild-type plants under drought stress conditions (Fig. 5). These results suggest that modulation of the expression of a subset of stress-responsive genes is related to the increased drought tolerance of the transgenic rice plants. However, we analyzed the expression levels of only a limited number of genes, and it is possible that many other stressresponsive genes are also regulated in the transgenic rice plants. Although it is not clear at present whether AtGRP2 and AtGRP7 affect directly or indirectly the transcript levels of stress-responsive genes, it is likely that AtGRP2 and AtGRP7 modulate the transcript levels of the genes either by directly regulating the processing or stability of mRNAs or by indirectly influencing the transcription of the genes via interaction with upstream protein factors that regulate the transcript levels of the stress-responsive genes. It should be interesting to further determine how the ectopic expression of Arabidopsis AtGRP2 and AtGRP7 influences the expression of stress-responsive genes in transgenic rice plants, which results in increased stress tolerance and enhanced grain yield of rice plants under drought stress conditions. In conclusion, the present study shows that GRPs harboring RNA chaperone activity can be utilized as a potential means to develop stress-tolerant crops. As evidenced from the current and previous analysis of transgenic crops expressing GRPs or CSPs, the proteins possessing RNA chaperone activity, posttranscriptional control of RNA processing and metabolism is an important level of regulation in plant adjustment to adverse environmental conditions. The fact that expression of GRPs or CSPs does not have any detrimental effect on the growth, development, or productivity of crop plants under normal growth conditions is another bright point of
utilizing these proteins in the development of stress-tolerant transgenic crops. Further studies should focus on the elucidation of the cellular mechanisms underlying GRP-mediated stress tolerance in crop plants. Acknowledgments This work was supported by grant from the Next-Generation BioGreen21 Program (PJ00820303), Rural Development Administration, Republic of Korea and by grant from the Mid-career Researcher Program through a National Research Foundation of Korea grant funded by the Ministry of Education, Science and Technology (2011-0017357). References [1] J.-S. Jeon, K.-H. Jung, H.-B. Kim, J.-P. Suh, G.S. Khush, Genetic and molecular insights into the enhancement of rice yield potential, J. Plant Biol. 54 (2011) 1–9. ´ Role of plant RNA-binding proteins in development, stress [2] Z.J. Lorkovic, response and genome organization, Trends Plant Sci. 14 (2009) 229–236. [3] H.J. Jung, S.J. Park, H. Kang, Regulation of RNA metabolism in plant development and stress responses, J. Plant Biol. 56 (2013) 123–129. [4] M. Floris, H. Mahgoub, E. Lanet, C. Robaglia, B. Menand, Post-transcriptional regulation of gene expression in plants during abiotic stress, Int. J. Mol. Sci. 10 (2009) 3168–3185. [5] C.G. Burd, G. Dreyfuss, Conserved structures and diversity of functions of RNAbinding proteins, Science 265 (1994) 615–621. [6] M.M. Albà, M. Pagès, Plant proteins containing the RNA-recognition motif, Trends Plant Sci. 3 (1998) 15–21. ´ A. Barta, Genomic analysis: RNA recognition motif (RRM) and K [7] Z.J. Lorkovic, homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana, Nucleic Acids Res. 30 (2002) 623–635. [8] M.K. Kim, H.J. Jung, D.H. Kim, H. Kang, Characterization of glycine-rich RNAbinding proteins in Brassica napus under stress conditions, Physiol. Plant. 146 (2012) 297–307. [9] D.P. Horvath, P.A. Olson, Cloning and characterization of cold-regulated glycine-rich RNA-binding protein genes from leafy spurge (Euphorbia esula L.) and comparison to heterologous genomic clones, Plant Mol. Biol. 38 (1998) 531–538. [10] N.S.M. Aneeta, N. Tuteja, S.K. Sopory, Salinity- and ABA-induced up-regulation and light-mediated modulation of mRNA encoding glycine-rich RNA-binding
112
[11]
[12]
[13]
[14]
[15]
[16]
[17] [18]
[19]
[20]
[21]
[22]
[23]
[24]
D.H. Yang et al. / Plant Science 214 (2014) 106–112 protein from Sorghum bicolor, Biochem. Biophys. Res. Commun. 296 (2002) 1063–1068. J.R. Stephen, K.C. Dent, W.E. Finch-Savage, A cDNA encoding a cold-induced glycine-rich RNA binding protein from Prunus avium expressed in embryonic axes, Gene 320 (2003) 177–183. T. Nomata, Y. Kabeya, N. Sato, Cloning and characterization of glycine-rich RNAbinding protein cDNAs in the moss Physcomitrella patens, Plant Cell Physiol. 45 (2004) 48–56. H. Shinozuka, H. Hisano, S. Yoneyama, Y. Shimamoto, E.S. Jones, J.W. Forster, T. Yamada, A. Kanazawa, Gene expression and genetic mapping analyses of a perennial ryegrass glycine-rich RNA-binding protein gene suggest a role in cold adaptation, Mol. Genet. Genomics 275 (2006) 399–408. X. Chen, Q.-C Zeng, X.-P Lu, D.-Q Yu, W.-Z Li, Characterization and expression analysis of four glycine-rich RNA-binding proteins involved in osmotic response in tobacco (Nicotiana tabacum cv. Xanthi), Agri. Sci. China 9 (2010) 1577–1587. C. Wang, D.W. Zhang, Y.C. Wang, L. Zheng, C.P. Yang, A glycine-rich RNA-binding protein can mediate physiological responses in transgenic plants under salt stress, Mol. Biol. Rep. 39 (2012) 1047–1053. G. Sachetto-Martins, L.O. Franco, D.E. de Oliveira, Plant glycine-rich proteins: a family or just proteins with a common motif? Biochim. Biophys. Acta 1492 (2000) 1–14. A. Mangeon, R.M. Junqueira, G. Sachetto-Martins, Functional diversity of the plant glycine-rich proteins superfamily, Plant Signal. Behav. 5 (2010) 99–104. Y.O. Kim, J.S. Kim, H. Kang, Cold-inducible zinc finger-containing glycine-rich RNA-binding protein contributes to the enhancement of freezing tolerance in Arabidopsis thaliana, Plant J. 42 (2005) 890–900. J.Y. Kim, S.J. Park, B. Jang, C.-H. Jung, S.J. Ahn, C.-H. Goh, K. Cho, O. Han, H. Kang, Functional characterization of a glycine-rich RNA-binding protein2 in Arabidopsis thaliana under abiotic stress conditions, Plant J. 50 (2007) 439–451. J.S. Kim, H.J. Jung, H.J. Lee, K.A. Kim, C.-H. Goh, Y. Woo, S.H. Oh, Y.S. Han, H. Kang, Glycine-rich RNA-binding protein7 affects abiotic stress responses by regulating stomata opening and closing in Arabidopsis thaliana, Plant J. 55 (2008) 455–466. J.Y. Kim, W.Y. Kim, K.J. Kwak, S.H. Oh, Y.S. Han, H. Kang, Glycine-rich RNAbinding proteins are functionally conserved in Arabidopsis thaliana and Oryza sativa during cold adaptation process, J. Exp. Bot. 61 (2010) 2317–2325. J.Y. Kim, W.Y. Kim, K.J. Kwak, S.H. Oh, Y.S. Han, H. Kang, Zinc finger-containing glycine-rich RNA-binding protein in Oryza sativa has an RNA chaperone activity under cold stress conditions, Plant Cell Environ. 33 (2010) 759–768. Y.O. Kim, H. Kang, The role of a zinc finger-containing glycine-rich RNA-binding protein during the cold adaptation process in Arabidopsis thaliana, Plant Cell Physiol. 47 (2006) 793–798. J.S. Kim, S.J. Park, K.J. Kwak, Y.O. Kim, J.Y. Kim, J. Song, B. Jang, C.-H. Jung, H. Kang, Cold shock domain proteins and glycine-rich RNA-binding proteins from
[25]
[26]
[27] [28]
[29]
[30]
[31] [32]
[33]
[34] [35]
[36] [37] [38]
[39]
Arabidopsis thaliana can promote the cold adaptation process in E. coli, Nucleic Acids Res. 35 (2007) 506–516. C. Sahi, M. Agarwal, A. Singh, A. Grover, Molecular characterization of a novel isoform of rice (Oryza sativa L.) glycine rich-RNA binding protein and evidence for its involvement in high temperature stress response, Plant Sci. 173 (2007) 144–155. P. Castiglioni, D. Warner, R.J. Bensen, D.C. Anstrom, J. Harrison, M. Stoecker, M. Abad, G. Kumar, S. Salvador, R. D’Ordine, et al., Bacterial RNA chaperones confer abiotic stress tolerance in plants and improved grain yield in maize under water-limited conditions, Plant Physiol. 147 (2008) 446–455. H.K. Lichtenthaler, Chlorophylls and carotenoids. Pigments of photosynthetic biomembranes, Methods Enzymol. 148 (1987) 350–382. K.J. Kwak, Y.O. Kim, H. Kang, Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress, J. Exp. Bot. 56 (2005) 3007–3016. J.S. Jeong, Y.S. Kim, K.H. Baek, H. Jung, S.-H. Ha, Y.D. Choi, M. Kim, C. Reuzeau, J.-K. Kim, Root specific expression of the transcription factor OsNac10 in rice enhances grain yield under drought conditions, Plant Physiol. 153 (2010) 185–197. ˜ S. Campo, C. Peris-Peris, L. Montesinos, G. Penas, J. Messeguer, B.S. Segundo, Expression of the maize ZmGF14-6 gene in rice confers tolerance to drought stress while enhancing susceptibility to pathogen infection, J. Exp. Bot. 63 (2012) 983–999. D. Herschlag, RNA chaperones and the RNA folding problem, J. Biol. Chem. 270 (1995) 20871–20874. L. Rajkowitsch, D. Chen, S. Stampfl, K. Semrad, C. Waldsich, O. Mayer, M.F. Jantsch, R. Konrat, U. Bläsi, R. Schroeder, RNA chaperones, RNA annealers and RNA helicases, RNA Biol. 4 (2007) 118–130. D. Karlson, K. Nakaminami, T. Toyomasu, R. Imai, A cold-regulated nucleic acidbinding protein of winter wheat shares a domain with bacterial cold shock proteins, J. Biol. Chem. 277 (2002) 35248–35256. D. Karlson, R. Imai, Conservation of the cold shock domain protein family in plants, Plant Physiol. 131 (2003) 12–15. K. Nakaminami, D. Karlson, R. Imai, Functional conservation of cold shock domains in bacteria and higher plants, Proc. Natl. Acad. Sci. USA 103 (2006) 10122–10127. V. Chaikam, D. Karlson, Functional characterization of two cold shock domain proteins from Oryza sativa, Plant Cell Environ. 31 (2008) 995–1006. M.H. Kim, K. Sasaki, R. Imai, Cold shock domain protein 3 regulates freezing tolerance in Arabidopsis thaliana, J. Biol. Chem. 284 (2009) 23454–23460. S.J. Park, K.J. Kwak, T.R. Oh, Y.O. Kim, H. Kang, Cold shock domain proteins affect seed germination and growth of Arabidopsis thaliana under abiotic stress conditions, Plant Cell Physiol. 50 (2009) 869–878. H. Kang, S.J. Park, K.J. Kwak, Plant RNA chaperones in stress response, Trends Plant Sci. 18 (2013) 100–106.
Contents lists available at ScienceDirect
Plant Science journal homepage: www.elsevier.com/locate/plantsci
Expression of Arabidopsis glycine-rich RNA-binding protein AtGRP2 or AtGRP7 improves grain yield of rice (Oryza sativa) under drought stress conditions Deok Hee Yang, Kyung Jin Kwak, Min Kyung Kim, Su Jung Park, Kwang-Yeol Yang, Hunseung Kang ∗ Department of Plant Biotechnology, College of Agriculture and Life Sciences, Chonnam National University, 300 Yongbong-dong, Buk-gu, Gwangju 500-757, South Korea
a r t i c l e
i n f o
Article history: Received 7 September 2013 Received in revised form 8 October 2013 Accepted 10 October 2013 Available online 20 October 2013 Keywords: Abiotic stress Rice RNA-binding protein RNA chaperone Yield improvement
a b s t r a c t Although posttranscriptional regulation of RNA metabolism is increasingly recognized as a key regulatory process in plant response to environmental stresses, reports demonstrating the importance of RNA metabolism control in crop improvement under adverse environmental stresses are severely limited. To investigate the potential use of RNA-binding proteins (RBPs) in developing stress-tolerant transgenic crops, we generated transgenic rice plants (Oryza sativa) that express Arabidopsis thaliana glycine-rich RBP (AtGRP) 2 or 7, which have been determined to harbor RNA chaperone activity and confer stress tolerance in Arabidopsis, and analyzed the response of the transgenic rice plants to abiotic stresses. AtGRP2- or AtGRP7-expressing transgenic rice plants displayed similar phenotypes comparable with the wild-type plants under high salt or cold stress conditions. By contrast, AtGRP2- or AtGRP7-expressing transgenic rice plants showed much higher recovery rates and grain yields compared with the wild-type plants under drought stress conditions. The higher grain yield of the transgenic rice plants was due to the increases in filled grain numbers per panicle. Collectively, the present results show the importance of posttranscriptional regulation of RNA metabolism in plant response to environmental stress and suggest that GRPs can be utilized to improve the yield potential of crops under stress conditions. © 2013 Elsevier Ireland Ltd. All rights reserved.
1. Introduction With the increasing information on the genome sequences of diverse plant species, it is imperative to utilize the wealth of genomic information for the enhancement of crop yield potentials. A variety of strategies, including conventional hybridization and selection, F1 hybrid breeding, modification of plant architecture, and enhancement of plant growth and development by genetic transformation, can be used to increase the yield potential of crops [1]. Considering the fact that climate changes encountered during recent years cause adverse environmental conditions that greatly diminish crop yields, it is particularly challenging to utilize these strategies to develop economic crops that can maintain high yield potentials under stressful conditions. Plant response and adaptation to changing environmental conditions as well as the maintenance of high yield potentials under adverse conditions are the
Abbreviations: CSP, cold shock protein; GRP, glycine-rich RNA-binding protein; RBP, RNA-binding protein. ∗ Corresponding author. Tel.: +82 62 530 2181; fax: +82 62 530 2069. E-mail address: [email protected] (H. Kang). 0168-9452/$ – see front matter © 2013 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.plantsci.2013.10.006
results of regulated gene expression in plants, which includes both transcriptional and posttranscriptional regulation. In recent years, posttranscriptional regulation of RNA metabolism is increasingly recognized as a key regulatory process in plant growth, development, and stress responses [2,3]. The regulation of RNA metabolism at the posttranscriptional level includes mRNA splicing, capping, polyadenylation, transport, turnover, and translation. These posttranscriptional events have been shown to play important roles in the response of plants to a variety of environmental stresses [2,4]. The regulation of posttranscriptional RNA metabolism is largely achieved by diverse RNA-binding proteins (RBPs), and identification and characterization of RBPs from different plant species is an indispensible step to better understand a variety of cellular processes. RBPs consist of one or more RNA-binding domains and a variety of auxiliary motifs, such as glycine-rich, arginine-rich, RD-repeat, SR-repeat, and CCHC-type zinc finger motifs, at the Cterminus [5,6]. Among the various types of RBPs, proteins that contain an RNA-recognition motif (RRM) at the N-terminus and a glycine-rich region at the C-terminus, thus named as glycine-rich RNA-binding proteins (GRPs), were found ubiquitously in diverse plant species [7], and the stress-responsive expression of GRPs has been investigated in plants under different environmental stress
D.H. Yang et al. / Plant Science 214 (2014) 106–112
conditions [8–15]. The highly modulated expression of GRPs in plants under different stress conditions suggests that GRPs may be involved in plant response to changing environmental conditions [16,17]. With their discovery from diverse plant species, the biological functions of several GRPs have been increasingly demonstrated in recent years. It has been shown that several family members of GRPs in Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa) enhanced seed germination, seedling growth, and freezing tolerance of plants under stress conditions [18–22]. Moreover, it has been demonstrated that certain family members of GRPs exhibit RNA chaperone activity during cold adaptation [21–24]. In addition, GRP from Limonium bicolor was demonstrated to enhance salt tolerance in transgenic tobacco [15], and OsGRP4 from rice has been shown to be involved in high temperature stress response [25]. Although these studies greatly contributed to our understanding of the biological roles of RBPs in Arabidopsis and tobacco under stress conditions, reports demonstrating the functional roles of RBPs in crops under stress conditions are severely limited. The possible utilization of RBPs possessing RNA chaperone activity to develop stress-tolerant crops has recently been demonstrated; cold shock protein (CSP) CspA and CspB, the bacterial RNA chaperones, could be used to improve the cold or drought stress tolerance of rice and maize [26], which opened new avenues of research involving the use of RNA chaperones as a means to improve crop performance under stress conditions. It has been shown that Arabidopsis AtGRP2 and AtGRP7 contribute to enhance seed germination and seedling growth of the plants under cold stress, and also confer freezing tolerance [19,20]. In particular, it was demonstrated that the ability of AtGRP2 and AtGRP7 to enhance cold tolerance is closely related with their RNA chaperone activity [20,24]. Given that AtGRP2 and AtGRP7 possess RNA chaperone activity and contribute to enhance stress tolerance in Arabidopsis, we attempted to determine whether these AtGRPs can confer stress tolerance in rice. This study provides evidences that AtGRP2 and AtGRP7 can be used as a potential modulator to improve rice performance under drought stress conditions.
107
maintaining green leaves were decided as surviving plants. For drought stress treatment for the plants grown in pots, water was withheld for 2 days, and water was supplied and recovery rates were measured 3–4 days after recovery. For the measurement of chlorophyll contents, leaf samples were cut into small pieces and were heated at 80 ◦ C for 20 min in 95% ethanol solution to extract chlorophyll. Chlorophyll contents were calculated based on the absorbance at 648 and 664 nm [27]. 2.3. Measurement of growth and grain yield under stress conditions The wild-type and transgenic rice plants expressing AtGRP2 or AtGRP7 were grown in soil until bolting stage under normal growth conditions. Two days after bolting, the rice plants were subjected to drought stress by withholding water for 3 days. The plants were recovered with the addition of water and grown under normal growth conditions. Several parameters, including culm length, panicle length, number of panicle per hill, number of grains per panicle, filled grain number, and grain weight per plantlet, were measured to compare yield potentials between the wild-type and transgenic plants. 2.4. RNA extraction and quantitative real-time RT-PCR Total RNA was extracted from the rice plants using a Plant RNeasy extraction kit (Qiagen, USA). The real-time quantification of RNA targets was performed in the Rotor-Gene Q real-time thermal cycling system (Qiagen) using QuantiTect SYBR Green RT-PCR kit (Qiagen) as previously described [28]. The reaction mixture contained 200 ng of total RNA, 0.5 M of each primer listed in Table 1, and appropriate amounts of enzymes and fluorescent dyes as recommended by the manufacturer. Control RT-PCR was performed with the same amount of total RNA using the primer pair specific to the ubiquitin gene. The experiments were repeated three times with different batches of RNA samples.
2. Materials and methods 2.5. Statistical analysis 2.1. Plant materials The wild-type rice plant used in this study was Donjin variety. To generate transgenic rice plants expressing Arabidopsis AtGRP2 or AtGRP7, the cDNAs encoding AtGRP2 or AtGRP7 were cloned into the pGA1611 vector which expresses target genes under the control of ubiquitin promoter. After selecting the transgenic plants in the medium containing hygromycin (50 mg/L), the insertion of AtGRP2 or AtGRP7 was verified by gDNA PCR analysis. Gnomic DNAs were extracted from the plant tissues using Genomic DNA extraction kit (iNtRON), and PCR was performed using the gene-specific primer pairs listed in Table 1. The T3 transgenic lines were selected and utilized for phenotype analysis. The expression of AtGRP2 or AtGRP7 in each transgenic rice plant was confirmed by RT-PCR analysis using the primer pairs listed in Table 1. 2.2. Drought stress treatment The wild-type and transgenic rice plants expressing AtGRP2 or AtGRP7 were grown in either 1/20 Hoagland solution or soil at 25 ± 2 ◦ C under 16-h-light/8-h-dark photocycle. For drought stress treatment for the plants grown in Hoagland solution, fifteen seedlings at 2–3 leaf stage were removed from the nutrient solution and were placed on filter paper for 9 h. The plants were resupplied with 1/20 Hoagland solution, and recovery rates (no. of surviving plants/no. of total plants) and chlorophyll contents were measured 1 week after recovery. For recovery rate measurement, the plants
Data were square root-transformed prior to analysis, and differences between the samples were compared by t-test (P ≤ 0.05; SIGMAPLOT software; Systat Software Inc.). 3. Results 3.1. Generation and selection of transgenic rice plants To examine whether Arabidopsis AtGRP2 and AtGRP7 can enhance stress tolerance in rice, transgenic rice plants expressing AtGRP2 or AtGRP7 under the control of ubiquitin promoter were generated. Multiple transgenic lines were selected in the medium containing hygromycin, and the insertion of AtGRP2 or AtGRP7 was verified by gDNA PCR analysis (Fig. 1A). The stressresponsive phenotypes of the wild-type and multiple transgenic lines were first analyzed in Hoagland solution. Among drought, high salt, or cold stress tested in this study, no significant differences in seedling growth were observed between the wild-type and transgenic plants under high salt or cold stress conditions (data not shown). By contrast, when the seedlings were subjected to drought stress by withholding water for 9 h, the recovery rates (no. of surviving plants/no. of total plants) of the plants were significantly different in that several transgenic lines, including GRP2-3, GRP2-16, GRP2-22, GRP2-33, GRP7-31, GRP7-33, GRP7-37, and GRP7-42, were more tolerant against drought stress than the wildtype plants (Fig. 1B). Among the multiple transgenic lines showing
108
D.H. Yang et al. / Plant Science 214 (2014) 106–112
Table 1 Gene-specific primer pairs used in RT-PCR experiments. Genes
Primers (5 –3 )a
AtGRP2 AtGRP7 OsRab21 OsDip1 OsOSE2 OsPBZ1 OsNAC10 NCED KUP3 HAK5 MutS4 LRR PER OsUbi
F; ATGGCTTTCTGTAACAAACTCGGTG F; TTACCATCCTCCACCACCACC F; GATGGGAGGAAGGAGGAAGAA F; GTGAGACCAGGCCATGGTTG F; TCAGTTGCCATCCCCATACA F; GCGATGGCTCCTGTGTGG F; TTCTCCTCGACGGCTCATCC F; ACGGCGGAGAAGTTCATCTA F; GGTCACCGGAGGAAGAGATG F; GTCTATTCCACGCCGCAAGT F; CGCGTATTCACACGGATTGG F; GCGGTTATCCAACTGAACCA F; TCACTGCCAAGTGGATGAAG F; CCCTGACTGGCAAGACCATCACAC
a
R; TTAGAAACCACCACCACCATCACCAC R; ATGGCGTCCGGTGATGTTGAG R; TGCTGGTTGTTGCCCTTGT R; TGCAGTGCAGAAAAAGCACC R; CGCAACTAGGCTACTGCCG R; CTCCGGCGACAGTGAGCT R; ATGGATGGCTCAGCAGATTG R; AATGAAGGTGCCGTGCAATC R; CTTGTACAGCATGCCGATCT R; ATGGAGAGTCACGCAAGCAA R; TCACAGCAGCTCCATGCAAT R; GGTTGACCAAGAGTCACTAC R; GTGTCGTGCGATGAATCCTA R; TTGACGAAGATCTGCATACCACCC
F, forward primers; R, reverse primers.
drought-tolerant phenotype, four lines (GRP2-16, GRP2-22, GRP731, and GRP7-42) were selected for further analysis. 3.2. Drought stress tolerance of the transgenic rice plants To further investigate whether AtGRP2 and AtGRP7 enhance drought stress tolerance in rice, the stress-responsive phenotypes of the four selected lines (GRP2-16, GRP2-22, GRP7-31, and GRP742) were analyzed in more detail. The expression of AtGRP2 or AtGRP7 in the transgenic rice plants was confirmed by RT-PCR analysis (Fig. 2A). When the wild-type and transgenic rice plants were grown under normal growth conditions, no differences in seedling growth were observed between the genotypes (Fig. 2B). The wildtype and transgenic rice plants were subjected to drought stress by withholding water for 9 h, and recovery rates were measured 1 week after re-watering. The recovery rates of the wild-type plants
Fig. 1. Generation and selection of transgenic rice plants. (A) Genomic DNA PCR was conducted to verify the insertion of Arabidopsis AtGRP2 or AtGRP7 in each transgenic rice plant. WT, wild-type plant. (B) The wild-type (WT) and transgenic rice plants expressing AtGRP2 or AtGRP7 were grown in Hoagland solution until 2–3 leaf stage and subjected to drought stress for 9 h. The recovery rates were measured 1 week after re-watering. The experiments were repeated three times, and the values are means ± SE (n = 15).
were approximately 4%, whereas the recovery rates of the transgenic plants were approximately 19–24% (Fig. 2B), indicating that the transgenic plants expressing AtGRP2 or AtGRP7 were more tolerant to drought stress than the wild-type plants. The stress-responsive phenotypes of the four selected lines were also analyzed in soil. When grown under normal growth conditions, no differences in plant growth were observed between the wild-type and transgenic rice plants (Fig. 3). Next, the wild-type
Fig. 2. Drought-responsive phenotypes of the transgenic rice plants. (A) Expression of AtGRPs in four transgenic lines (GRP2-16, GRP2-22, GRP7-31, and GRP7-42) selected for further phenotype analysis was confirmed by RT-PCR analysis. (B) The wild-type (WT) and transgenic rice plants expressing AtGRP2 or AtGRP7 were grown in Hoagland solution until 2–3 leaf stage and subjected to drought stress for 9 h. The recovery rates were measured 1 week after re-watering. The experiments were repeated three times, and the values under each transgenic line number represent mean recovery rate ± SE (n = 15).
D.H. Yang et al. / Plant Science 214 (2014) 106–112
109
drought stress by withholding water for 3 days, during which the soil humidity was decreased to 12 ± 1%. The plants were recovered with resupplying water and grown under normal growth conditions until maturity. Several parameters, including culm length, panicle length, panicle number per hill, filled grain number per panicle, and grain yield per plant, were used to determine the severity of drought stress at the time of maturity. No significant differences in culm length, panicle length, and panicle number per hill were observed between the wild-type and transgenic rice plants subjected to drought stress (Fig. 4). However, the filled grain numbers per panicle of the transgenic plants were significantly higher than those of the wild-type plants (Fig. 4). The wild-type rice plants grown under normal growth conditions contained approximately 70 filled grains per panicle. When subjected to drought stress, the wild-type rice plants contained approximately 15 filled grains per panicle, whereas the transgenic rice plants contained approximately 40–60 filled grains per panicle (Fig. 4). The grain yields of the wild-type and transgenic rice plants were approximately 10 g per plant under normal growth conditions. When subjected to drought stress, the grain yield of the wild-type plants was decreased significantly down to approximately 1 g per plant. By contrast, the grain yield of the transgenic rice plants expressing AtGRP2 or AtGRP7 was approximately 4–6 g per plant under drought stress conditions (Fig. 4). These results indicate that expression of AtGRP2 or AtGRP7 contributed to the increases in filled grain number per panicle, which resulted in enhanced grain yield of the transgenic rice plants under drought stress conditions. 3.4. AtGRP2 and AtGRP7 affected the expression of drought stress-responsive genes
Fig. 3. Drought-tolerant phenotypes of the transgenic rice plants. The wild-type (WT) and transgenic rice plants expressing AtGRP2 (2–16 and 2–22) or AtGRP7 (7–31 and 7–42) were grown in soil until 2–3 leaf stage, and the seedlings were subjected to drought stress by withholding water until half of the leaves became dry or wilt. After recovery with re-watering, the severity of damage was investigated and the chlorophyll contents were measured. The experiments were repeated three times, and the values are means ± SE (n = 10). Asterisks above the columns indicate values that are statistically different from the control (WT) values (p < 0.05).
and transgenic rice plants were subjected to drought stress by withholding water until half of the leaves became dry or wilted, and the severity of damage was investigated after recovery with re-watering. As shown in Fig. 3, the transgenic plants expressing AtGRP2 or AtGRP7 were much healthier that the wild-type plants after recovery. As another measure of stress tolerance, chlorophyll contents were analyzed in the plants. Results showed that chlorophyll contents in the transgenic lines were much higher than those in the wild-type plants (Fig. 3), indicating that the transgenic plants expressing AtGRP2 or AtGRP7 were more tolerant to drought stress than the wild-type plants. 3.3. AtGRP2 and AtGRP7 enhanced grain yield under drought stress conditions To further determine whether AtGRP2 and AtGRP7 contribute to enhance grain yield of rice under drought stress conditions, the growth and productivity of the four selected lines were analyzed at maturation stage in soil. The wild-type and transgenic rice plants expressing AtGRP2 or AtGRP7 were grown in soil until bolting stage under normal growth conditions, and then subjected to
To get some clues on how AtGRP2 and AtGRP7 contributed to enhance grain yield of the transgenic rice plants under drought stress conditions, the expression levels of several drought stressresponsive genes were analyzed by real-time RT-PCR. The drought stress-responsive genes investigated in this study include NAC10, P450, KUP3, HAK5, MutS4, LRR, Rab21, Dip1, OSE2, and PBZ1, the expression of which is highly modulated in rice under drought stress conditions [29,30]. The expression levels of these stressresponsive genes were similar in the wild-type and transgenic plants under normal growth conditions (data not shown). However, the transcript levels of several genes, including OSE2, Dip1, PBZ1, and LRR, were marginally up-regulated in the AtGRP2- or AtGRP7expressing transgenic plants compared with the wild-type plants under drought stress conditions (Fig. 5). These results suggest that modulation of the expression of a subset of stress-responsive genes was related to the increased drought tolerance of the transgenic rice plants. 4. Discussion This study demonstrates that RBPs possessing RNA chaperone activity can be utilized as a potential means to develop stresstolerant crops. The present data clearly showed that AtGRP2 and AtGRP7 contribute to enhance drought stress tolerance of rice at both vegetative and reproductive stages with enhanced grain yield. Compared with many other transgenic approaches, e.g. utilizing transcription factors, which could increase stress tolerance but resulted in undesirable side effects such as diminished plant height and development, our approach utilizing AtGRP2 or AtGRP7 possessing RNA chaperone activity did not result in any detrimental effects on plant size and productivity under normal growth conditions (Fig. 4). The potential utilization of the proteins harboring RNA chaperone activity for the generation of transgenic crops without any detrimental effects has previously been demonstrated for CspA
110
D.H. Yang et al. / Plant Science 214 (2014) 106–112
Fig. 4. Growth parameters and grain yield of the transgenic rice plants under drought stress conditions. The wild-type (WT) and transgenic rice plants expressing AtGRP2 (2–16 and 2–22) or AtGRP7 (7–31 and 7–42) were grown in soil until bolting, and the plants at 2 days after bolting were subjected to drought stress by withholding water until soil humidity decreased down to 12%. After recovery with re-watering, the growth parameters and grain yield of each plant were measured. The values are means ± SE (n = 10), and asterisks above the columns indicate values that are statistically different from the control (WT) values under drought stress conditions (p < 0.05). WT-Norm; wild-type grown under normal conditions.
and CspB, the bacterial RNA chaperones, in maize and rice under drought, heat, or cold stress conditions [26]. Clearly, engineering the proteins with RNA chaperone activity can be a potential means to develop multiple stress-tolerant crops. Although the molecular mechanism underlying AtGRP2- or AtGRP7-mediated stress tolerance in transgenic rice is unclear at present, the RNA chaperone activity of GRPs should be necessary for improving stress tolerance in rice. In a previous study by Castiglioni et al. [26], expression of the mutant CspB protein that does not exhibit RNA chaperone activity resulted in no beneficial effects on
grain yield of maize under water-deficit conditions, which emphasizes the requirement of effective RNA chaperone activity to confer yield benefits under water stress. RNA chaperones are nonspecific RNA-binding proteins that aid RNA folding process by structural rearrangement of RNA molecules [31,32]. The functional roles of RBPs possessing RNA chaperone activity have been demonstrated in diverse plant species including Arabidopsis, rice, and winter wheat [18,19,33–39]. In particular, it has been determined that AtGRP2 and AtGRP7 possess RNA chaperone activity during stress tolerance in Arabidopsis and E. coli [20,24]. It is likely that the
D.H. Yang et al. / Plant Science 214 (2014) 106–112
2.5 2
OSE2 *
2.5
*
*
Expresssion (fold control)
1.5
*
0.5
0.5
0
0
2
*
*
*
*
2.5 2
1.5
1.5
1
1
0.5
0.5
0
*
1.5 1
PBZ1
Dip1
2
1
2.5
111
*
*
*
*
*
LRR *
*
0
WT 2-16 2-22 7-31 7-42
WT 2-16 2-22 7-31 7-42
Fig. 5. Transcript levels of the drought stress-responsive genes in the transgenic rice plants under drought stress conditions. Three-week-old wild-type (WT) and transgenic rice plants expressing AtGRP2 (2–16 and 2–22) or AtGRP7 (7–31 and 7–42) were subjected to drought stress, and the expression of the drought stress-responsive genes was analyzed 24 h after drought treatment by real-time RT-PCR. The experiments were repeated three times, and the values are means ± SE. Asterisks above the columns indicate values that are statistically different from the control (WT) values (p < 0.05).
RNA chaperone activity of AtGRP2 and AtGRP7 is involved in the regulation of RNA metabolism in rice, which results in increased yield benefits of rice plants under drought stress conditions. Next remaining question is to determine the target mRNAs in rice regulated by AtGRP2 or AtGRP7 under drought stress conditions. Our target-oriented analysis showed that the transcript levels of several drought stress-responsive genes, including OSE2, Dip1, PBZ1, and LRR, were marginally up-regulated in the AtGRP2- or AtGRP7expressing transgenic plants compared with the wild-type plants under drought stress conditions (Fig. 5). These results suggest that modulation of the expression of a subset of stress-responsive genes is related to the increased drought tolerance of the transgenic rice plants. However, we analyzed the expression levels of only a limited number of genes, and it is possible that many other stressresponsive genes are also regulated in the transgenic rice plants. Although it is not clear at present whether AtGRP2 and AtGRP7 affect directly or indirectly the transcript levels of stress-responsive genes, it is likely that AtGRP2 and AtGRP7 modulate the transcript levels of the genes either by directly regulating the processing or stability of mRNAs or by indirectly influencing the transcription of the genes via interaction with upstream protein factors that regulate the transcript levels of the stress-responsive genes. It should be interesting to further determine how the ectopic expression of Arabidopsis AtGRP2 and AtGRP7 influences the expression of stress-responsive genes in transgenic rice plants, which results in increased stress tolerance and enhanced grain yield of rice plants under drought stress conditions. In conclusion, the present study shows that GRPs harboring RNA chaperone activity can be utilized as a potential means to develop stress-tolerant crops. As evidenced from the current and previous analysis of transgenic crops expressing GRPs or CSPs, the proteins possessing RNA chaperone activity, posttranscriptional control of RNA processing and metabolism is an important level of regulation in plant adjustment to adverse environmental conditions. The fact that expression of GRPs or CSPs does not have any detrimental effect on the growth, development, or productivity of crop plants under normal growth conditions is another bright point of
utilizing these proteins in the development of stress-tolerant transgenic crops. Further studies should focus on the elucidation of the cellular mechanisms underlying GRP-mediated stress tolerance in crop plants. Acknowledgments This work was supported by grant from the Next-Generation BioGreen21 Program (PJ00820303), Rural Development Administration, Republic of Korea and by grant from the Mid-career Researcher Program through a National Research Foundation of Korea grant funded by the Ministry of Education, Science and Technology (2011-0017357). References [1] J.-S. Jeon, K.-H. Jung, H.-B. Kim, J.-P. Suh, G.S. Khush, Genetic and molecular insights into the enhancement of rice yield potential, J. Plant Biol. 54 (2011) 1–9. ´ Role of plant RNA-binding proteins in development, stress [2] Z.J. Lorkovic, response and genome organization, Trends Plant Sci. 14 (2009) 229–236. [3] H.J. Jung, S.J. Park, H. Kang, Regulation of RNA metabolism in plant development and stress responses, J. Plant Biol. 56 (2013) 123–129. [4] M. Floris, H. Mahgoub, E. Lanet, C. Robaglia, B. Menand, Post-transcriptional regulation of gene expression in plants during abiotic stress, Int. J. Mol. Sci. 10 (2009) 3168–3185. [5] C.G. Burd, G. Dreyfuss, Conserved structures and diversity of functions of RNAbinding proteins, Science 265 (1994) 615–621. [6] M.M. Albà, M. Pagès, Plant proteins containing the RNA-recognition motif, Trends Plant Sci. 3 (1998) 15–21. ´ A. Barta, Genomic analysis: RNA recognition motif (RRM) and K [7] Z.J. Lorkovic, homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana, Nucleic Acids Res. 30 (2002) 623–635. [8] M.K. Kim, H.J. Jung, D.H. Kim, H. Kang, Characterization of glycine-rich RNAbinding proteins in Brassica napus under stress conditions, Physiol. Plant. 146 (2012) 297–307. [9] D.P. Horvath, P.A. Olson, Cloning and characterization of cold-regulated glycine-rich RNA-binding protein genes from leafy spurge (Euphorbia esula L.) and comparison to heterologous genomic clones, Plant Mol. Biol. 38 (1998) 531–538. [10] N.S.M. Aneeta, N. Tuteja, S.K. Sopory, Salinity- and ABA-induced up-regulation and light-mediated modulation of mRNA encoding glycine-rich RNA-binding
112
[11]
[12]
[13]
[14]
[15]
[16]
[17] [18]
[19]
[20]
[21]
[22]
[23]
[24]
D.H. Yang et al. / Plant Science 214 (2014) 106–112 protein from Sorghum bicolor, Biochem. Biophys. Res. Commun. 296 (2002) 1063–1068. J.R. Stephen, K.C. Dent, W.E. Finch-Savage, A cDNA encoding a cold-induced glycine-rich RNA binding protein from Prunus avium expressed in embryonic axes, Gene 320 (2003) 177–183. T. Nomata, Y. Kabeya, N. Sato, Cloning and characterization of glycine-rich RNAbinding protein cDNAs in the moss Physcomitrella patens, Plant Cell Physiol. 45 (2004) 48–56. H. Shinozuka, H. Hisano, S. Yoneyama, Y. Shimamoto, E.S. Jones, J.W. Forster, T. Yamada, A. Kanazawa, Gene expression and genetic mapping analyses of a perennial ryegrass glycine-rich RNA-binding protein gene suggest a role in cold adaptation, Mol. Genet. Genomics 275 (2006) 399–408. X. Chen, Q.-C Zeng, X.-P Lu, D.-Q Yu, W.-Z Li, Characterization and expression analysis of four glycine-rich RNA-binding proteins involved in osmotic response in tobacco (Nicotiana tabacum cv. Xanthi), Agri. Sci. China 9 (2010) 1577–1587. C. Wang, D.W. Zhang, Y.C. Wang, L. Zheng, C.P. Yang, A glycine-rich RNA-binding protein can mediate physiological responses in transgenic plants under salt stress, Mol. Biol. Rep. 39 (2012) 1047–1053. G. Sachetto-Martins, L.O. Franco, D.E. de Oliveira, Plant glycine-rich proteins: a family or just proteins with a common motif? Biochim. Biophys. Acta 1492 (2000) 1–14. A. Mangeon, R.M. Junqueira, G. Sachetto-Martins, Functional diversity of the plant glycine-rich proteins superfamily, Plant Signal. Behav. 5 (2010) 99–104. Y.O. Kim, J.S. Kim, H. Kang, Cold-inducible zinc finger-containing glycine-rich RNA-binding protein contributes to the enhancement of freezing tolerance in Arabidopsis thaliana, Plant J. 42 (2005) 890–900. J.Y. Kim, S.J. Park, B. Jang, C.-H. Jung, S.J. Ahn, C.-H. Goh, K. Cho, O. Han, H. Kang, Functional characterization of a glycine-rich RNA-binding protein2 in Arabidopsis thaliana under abiotic stress conditions, Plant J. 50 (2007) 439–451. J.S. Kim, H.J. Jung, H.J. Lee, K.A. Kim, C.-H. Goh, Y. Woo, S.H. Oh, Y.S. Han, H. Kang, Glycine-rich RNA-binding protein7 affects abiotic stress responses by regulating stomata opening and closing in Arabidopsis thaliana, Plant J. 55 (2008) 455–466. J.Y. Kim, W.Y. Kim, K.J. Kwak, S.H. Oh, Y.S. Han, H. Kang, Glycine-rich RNAbinding proteins are functionally conserved in Arabidopsis thaliana and Oryza sativa during cold adaptation process, J. Exp. Bot. 61 (2010) 2317–2325. J.Y. Kim, W.Y. Kim, K.J. Kwak, S.H. Oh, Y.S. Han, H. Kang, Zinc finger-containing glycine-rich RNA-binding protein in Oryza sativa has an RNA chaperone activity under cold stress conditions, Plant Cell Environ. 33 (2010) 759–768. Y.O. Kim, H. Kang, The role of a zinc finger-containing glycine-rich RNA-binding protein during the cold adaptation process in Arabidopsis thaliana, Plant Cell Physiol. 47 (2006) 793–798. J.S. Kim, S.J. Park, K.J. Kwak, Y.O. Kim, J.Y. Kim, J. Song, B. Jang, C.-H. Jung, H. Kang, Cold shock domain proteins and glycine-rich RNA-binding proteins from
[25]
[26]
[27] [28]
[29]
[30]
[31] [32]
[33]
[34] [35]
[36] [37] [38]
[39]
Arabidopsis thaliana can promote the cold adaptation process in E. coli, Nucleic Acids Res. 35 (2007) 506–516. C. Sahi, M. Agarwal, A. Singh, A. Grover, Molecular characterization of a novel isoform of rice (Oryza sativa L.) glycine rich-RNA binding protein and evidence for its involvement in high temperature stress response, Plant Sci. 173 (2007) 144–155. P. Castiglioni, D. Warner, R.J. Bensen, D.C. Anstrom, J. Harrison, M. Stoecker, M. Abad, G. Kumar, S. Salvador, R. D’Ordine, et al., Bacterial RNA chaperones confer abiotic stress tolerance in plants and improved grain yield in maize under water-limited conditions, Plant Physiol. 147 (2008) 446–455. H.K. Lichtenthaler, Chlorophylls and carotenoids. Pigments of photosynthetic biomembranes, Methods Enzymol. 148 (1987) 350–382. K.J. Kwak, Y.O. Kim, H. Kang, Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress, J. Exp. Bot. 56 (2005) 3007–3016. J.S. Jeong, Y.S. Kim, K.H. Baek, H. Jung, S.-H. Ha, Y.D. Choi, M. Kim, C. Reuzeau, J.-K. Kim, Root specific expression of the transcription factor OsNac10 in rice enhances grain yield under drought conditions, Plant Physiol. 153 (2010) 185–197. ˜ S. Campo, C. Peris-Peris, L. Montesinos, G. Penas, J. Messeguer, B.S. Segundo, Expression of the maize ZmGF14-6 gene in rice confers tolerance to drought stress while enhancing susceptibility to pathogen infection, J. Exp. Bot. 63 (2012) 983–999. D. Herschlag, RNA chaperones and the RNA folding problem, J. Biol. Chem. 270 (1995) 20871–20874. L. Rajkowitsch, D. Chen, S. Stampfl, K. Semrad, C. Waldsich, O. Mayer, M.F. Jantsch, R. Konrat, U. Bläsi, R. Schroeder, RNA chaperones, RNA annealers and RNA helicases, RNA Biol. 4 (2007) 118–130. D. Karlson, K. Nakaminami, T. Toyomasu, R. Imai, A cold-regulated nucleic acidbinding protein of winter wheat shares a domain with bacterial cold shock proteins, J. Biol. Chem. 277 (2002) 35248–35256. D. Karlson, R. Imai, Conservation of the cold shock domain protein family in plants, Plant Physiol. 131 (2003) 12–15. K. Nakaminami, D. Karlson, R. Imai, Functional conservation of cold shock domains in bacteria and higher plants, Proc. Natl. Acad. Sci. USA 103 (2006) 10122–10127. V. Chaikam, D. Karlson, Functional characterization of two cold shock domain proteins from Oryza sativa, Plant Cell Environ. 31 (2008) 995–1006. M.H. Kim, K. Sasaki, R. Imai, Cold shock domain protein 3 regulates freezing tolerance in Arabidopsis thaliana, J. Biol. Chem. 284 (2009) 23454–23460. S.J. Park, K.J. Kwak, T.R. Oh, Y.O. Kim, H. Kang, Cold shock domain proteins affect seed germination and growth of Arabidopsis thaliana under abiotic stress conditions, Plant Cell Physiol. 50 (2009) 869–878. H. Kang, S.J. Park, K.J. Kwak, Plant RNA chaperones in stress response, Trends Plant Sci. 18 (2013) 100–106.
