Microbial Pathogenesis 1992 ; 12 : 383-389
Short communication Expression of Bordetella pertussis filamentous hemagglutinin in Escherichia coil using a two cistron system Carlos A . Guzman,"' Mark J . Walker, 2 Manfred Rohde and Kenneth N . Timmis
Department of Microbiology, GBF-National Research Centre for Biotechnology, Braunschweig, Germany (Received November 20,1991 ; accepted in revised form January 14, 1992)
Guzman, C . A . (Dept of Microbiology, GBF-National Research Centre for Biotechnology, Braunschweig, Germany), M . J . Walker, M . Rohde and K . N . Timmis. Expression of Bordetella pertussis filamentous hemagglutinin in Escherichia coli using a two cistron system . Microbial Pathogenesis 1992 ; 12 : 383-389 . Expression of Bordetella pertussis filamentous hemagglutinin (FHA) has been achieved in Escherichia coli K-12 . This involved the construction of a two cistron system where the first cistron was provided by the NI-1 2 -terminus (first 98 amino acids) of MS2 polymerase . When the FHA gene sequences were fused to the first cistron, higher levels of expression were obtained and the fusion protein aggregated in inclusion bodies . FHA expressed by the two cistron system, however, appeared to be diffusely dispersed in the cytoplasm .
Key words : Bordetella pertussis ; filamentous hemagglutinin ; gene expression ; recombinant protein ; two cistron system .
Introduction There are many virulence traits produced by Bordete/la pertussis which are potential antigens for inclusion in a new generation of subunit vaccines highly immunogenic and non-reactogenic .' Filamentous hemagglutinin (FHA) is a major candidate because it mediates the early interactions with respiratory tract epithelial cells which are essential for colonization and production of disease ."' Moreover, in experimental animal models, immunization with purified FHA provided protection against B. pertussis infection .' The purification of FHA from B . pertussis for production of subunit vaccines is associated with important problems, such as the fermentation of a pathogenic microorganism, slow growth rates, poor yields, the possibility of copurification of other reactogenic factors and lack of an efficiently regulated promotor that can be highly induced under process conditions . Previous efforts have lead to the production in
'Present addresses : 'Institute of Microbiology, University of Genoa, Viale Benedetto XV, 10, 16132Genoa, Italy and 'University of Wollongong, Department of Biology, Wollongong, N .S .W . 2500, Australia . 0882-4010/92/050383+07 $03 .00/0
© 1992 Academic Press Limited
384
C . A . Guzman et al.
Escherichia coli of recombinant FHA fusion protein S,4,5 but these, despite the high yields obtained, are unacceptable for vaccine purposes . Truncated forms of FHA have also been obtained, but these are poor inducers of mucosal SIgA immune responses . 4,6 ' Many factors influence the expression of recombinant proteins . In a recent study we described the production of full-length recombinant FHA in E. co/i and Salmonella typhimurium$ after optimizing factors including mRNA stability, codon usage and translational efficiency . In this study we explored an alternative strategy to overcome the problem of low translational efficiency by the use of a two cistron system . This approach has proved to be successful for the overexpression of several recombinant proteins including human proinsulin, and bovine and human growth hormones .' , " The 5' end of the mRNA sequence corresponding to the first cistron must be free of local secondary structures in the translation initiation region, allowing efficient binding of the ribosome to the Shine-Dalgarno (SD) sequence and optimization of translation initiation . The ribosomes bound to the first cistron must also disrupt, during the protein synthesis, the secondary structures present downstream in the mRNA sequence corresponding to the second cistron which contains the FHA coding information . The recombinant non-fused FHA obtained by this method could be useful for inclusion in subunit vaccines against whooping cough . Results Production of fusion proteins containing FHA Cosmid pRMB2," contains the first 10 kb of the fhaB open reading frame (ORF) . Subfragments of the fhaB gene were cloned into pUC18Not1 12 and then transferred as EcoRl-HindIll inserts into the corresponding sites of plasmid cloning vectors pEX31 A and pEX31 B 13 (Fig . 1) to obtain hybrid proteins consisting of the NH 2 terminal 98 amino acids of the MS2 polymerase protein fused in frame to C-terminal fragments of FHA. Hybrid plasmids were subsequently transformed into E. co/i 537 (pC1857 rs ) 14 which is temperature sensitive for the lambda repressor activity . Whole cell extracts obtained from bacteria induced by growth at 42°C were subjected to Western blot analysis . These fusion proteins were used for a qualitative comparison with the product obtained using the two cistron system (see below) . Hybrid plasmids pCG24 (3 .6 kb Bg/I I-B am H I insert) and pCG17 (2 .4 kb Bam H I-Bam H I insert) reacted only with the rabbit polyclonal anti-FHA antibody [Fig . 1 (c) and (d)] . Clone pCG22 (4 .7 kb Bam HI-Bam H I insert) reacted with both the polyclonal and P121-13 monoclonal antibodies [Fig . 1 (c) and (d)], indicating that the epitope recognized by the P12H3 hybridoma is encoded by sequences present on the 1 .0 kb BamHI-Bg/I l fragment of the fhaB ORF . The recombinant fusion proteins appeared as a major band and many minor bands [Fig . 1(b), (c) and (d)] ; extension of the induction time up to 9 h did not affect FHA yields or Western blot patterns (not shown), suggesting that the protein produced was neither toxic for the cells nor degradated extensively by proteases . Expression of FHA using a two cistron system Hybrid plasmid pCG16 was constructed in a similar fashion and contains the 8 .4 kb Sphl-Sphl DNA fragment . This fragment was cloned downstream of the TAG stop codon present in the Xbal site of the multiple cloning site of pUC18Notl . When this fragment was excised as a EcoRl-Hindlll insert and introduced into pEX31A, the stop codon was in frame with the MS2 polymerase sequence of the vector . The hybrid plasmid pCG16 specified a product that was recognized by both monoclonal and polyclonal FHA antibodies, expressed at lower levels than the fusion proteins, and was less stable when the induction time was extended [Fig . 1 (c), lanes 6 and 7] . A
38 5
Expression of B . pertussis FHA (a)
fhoB o
=
_
.. _
m
r4 m
y
Western blot W
y
mW
P12H3
Vector
pCGl6
PEX31A
pCG22
I
I
V//,Y/////.1
pCG24
I
I
I
pCGl7
I
(b)
Polyclonal
Y////A
12
3
II
PEX31B
Y/////,Y//11
PEX31A
I II
PEX31B
I
4
5
Monoclonal
+
+
+
+
+
+
6
12
( c )
200 -
3
4
5
6
7
205 -
116 97 116 -
66 -
77 42 46 ~
2
3
4
5
6
7
8
9
10
205 116 77 46-
Aak Fig . 1 . Production of fused and non-fused FHA . (a) The region encoding the epitope recognized by the monoclonal antibody P12H3 is represented by the filler bar . Hatched bars correspond to fhaB gene sequences encoding fusion proteins (pCG22, pCG24 and pCG1 7) or the non-fusion protein in the two cistron system (pCG16) . + and - indicate the reaction of proteins produced by different clones with the monoclonal antibody P12H3 or polyclonal anti-FHA antiserum in Western blots . (b) SDS-PAGE of total cell extracts stained with Coomassie blue . Molecular weight standards (lane 1) ; E. co/i 537 (pCI 857rs) containing pCG24 (lane 2), pCG22 (lane 3), pCG17 (lane 4), pCG16 (lane 5) and pEX31A (lane 6), arrows indicate main protein products . (c) Western blot analysis using monoclonal antibody P12H3 . Molecular weight markers (lane 1) ; purified B . pertussis FHA obtained from Tohama strain (lane 2) ; E. coli 537 (pCI 857rs) containing pEX31 A (lane 3), pCG22 (lanes 4 and 5) and pCG1 6 (lanes 6 and 7) . Lanes 4 and 6 were induced for 30 min while lanes 3, 5 and 7 were induced for 2 h . (d) Western blot analysis using polyclonal antiserum against FHA . Molecular weight markers (lane 1) ; purified B. pertussis FHA (lane 2) ; TS) containing pCG24 (lanes 3 and 7), pCG22 (lanes 4 and 8), pCG17 (lanes 5 and E. coil 537 (pCI 857 9), pCG1 6 (lanes 6 and 10) and pEX31 A (lane 11) . Lanes 3-6 were induced for 30 min while lanes 7-11 were induced for 2 h . Molecular weight standards (kDa) are indicated by arrow heads .
386
C . A. Guzman et a/_
two cistron system has thus been created where the first cistron consists of the first 98 amino acids of the MS2 polymerase and the second of an internal fhaB gene sequence . The intercistronic region is 15 by long with the next available ATG start codon being provided by the Sph I site present in the FHA insert . The FHA start codon is in frame with the stop codon of the first cistron, a characteristic that seems important in obtaining expression . 9,10 At the end of the FHA insert, translation is stopped at a double stop codon (TGA-TGA) 27 bases into the vector (Fig . 2) . In this construction, the first 15 codons of the fhaB ORF present in the 0 .3 kb EcoRI-Sphl fragment s and the FHA COOH-terminus are not present (Fig . 2) . Cellular localization of recombinant FHA by immune electron microscopy Immune electron microscopy demonstrated that in the E. co/i 537 (pCI 857Ts) hybrid strain expressing fusion proteins, FHA accumulated in the cytoplasm as inclusion bodies, while in bacteria containing pCG16 (two cistron system), non-fusion FHA was present in the cytoplasm as a diffuse pattern and inclusion bodies were not observed [Fig . 3(a) and (b)] . The solubility of the recombinant protein could be due both to the lower levels of expression or the absence of the MS2 polymerase NH 2 terminus . Discussion and conclusions Genetic manipulation of pRMB2 resulted in expression of FHA at high level as Cterminal components of fusion proteins containing the N-terminal region of MS2 polymerase . These fusion proteins accumulated as inclusion bodies . At present, methods for solubilizing and refolding inclusion bodies are not so advanced that entirely native protein conformations can be reproducibly obtained . The accumulation of human therapeutic substances and vaccines as inclusion bodies is therefore not desirable . FHA was also expressed in standard E. coil strains as a soluble, unfused protein using a two cistron system, but at somewhat lower levels than the fusion proteins, presumably as a result of proteolytic degradation of the non-fusion protein (fusion proteins are usually more stable) . Alternatively, a non-optimal genetic organization of the two cistron system (Fig . 2) may result in lower yields and early degradation . It is known that several factors including the length of the first cistron ORF, the phasing of the stop codon of the first cistron with respect to the start codon of the second
PEX31A
I
Ribosome binding site MS2-POL 1 98 a ECO RI I I
I
a O Ln
I
GTCATGGGGAATTCGAGCTCGGTACCCGGGGATCCTCTAG -~ ATG first cistron
a a
0 0 Sph I -AGTCGACCTGCAGGCATGC
Intercistronic region 15 bases
FHA
I
M Q A W L P R A F RI N I~1 GCATGCAAGCTTGGCTGCCTCGCGCG111LGGTGATGA 3' Hind III
+I Second cistron
Fig . 2 . Diagrammatic representation of the two cistron system constructed in clone pCG16 . Abbreviations : A-P L, lambda phage P L promotor ; SD, Shine-Dalgarno sequence ; MS2-Pol, first 98 amino acids of MS-2 polymerase; FHA, Sphl/Sphl 8 .4 kb fragment from the fhaB ORF . Amino acids are indicated using one letter code .
Expression of B . pertussis FHA
387
Fig . 3 . Immune electron microscopic localization of recombinant FHA . Induced E. coli 537 (pCI 857Ts) containing pCG22 (a), pCG16 (b) and uninduced E. coli EC537 (pCI 857 Ts) containing pCG22 (c) . Inductions were performed at 42'C for 1 h . Symbols: G, gold particles (10 nm in size) are indicated by large arrows; small arrows indicate inclusion bodies ; bars represent 0 .25 pm .
cistron, the size of the intercistronic region and the presence or absence of a second SD sequence, influence product yield . 9 •1 0 Nevertheless, it should be stressed that both types of recombinant proteins, fusion proteins and the non-fusion protein expressed from the two cistron system were produced at higher levels than FHA from the wildtype B . pertussis Tohama strain (not shown) . The FHA gene ORF extends over 11 kb of DNA . The 220 kDa processed mature protein secreted by B . pertussis is however encoded by the first 6 .2 kb of the FHA ORF . This means that the recombinant protein produced from pCG16 lacks only the first 15 N-terminal amino acids of the mature FHA protein and therefore should contain all the epitopes important for the immune response . The degradation of the recombinant protein observed may not be critical for vaccines purposes . Purified non-fused recombinant FHA obtained from E. coli using the two cistron system may be suitable for inclusion in subunit vaccines against whooping cough . In contrast to the FHA produced in B . pertussis, the recombinant protein has the advantages of the absence of other possibly reactogenic pertussis virulence components and the production by fermentation of a non-pathogenic microorganism with high growth rates and yields . Materials and methods Bacterial strains, plasmids and media . The bacterial strains used in this work were : B. pertussis Tohama 1 .2 serotype; 15 E. coli SURE TI (Stratagene) was used for transformations where
388
C . A . Guzman et al.
recombinant clones were screened for /l-galactosidase a complementation . E. co/i 537 (pCl 857 Ts ) 14 was used in induction experiments for expression of FHA . The plasmids used in this work were : pUC18Notl, 12 pEX31A and pEX31 B 13 and pRMB2 . 1 ' E. co/i strains were grown in Luria broth or on Luria agar ." X-gal medium 76 was used for selection with the f-galactosidase a complementation system . Bordetella pertussis was grown on Bordet Gengou agar base (Difco) supplemented with 1% glycerol and 15% (v/v) defibrinated horse blood or SS-X broth ." Ampicillin (100 ltg/ml) and tetracycline (50 µg/ml) were used when appropriate . DNA manipulations. Plasmids were isolated by alkaline lysis ." Restriction endonuclease digestion, ligation with T4 DNA ligase, dephosphorylation with fetal calf intestine phosphatase and transformation were performed as described by Sambrook et al." Enzymes were obtained from Boehringer Mannheim . Protein and immunological techniques . Induction experiments and FHA purification were performed as previously described .' Approximately 50 µg of protein was electrophoresed according to the procedure of Laemmli 1 S using a 3 .85% acrylamide stacking gel and a 10% acrylamide separating gel . High range molecular weight markers were purchased from Biorad . Western blotting was carried out using polyclonal rabbit antiserum against FHA and the monoclonal antibody P12H3 kindly provided by Dr C . Parker as described .' The blocked membranes were incubated with the first antibody for 2 h, washed three times with PBS (137 mm NaCl, 2 .7 mm KCI, 8 mm Na 2 PO 4 , 1 .5 mm KH 2 HPO4 ) pH 7 .4, and incubated for 1 h with Biorad horse radish peroxidase conjugated goat anti-rabbit or goat anti-mouse IgG . Membranes were washed and then developed using 4-chloro-1 -naphthol as a substrate . Immune electron microscopy. Cells were fixed and embedded by the progressive lowering of temperature method using Lowicryl K4M resin as previously described .' The protein was detected using polyclonal antibodies against FHA that had been cross-adsorbed with E. coli bacteria and purified by affinity chromatography using protein A Sepharose CL-4B . Antibodies bound to sample preparations were visualized by incubation with protein A-gold complexes (gold particle size 10 nm) after preparation of ultrathin sections as previously described .'
We thank C . Parker for the monoclonal antibody P12H3, J . Wehland for assistance in the preparation of rabbit antiserum against FHA, R . Brownlie for pRMB2 and helpful discussions, V. de Lorenzo for suggestions during the early stages of this work and for pUC18Notl, P . Jerlstrom for the strain 537 (pCI857' s ) and pEX31A-B . C . A . Guzman was the recipient of a CEC training fellowship (019942) .
References 1 . Robinson A, Ashworth LAE . Acellular and defined component vaccines against pertussis. In : Wardlaw AC and Parton R, eds . Pathogenesis and immunity in pertussis . Chichester: John Wiley & Sons, 1988 ; 399-417 . 2 . Sato H, Sato Y . Bordetella pertussis in mice : correlation of specific antibodies against two antigens, pertussis toxin and filamentous hemagglutinin, with mouse protectivity in an intracerebral aerosol challenge system . Infect Immun 1984; 46 : 415-21 . 3 . Tuomanen E, Weiss A . Characterization of two adhesins of Bordetella pertussis for human ciliated respiratory-epithelial cells . J Infect Dis 1985 ; 152 : 118-25 . 4 . Delisse-Gathoye A-M, Locht C, Jacob F et al. Cloning, partial sequence, expression, and antigenic analysis of the filamentous hemagglutinin gene of Bordete/la pertussis. Infect Immun 1990 ; 58: 2895905 . 5 . Domenighini M, Relman D, Capiau C et al. Genetic characterization of Bordetella pertussis filamentous hemagglutinin : a protein processed from an unusually large precursor . Mol Microbiol 1990 ; 4: 787800 . 6 . Molina C, Parker CD . Murine antibody response to oral infection with live aroA recombinant Salmonella dublin vaccine strains expressing filamentous hemagglutinin antigen from Bordetella pertussis. Infect Immun 1990; 58 : 2523-8 . 7 . Parker CD, Molina CN, Kelly SM, Curtiss III R, Yu J . Live oral attenuated Salmonella typhimurium vaccine vectors which induce formation of antibody to Bordetella pertussis . In : Proceedings 6th Symposium on Pertussis, Bethesda, Maryland . Department of Health and Human Services, Bethesda, Maryland, 1990 .
Expression of B . pertussis FHA
389
8 . Guzman CA, Walker MJ, Rohde M, Timmis KN . Direct expression of Bordetella pertussis filamentous hemagglutinin in Escherichia coli and Salmonella typhimurium aroA . Infect Immun 1991 ; 59 : 378795 . 9 . Schoner BE, Belagaje RM, Schoner RG . Enhanced translational efficiency with two-cistron expression system . Methods Enzymol 1990 ; 185: 94-103 . 10 . Schoner BE, Belagaje RM, Schoner RG . Translation of a synthetic two-cistron mRNA in Escherichia coli. Proc Natl Acad Sci USA 1986 ; 83: 8506-10 . 11 . Brownlie RM, Coote JG, Parton R, Schultz JE, Rogel A, Hanski E . Cloning of the adenylate cyclase genetic determinant of Bordetella pertussis and its expression in Escherichia coli and B . pertussis . Microb Pathogen 1988; 4: 335-44 . 12 . Herrero M, De Lorenzo V, Timmis KN . Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria . J Bacteriol 1990 ; 172 : 6557-67 . 13 . Strebel K, Beck E, Strohmaier K, Schaller H . Characterization of foot-and-mouth disease virus gene products with antisera against bacterially synthesized fusion proteins . J Virol 1986; 57 : 983-91 . 14 . Remaut E, Tsao H, Fiers W . Improved plasmid vectors with a thermoinducible expression and temperature regulated runaway replication . Gene 1983 ; 22 : 103-13 . 15 . Sato Y, Arai H . Leukocytosis promoting factor of Bordetella pertussis. I . Purification and characterization . Infect Immun 1972 ; 6 : 899-904. 16 . Sambrook J, Fritsch EF, Maniatis T . Molecular Cloning : a laboratory manual, 2nd edn . Cold Spring Harbor, New York : Cold Spring Harbor Laboratory Press, 1989 . 17 . Stainer DW, Scholte MJ . A simple chemically defined medium for the production of phase I Bordetella pertussis . J Gen Microbiol 1970; 63 : 211-20 . 18 . Laemmli UK . Cleavage of structural proteins during the assembly of the head of bacteriophage T4 . Nature 1970; 227 : 680-5 .
Short communication Expression of Bordetella pertussis filamentous hemagglutinin in Escherichia coil using a two cistron system Carlos A . Guzman,"' Mark J . Walker, 2 Manfred Rohde and Kenneth N . Timmis
Department of Microbiology, GBF-National Research Centre for Biotechnology, Braunschweig, Germany (Received November 20,1991 ; accepted in revised form January 14, 1992)
Guzman, C . A . (Dept of Microbiology, GBF-National Research Centre for Biotechnology, Braunschweig, Germany), M . J . Walker, M . Rohde and K . N . Timmis. Expression of Bordetella pertussis filamentous hemagglutinin in Escherichia coli using a two cistron system . Microbial Pathogenesis 1992 ; 12 : 383-389 . Expression of Bordetella pertussis filamentous hemagglutinin (FHA) has been achieved in Escherichia coli K-12 . This involved the construction of a two cistron system where the first cistron was provided by the NI-1 2 -terminus (first 98 amino acids) of MS2 polymerase . When the FHA gene sequences were fused to the first cistron, higher levels of expression were obtained and the fusion protein aggregated in inclusion bodies . FHA expressed by the two cistron system, however, appeared to be diffusely dispersed in the cytoplasm .
Key words : Bordetella pertussis ; filamentous hemagglutinin ; gene expression ; recombinant protein ; two cistron system .
Introduction There are many virulence traits produced by Bordete/la pertussis which are potential antigens for inclusion in a new generation of subunit vaccines highly immunogenic and non-reactogenic .' Filamentous hemagglutinin (FHA) is a major candidate because it mediates the early interactions with respiratory tract epithelial cells which are essential for colonization and production of disease ."' Moreover, in experimental animal models, immunization with purified FHA provided protection against B. pertussis infection .' The purification of FHA from B . pertussis for production of subunit vaccines is associated with important problems, such as the fermentation of a pathogenic microorganism, slow growth rates, poor yields, the possibility of copurification of other reactogenic factors and lack of an efficiently regulated promotor that can be highly induced under process conditions . Previous efforts have lead to the production in
'Present addresses : 'Institute of Microbiology, University of Genoa, Viale Benedetto XV, 10, 16132Genoa, Italy and 'University of Wollongong, Department of Biology, Wollongong, N .S .W . 2500, Australia . 0882-4010/92/050383+07 $03 .00/0
© 1992 Academic Press Limited
384
C . A . Guzman et al.
Escherichia coli of recombinant FHA fusion protein S,4,5 but these, despite the high yields obtained, are unacceptable for vaccine purposes . Truncated forms of FHA have also been obtained, but these are poor inducers of mucosal SIgA immune responses . 4,6 ' Many factors influence the expression of recombinant proteins . In a recent study we described the production of full-length recombinant FHA in E. co/i and Salmonella typhimurium$ after optimizing factors including mRNA stability, codon usage and translational efficiency . In this study we explored an alternative strategy to overcome the problem of low translational efficiency by the use of a two cistron system . This approach has proved to be successful for the overexpression of several recombinant proteins including human proinsulin, and bovine and human growth hormones .' , " The 5' end of the mRNA sequence corresponding to the first cistron must be free of local secondary structures in the translation initiation region, allowing efficient binding of the ribosome to the Shine-Dalgarno (SD) sequence and optimization of translation initiation . The ribosomes bound to the first cistron must also disrupt, during the protein synthesis, the secondary structures present downstream in the mRNA sequence corresponding to the second cistron which contains the FHA coding information . The recombinant non-fused FHA obtained by this method could be useful for inclusion in subunit vaccines against whooping cough . Results Production of fusion proteins containing FHA Cosmid pRMB2," contains the first 10 kb of the fhaB open reading frame (ORF) . Subfragments of the fhaB gene were cloned into pUC18Not1 12 and then transferred as EcoRl-HindIll inserts into the corresponding sites of plasmid cloning vectors pEX31 A and pEX31 B 13 (Fig . 1) to obtain hybrid proteins consisting of the NH 2 terminal 98 amino acids of the MS2 polymerase protein fused in frame to C-terminal fragments of FHA. Hybrid plasmids were subsequently transformed into E. co/i 537 (pC1857 rs ) 14 which is temperature sensitive for the lambda repressor activity . Whole cell extracts obtained from bacteria induced by growth at 42°C were subjected to Western blot analysis . These fusion proteins were used for a qualitative comparison with the product obtained using the two cistron system (see below) . Hybrid plasmids pCG24 (3 .6 kb Bg/I I-B am H I insert) and pCG17 (2 .4 kb Bam H I-Bam H I insert) reacted only with the rabbit polyclonal anti-FHA antibody [Fig . 1 (c) and (d)] . Clone pCG22 (4 .7 kb Bam HI-Bam H I insert) reacted with both the polyclonal and P121-13 monoclonal antibodies [Fig . 1 (c) and (d)], indicating that the epitope recognized by the P12H3 hybridoma is encoded by sequences present on the 1 .0 kb BamHI-Bg/I l fragment of the fhaB ORF . The recombinant fusion proteins appeared as a major band and many minor bands [Fig . 1(b), (c) and (d)] ; extension of the induction time up to 9 h did not affect FHA yields or Western blot patterns (not shown), suggesting that the protein produced was neither toxic for the cells nor degradated extensively by proteases . Expression of FHA using a two cistron system Hybrid plasmid pCG16 was constructed in a similar fashion and contains the 8 .4 kb Sphl-Sphl DNA fragment . This fragment was cloned downstream of the TAG stop codon present in the Xbal site of the multiple cloning site of pUC18Notl . When this fragment was excised as a EcoRl-Hindlll insert and introduced into pEX31A, the stop codon was in frame with the MS2 polymerase sequence of the vector . The hybrid plasmid pCG16 specified a product that was recognized by both monoclonal and polyclonal FHA antibodies, expressed at lower levels than the fusion proteins, and was less stable when the induction time was extended [Fig . 1 (c), lanes 6 and 7] . A
38 5
Expression of B . pertussis FHA (a)
fhoB o
=
_
.. _
m
r4 m
y
Western blot W
y
mW
P12H3
Vector
pCGl6
PEX31A
pCG22
I
I
V//,Y/////.1
pCG24
I
I
I
pCGl7
I
(b)
Polyclonal
Y////A
12
3
II
PEX31B
Y/////,Y//11
PEX31A
I II
PEX31B
I
4
5
Monoclonal
+
+
+
+
+
+
6
12
( c )
200 -
3
4
5
6
7
205 -
116 97 116 -
66 -
77 42 46 ~
2
3
4
5
6
7
8
9
10
205 116 77 46-
Aak Fig . 1 . Production of fused and non-fused FHA . (a) The region encoding the epitope recognized by the monoclonal antibody P12H3 is represented by the filler bar . Hatched bars correspond to fhaB gene sequences encoding fusion proteins (pCG22, pCG24 and pCG1 7) or the non-fusion protein in the two cistron system (pCG16) . + and - indicate the reaction of proteins produced by different clones with the monoclonal antibody P12H3 or polyclonal anti-FHA antiserum in Western blots . (b) SDS-PAGE of total cell extracts stained with Coomassie blue . Molecular weight standards (lane 1) ; E. co/i 537 (pCI 857rs) containing pCG24 (lane 2), pCG22 (lane 3), pCG17 (lane 4), pCG16 (lane 5) and pEX31A (lane 6), arrows indicate main protein products . (c) Western blot analysis using monoclonal antibody P12H3 . Molecular weight markers (lane 1) ; purified B . pertussis FHA obtained from Tohama strain (lane 2) ; E. coli 537 (pCI 857rs) containing pEX31 A (lane 3), pCG22 (lanes 4 and 5) and pCG1 6 (lanes 6 and 7) . Lanes 4 and 6 were induced for 30 min while lanes 3, 5 and 7 were induced for 2 h . (d) Western blot analysis using polyclonal antiserum against FHA . Molecular weight markers (lane 1) ; purified B. pertussis FHA (lane 2) ; TS) containing pCG24 (lanes 3 and 7), pCG22 (lanes 4 and 8), pCG17 (lanes 5 and E. coil 537 (pCI 857 9), pCG1 6 (lanes 6 and 10) and pEX31 A (lane 11) . Lanes 3-6 were induced for 30 min while lanes 7-11 were induced for 2 h . Molecular weight standards (kDa) are indicated by arrow heads .
386
C . A. Guzman et a/_
two cistron system has thus been created where the first cistron consists of the first 98 amino acids of the MS2 polymerase and the second of an internal fhaB gene sequence . The intercistronic region is 15 by long with the next available ATG start codon being provided by the Sph I site present in the FHA insert . The FHA start codon is in frame with the stop codon of the first cistron, a characteristic that seems important in obtaining expression . 9,10 At the end of the FHA insert, translation is stopped at a double stop codon (TGA-TGA) 27 bases into the vector (Fig . 2) . In this construction, the first 15 codons of the fhaB ORF present in the 0 .3 kb EcoRI-Sphl fragment s and the FHA COOH-terminus are not present (Fig . 2) . Cellular localization of recombinant FHA by immune electron microscopy Immune electron microscopy demonstrated that in the E. co/i 537 (pCI 857Ts) hybrid strain expressing fusion proteins, FHA accumulated in the cytoplasm as inclusion bodies, while in bacteria containing pCG16 (two cistron system), non-fusion FHA was present in the cytoplasm as a diffuse pattern and inclusion bodies were not observed [Fig . 3(a) and (b)] . The solubility of the recombinant protein could be due both to the lower levels of expression or the absence of the MS2 polymerase NH 2 terminus . Discussion and conclusions Genetic manipulation of pRMB2 resulted in expression of FHA at high level as Cterminal components of fusion proteins containing the N-terminal region of MS2 polymerase . These fusion proteins accumulated as inclusion bodies . At present, methods for solubilizing and refolding inclusion bodies are not so advanced that entirely native protein conformations can be reproducibly obtained . The accumulation of human therapeutic substances and vaccines as inclusion bodies is therefore not desirable . FHA was also expressed in standard E. coil strains as a soluble, unfused protein using a two cistron system, but at somewhat lower levels than the fusion proteins, presumably as a result of proteolytic degradation of the non-fusion protein (fusion proteins are usually more stable) . Alternatively, a non-optimal genetic organization of the two cistron system (Fig . 2) may result in lower yields and early degradation . It is known that several factors including the length of the first cistron ORF, the phasing of the stop codon of the first cistron with respect to the start codon of the second
PEX31A
I
Ribosome binding site MS2-POL 1 98 a ECO RI I I
I
a O Ln
I
GTCATGGGGAATTCGAGCTCGGTACCCGGGGATCCTCTAG -~ ATG first cistron
a a
0 0 Sph I -AGTCGACCTGCAGGCATGC
Intercistronic region 15 bases
FHA
I
M Q A W L P R A F RI N I~1 GCATGCAAGCTTGGCTGCCTCGCGCG111LGGTGATGA 3' Hind III
+I Second cistron
Fig . 2 . Diagrammatic representation of the two cistron system constructed in clone pCG16 . Abbreviations : A-P L, lambda phage P L promotor ; SD, Shine-Dalgarno sequence ; MS2-Pol, first 98 amino acids of MS-2 polymerase; FHA, Sphl/Sphl 8 .4 kb fragment from the fhaB ORF . Amino acids are indicated using one letter code .
Expression of B . pertussis FHA
387
Fig . 3 . Immune electron microscopic localization of recombinant FHA . Induced E. coli 537 (pCI 857Ts) containing pCG22 (a), pCG16 (b) and uninduced E. coli EC537 (pCI 857 Ts) containing pCG22 (c) . Inductions were performed at 42'C for 1 h . Symbols: G, gold particles (10 nm in size) are indicated by large arrows; small arrows indicate inclusion bodies ; bars represent 0 .25 pm .
cistron, the size of the intercistronic region and the presence or absence of a second SD sequence, influence product yield . 9 •1 0 Nevertheless, it should be stressed that both types of recombinant proteins, fusion proteins and the non-fusion protein expressed from the two cistron system were produced at higher levels than FHA from the wildtype B . pertussis Tohama strain (not shown) . The FHA gene ORF extends over 11 kb of DNA . The 220 kDa processed mature protein secreted by B . pertussis is however encoded by the first 6 .2 kb of the FHA ORF . This means that the recombinant protein produced from pCG16 lacks only the first 15 N-terminal amino acids of the mature FHA protein and therefore should contain all the epitopes important for the immune response . The degradation of the recombinant protein observed may not be critical for vaccines purposes . Purified non-fused recombinant FHA obtained from E. coli using the two cistron system may be suitable for inclusion in subunit vaccines against whooping cough . In contrast to the FHA produced in B . pertussis, the recombinant protein has the advantages of the absence of other possibly reactogenic pertussis virulence components and the production by fermentation of a non-pathogenic microorganism with high growth rates and yields . Materials and methods Bacterial strains, plasmids and media . The bacterial strains used in this work were : B. pertussis Tohama 1 .2 serotype; 15 E. coli SURE TI (Stratagene) was used for transformations where
388
C . A . Guzman et al.
recombinant clones were screened for /l-galactosidase a complementation . E. co/i 537 (pCl 857 Ts ) 14 was used in induction experiments for expression of FHA . The plasmids used in this work were : pUC18Notl, 12 pEX31A and pEX31 B 13 and pRMB2 . 1 ' E. co/i strains were grown in Luria broth or on Luria agar ." X-gal medium 76 was used for selection with the f-galactosidase a complementation system . Bordetella pertussis was grown on Bordet Gengou agar base (Difco) supplemented with 1% glycerol and 15% (v/v) defibrinated horse blood or SS-X broth ." Ampicillin (100 ltg/ml) and tetracycline (50 µg/ml) were used when appropriate . DNA manipulations. Plasmids were isolated by alkaline lysis ." Restriction endonuclease digestion, ligation with T4 DNA ligase, dephosphorylation with fetal calf intestine phosphatase and transformation were performed as described by Sambrook et al." Enzymes were obtained from Boehringer Mannheim . Protein and immunological techniques . Induction experiments and FHA purification were performed as previously described .' Approximately 50 µg of protein was electrophoresed according to the procedure of Laemmli 1 S using a 3 .85% acrylamide stacking gel and a 10% acrylamide separating gel . High range molecular weight markers were purchased from Biorad . Western blotting was carried out using polyclonal rabbit antiserum against FHA and the monoclonal antibody P12H3 kindly provided by Dr C . Parker as described .' The blocked membranes were incubated with the first antibody for 2 h, washed three times with PBS (137 mm NaCl, 2 .7 mm KCI, 8 mm Na 2 PO 4 , 1 .5 mm KH 2 HPO4 ) pH 7 .4, and incubated for 1 h with Biorad horse radish peroxidase conjugated goat anti-rabbit or goat anti-mouse IgG . Membranes were washed and then developed using 4-chloro-1 -naphthol as a substrate . Immune electron microscopy. Cells were fixed and embedded by the progressive lowering of temperature method using Lowicryl K4M resin as previously described .' The protein was detected using polyclonal antibodies against FHA that had been cross-adsorbed with E. coli bacteria and purified by affinity chromatography using protein A Sepharose CL-4B . Antibodies bound to sample preparations were visualized by incubation with protein A-gold complexes (gold particle size 10 nm) after preparation of ultrathin sections as previously described .'
We thank C . Parker for the monoclonal antibody P12H3, J . Wehland for assistance in the preparation of rabbit antiserum against FHA, R . Brownlie for pRMB2 and helpful discussions, V. de Lorenzo for suggestions during the early stages of this work and for pUC18Notl, P . Jerlstrom for the strain 537 (pCI857' s ) and pEX31A-B . C . A . Guzman was the recipient of a CEC training fellowship (019942) .
References 1 . Robinson A, Ashworth LAE . Acellular and defined component vaccines against pertussis. In : Wardlaw AC and Parton R, eds . Pathogenesis and immunity in pertussis . Chichester: John Wiley & Sons, 1988 ; 399-417 . 2 . Sato H, Sato Y . Bordetella pertussis in mice : correlation of specific antibodies against two antigens, pertussis toxin and filamentous hemagglutinin, with mouse protectivity in an intracerebral aerosol challenge system . Infect Immun 1984; 46 : 415-21 . 3 . Tuomanen E, Weiss A . Characterization of two adhesins of Bordetella pertussis for human ciliated respiratory-epithelial cells . J Infect Dis 1985 ; 152 : 118-25 . 4 . Delisse-Gathoye A-M, Locht C, Jacob F et al. Cloning, partial sequence, expression, and antigenic analysis of the filamentous hemagglutinin gene of Bordete/la pertussis. Infect Immun 1990 ; 58: 2895905 . 5 . Domenighini M, Relman D, Capiau C et al. Genetic characterization of Bordetella pertussis filamentous hemagglutinin : a protein processed from an unusually large precursor . Mol Microbiol 1990 ; 4: 787800 . 6 . Molina C, Parker CD . Murine antibody response to oral infection with live aroA recombinant Salmonella dublin vaccine strains expressing filamentous hemagglutinin antigen from Bordetella pertussis. Infect Immun 1990; 58 : 2523-8 . 7 . Parker CD, Molina CN, Kelly SM, Curtiss III R, Yu J . Live oral attenuated Salmonella typhimurium vaccine vectors which induce formation of antibody to Bordetella pertussis . In : Proceedings 6th Symposium on Pertussis, Bethesda, Maryland . Department of Health and Human Services, Bethesda, Maryland, 1990 .
Expression of B . pertussis FHA
389
8 . Guzman CA, Walker MJ, Rohde M, Timmis KN . Direct expression of Bordetella pertussis filamentous hemagglutinin in Escherichia coli and Salmonella typhimurium aroA . Infect Immun 1991 ; 59 : 378795 . 9 . Schoner BE, Belagaje RM, Schoner RG . Enhanced translational efficiency with two-cistron expression system . Methods Enzymol 1990 ; 185: 94-103 . 10 . Schoner BE, Belagaje RM, Schoner RG . Translation of a synthetic two-cistron mRNA in Escherichia coli. Proc Natl Acad Sci USA 1986 ; 83: 8506-10 . 11 . Brownlie RM, Coote JG, Parton R, Schultz JE, Rogel A, Hanski E . Cloning of the adenylate cyclase genetic determinant of Bordetella pertussis and its expression in Escherichia coli and B . pertussis . Microb Pathogen 1988; 4: 335-44 . 12 . Herrero M, De Lorenzo V, Timmis KN . Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria . J Bacteriol 1990 ; 172 : 6557-67 . 13 . Strebel K, Beck E, Strohmaier K, Schaller H . Characterization of foot-and-mouth disease virus gene products with antisera against bacterially synthesized fusion proteins . J Virol 1986; 57 : 983-91 . 14 . Remaut E, Tsao H, Fiers W . Improved plasmid vectors with a thermoinducible expression and temperature regulated runaway replication . Gene 1983 ; 22 : 103-13 . 15 . Sato Y, Arai H . Leukocytosis promoting factor of Bordetella pertussis. I . Purification and characterization . Infect Immun 1972 ; 6 : 899-904. 16 . Sambrook J, Fritsch EF, Maniatis T . Molecular Cloning : a laboratory manual, 2nd edn . Cold Spring Harbor, New York : Cold Spring Harbor Laboratory Press, 1989 . 17 . Stainer DW, Scholte MJ . A simple chemically defined medium for the production of phase I Bordetella pertussis . J Gen Microbiol 1970; 63 : 211-20 . 18 . Laemmli UK . Cleavage of structural proteins during the assembly of the head of bacteriophage T4 . Nature 1970; 227 : 680-5 .
