Microbial Pathogenesis 1991 ; 10 : 393-403
Expression of Bordetella pertussis fimbrial (fim) genes in Bordetella bronchiseptica : fimX is expressed at a low level and vir-regulated B . Riboli, P . Pedroni, A . Cuzzoni, G . Grandi and F . de Ferra* Eniricerche S.p .A ., Department of Genetic Engineering and Microbiology, Via F . Maritano 2620097 San Donato Milanese, Milan, Italy (Received November 23, 1990 ; accepted in revised form January 26, 1991)
Riboli, B . (Eniricerche S .p .A ., Dept of Genetic Engineering and Microbiology, Via F . Maritano 26-20097 San Donato Milanese, Milan, Italy), P . Pedroni, A . Cuzzoni, G . Grandi and F . de Ferra . Expression of Bordetella pertussis fimbrial (fim) genes in Bordetella bronchisepta : fimX is expressed at a low level and vir-regulated . Microbial Pathogenesis 1991 ; 10 : 393-403 . To identify the elements involved in Bordetella pertussis fimbriae regulation and to determine whether fimX is an expressed gene, the promoter regions of fimX, fim2 and fim3 from strain BPSA1 were isolated and linked to the promoterless CAT gene in pLAFR2 . By following CAT activity in Bordetella bronchiseptica vir+ and vir- strains we established that the fimX promoter, like those for fim2 and fim3, is active, although at a low level, and vir-regulated . This suggests that the fimX protein might be produced in minute quantities which are not detectable by conventional methods . Comparison of the three fim promoter sequences and transcriptional activities identifies two conserved elements necessary for transcription in the -60 to -20 region : the 'firn box' and the 'C-stretch' . Mutations in these two sequences drastically reduce transcription and alter the interaction with vir components, suggesting a role for the two elements in the regulation of fim genes . Finally, we suggest that the apparent constitutive nature of fim3 in BPSA1 is due to a modification in the length of the 'C-stretch' . Key words : Bordetella pertussis; fimbriae; fim genes ; regulation .
Introduction The membrane-associated fimbriae (or pili) of Bordetella pertussis are classified among the B . pertussis virulence determinants having the possible role in mediating, together with other membrane components, 1-3 the attachment of the bacteria to the ciliated epithelium of the upper respiratory tract in the first stages of the disease . Purified fimbrial preparations have been shown to induce immunological protection against subsequent infection by isotypic strains,' and therefore they have been considered as good candidates for inclusion in acellular pertussis vaccines . Different isolates of B . pertussis can be distinguished by their cross-reactivity with 'typing' sera which identify major antigenic determinants on the surface of B . pertussis . While some of these antigens are present in all B . pertussis strains, the antigens associated with the fimbriae` are found in different combinations in different strains, and also in different
Author to whom correspondence should be addressed . 0882-4010/91/050393+11 $03 .00/0
© 1991 Academic Press Limited
394
B . Riboli et al.
isolates from the same strain .' This phenomenon (antigenic variation) is based on the differential expression of multiple fim genes by B. pertussis strains . Like other virulence associated factors of B . pertussis, fimbriae are not expressed phenotypically in the avirulent phase of B . pertussis (phase variation) 6 .6 and are reversibly regulated by growth conditions (modulation) .' A single genetic locus (named vir or bvg) has been identified by transposon mutagenesis which controls the phase variation and modulation phenomena ." The vir locus has been originally proposed to encode a positive pleiotropic inducer(s) which coordinately turns on the expression of virulence factor genes 6 and its recent cloning and characterization brings support to this hypothesis .", " The putative products of the two vir-related genes, bvgA and bvgS, share homologies with a series of bacterial regulatory proteins belonging to the 'two-component' systems ." In general one of the two components is a membrane-associated receptor for changes in metabolite concentrations or growth conditions (sensor) which modifies by phosphorylation the second component (regulator), a cytoplasmic DNA-binding protein which, when activated, either promotes or represses transcription of the genes regulated by the system . In the past few years, several of the genes coding for B . pertussis virulence factors have been cloned, including the pertussis toxin (PT) gene, the filamentous hemagglutinin (FHA) gene, the gene coding for the 69 kDa protein, the adenylate cyclase gene (cya) and the genes coding for the major fimbrial components corresponding to serotypes 2 and 3, named fim2, t 3 fim3, 21415 and fimX 16 the gene product of which is unknown . To determine whether fimX might be an active gene and to study the elements involved in fimbrial expression and regulation, we have isolated fimX, fim2 and fim3 putative regulatory regions, functionally defined their promoter sequences, and identified mutations which disrupt the productive interaction of the vir components with the promoters . With these experiments we show that the fimX promoter is active and vir regulated, but less strong than the other two . We have also identified conserved regions in the three promoters, the integrity of which is essential for the proper expression and regulation of fimbrial genes . Since the completion of our work, Willems et al." have published an analysis of fim genes' upstream sequences from B . pertussis strains which express variable levels of fim3 . We will also discuss our results in the context of these recent findings .
Results Cloning and functional assay of fim promoters In order to identify the regulatory sequences involved in the expression of the B . pertussis fimbrial genes, we isolated the genomic clones corresponding to the three fim genes fim2, fim3 and fimX from cosmid and plasmid libraries derived from B. pertussis strain BPSA1 . Clones containing the fimbrial coding regions were previously isolated by homology to a degenerate probe hybridizing to the conserved amino acid terminus of the mature portion of the fimbrial subunits,"' and the identity of the clones was assigned by sequencing and/or hybridization to probes specific for each type of fimbriae . Subsequently, DNA restriction fragments containing the coding and 5' upstream regions were subcloned in pUC plasmids for further analysis . To determine whether the promoter regions of the fim genes were under transcriptional regulation by the vir components, we took advantage of the functional relationship between the B. pertussis and B . bronchiseptica species, where it has been shown that the vir components of B . bronchiseptica cross-interact with the PT gene regulatory sequences in a physiological manner ." The fim upstream sequences were cloned in the broad
395
Regulation of Bordetella pertussis fim genes 5' upstream sequences Sphl
SO/71 I
S1ul
fim2
*ATG
t
383 by
Promoterless CAT gene 1630 by
mRNA start point
Barn HI I-/cell Avol Awl ll I
fimX
539 by
*ATG
Promoter less 1630
t
CAT gene
by
mRNA start point
Avail
PS/
I
fim3 I
*ATG
Sau3A I
1330 by
Promoterless CAT gene 1630
t
by
mRNA start point
Fig . 1 . fim genes' 5' upstream regions cloned in pLAFR2 and analysed in the CAT assay experiments .
host range, low copy number plasmid pLAFR2 in E. coli, juxtaposed to the promoterless CAT gene (see Materials and methods and Fig . 1) and the constructs were introduced in the B . bronchiseptica vir+ strain BB7865 and in the B . bronchiseptica vir- BB7866 by conjugation . The mutation carried by the BB7866 vir- strain has been characterized as a deletion in the bvgS gene, predicted to result in the synthesis, in this strain, of only the amino-terminal region of BvgS . 19,20 Extracts of the conjugants were assayed for CAT activity at the mid-logarithmic phase of growth . Transcription of the CAT gene in the vir+ B . bronchiseptica strain BB7865 revealed strong promoters in the fim2 and fim3 upstream sequences and a weak promoter in the fimX upstream sequence (Fig . 2 and Table 1) . In B . bronchiseptica strain BB7866, the fim2 and fimX promoters were inactive, indicating that the activation of transcription promoted by pR2 and pRX depends on the presence of functional vir components (Fig . 2) . On the other hand, in this assay the plasmid carrying the fim3 upstream sequence promotes CAT transcription constitutively, at the same level in a vir+ or vir- background (Table 1) . The same amounts of CAT transcription in vir+ and vir- background were observed to be
Table 1
Activity of fimbrial promoters vir+
pR2 pR3 pRX
vir-
vir+ plus MgSO 4
100.00% 33.70% 1 .63%
0 .34% 35 .02% 0 .14%
0 .57%
pR2A1 pR2A2 pR2A3
0 .48% 5.00% 1 .65%
0 .44% 0 .25% 1 .42%
0 .38% 0 .29%
pLAFR-CAT
0.39%
0 .38%
Plasmids pR2, pR3, pRX and the derivatives pR2A1, pR2A2 and pR2A3 were introduced in B. bronchiseptica BB7865 (vir+) and BB7866 (vir-) strains . Results of the quantitative assay are expressed as percent acetylation with respect to CAT activity of pR2 in BB7865 extracts, the absolute value of which is 94 .3 U/pg (one CAT unit is defined as the amount of enzyme that transfers 1 nmole of acetyl moiety per minute) . The data represent the average of at least two independent experiments . (- = not done) .
396
B . Riboli eta[ 1
2
3
4
5
6
Fig . 2 . Thin-layer chromatography CAT assay of extracts containing fim2 and fimX 5' upstream sequences in B . bronchiseptica BB7865 (vir+) and B. bronchiseptica BB7866 (vir-) strains . The assays were performed as described in Materials and methods . Lanes : 1, pLAFR-CAT in B. b . 7865 (vir+) ; 2, pLAFR-CAT in B . b. 7866 (vir-) ; 3, pR2 (fim2 promoter) in B. b . 7865 (vir+) ; 4, pR2 (fim2 promoter) in B . b. 7866 (vir-) ; 5, pRX (fimX promoter) in B . b. 7865 (vir+) ; 6, pRX (fimX promoter) in B . b . 7866 (vir-) .
promoted by a shorter fim3-CAT construct which includes only 80 by sequence upstream from the mRNA start point (data not shown) . The fact that the fimX 5' upstream region drives the transcription of the CAT gene in a vir-regulated manner, represents indirect evidence that this gene must be expressed in B. pertussis cells during the virulent phase . Primer extension analysis The exact start point of transcription of the CAT-coding mRNAs was determined by analysing the distance between the 5' terminus of the RNA and the first bases of the CAT-coding region by reverse transcriptase extension of a primer which hybridizes to the first 30 bases of the CAT-coding region . The length of the major extended fragments revealed start points of transcription at 72/73, 73, and 72 bases of distance from the CAT initiator codon for fim2, fim3 and fimX respectively (data not shown) and are indicated with an arrow on the 5' upstream region sequences in Fig . 3 . No extension was observed from sample RNAs from B . bronchiseptica vir- extracts (with the exception of the RNA derived from the culture containing the fim3 promoter harbouring plasmid), and from control incubations not containing RNA . This experiment shows that the sequences determining the promotion of CAT transcription are in fact located on the cloned fragments under analysis .
Functional assay of fim genes promoters Analysis of the sequences lying upstream from the putative start point of transcription revealed regions of homology between the three promoters (Fig . 3) which can be
Regulation of Bordetella pertussis fim genes
397
fim2
TGTTTCCCAC
CGGaATCA CCCCCCCCCCCCCCCTAAGACCTAAGATCGTGGCTCCAT
fimX
MP TTCCTAC
ATCCATCAG CCCCCC GAGGCGTCTAATAATCTTGCACACACAT
fim3
MPTTCCCACACAACCATCA
f i CCCCCCCC CGGACCTGATATTCTGATGCCGACGCCA\GCACAT I
fim box
C-stretch
Fig . 3 . Homologies among the fim promoters . 'fim boxes' and 'C-stretches' are marked . The arrows indicate mRNA start points as deduced from primer extension experiments .
identified as (i) a 'C-stretch' situated around nucleotide -35 and (ii) a second homology region just upstream from it, named here 'fim box' which is not immediately analogous to any sequence from other B . pertussis genes by computer analysis . The particular positioning of these sequences and their high degree of homology in all three genes compelled us to investigate further their possible role in the promotion of transcription and vir regulation of these genes by functional assays . Three mutants were constructed in which either the 'fim box' (pR2A1 plasmid) or the 'C-stretch'
(pR2A2 plasmid) or both (pR2A3 plasmid) were deleted from pR2 which contains the fim2 promoter (Fig . 4) . Functional assays on these deletion-mutants in a vir+ or vir- background were designed to determine whether either of these two conserved sequences is necessary for the fim genes vir-regulated promotion of transcription . Additionally, two mutants of the fimX promoter region were designed in an attempt to identify the sequence elements which determine the difference in strength between the relatively weaker promoter fimX with respect to fim2 (Fig . 4) . The first mutant (pRXM1) carries a point mutation in the 'fim box' (T C) which makes this sequence identical to the corresponding fim2 'fim box' sequence, while in the second mutant (pRXM2) the 'C-stretch' is lengthened from seven bases to the 16 cytosines of the fim2 promoter . The mutant plasmids were reintroduced into the vir+ B . bronchiseptica BB7865 and vir- BB7866 by conjugation and the CAT activity was assayed from the extracts of the respective conjugants . The results of this experiment for the fim2 deletion mutants are shown in Table 1 . While B . bronchiseptica 7865 (vir+) extracts containing the pR2 construct, carrying about 400 bases of upstream sequence from the fim2 gene display a CAT activity
pR2AI
fim2
TGTCTCCCAC
pR2A2
fCGGI \1CAGGCCCCCCCCCCCCCCCTAAGACCTMGATCGTGGCTCCAT
pR2A3
fimX
M4IICCTACA .ATCC~TCAACCCCCCGAGGCGTCTAATMTCTTGCACACACAT
/
C pRXMI
NN
i .000CCCCC pRM2
Fig . 4 . Deletion mutants of pR2 plasmid (pR2A1, pR2A2 and pR2A3) and modification mutants of pRX plasmid (pRXM1, pRXM2) . 'fim boxes' are indicated and 'C-stretches' are underlined . Brackets indicate the sequences deleted in the pR2 mutants, and the extra Cs inserted in the pRX mutant . The arrow indicates the point mutation (T C) .
398
B . Riboli et al .
which is similar to the PT promoter, the deletion mutants pR2A1 and A2 which carry deletions either in the 'fim-specific' sequence or in the 'C-stretch', show a large decrease in CAT activity with 0 .48% and 5 .00% residual activity, respectively (Fig . 5 and Table 1) . Interestingly, it appears that the residual CAT activity in the extract containing pR2A2 (deleted only in the 'C-stretch') is still dependent on the presence of the vir components, so that there is a further decrease (from 5 .00 to 0 .25%) in the CAT activity promoted by plasmid pR2A2 in B . bronchiseptica 7866 . In contrast, both pR2A1, deleted in the 'fim box' only, and pR2A3, with the double deletion, show no difference in CAT activity between the vir+ or vir- strains . CAT activity data in the extracts containing the fimX mutants (Fig . 5) indicate that in pRXM1, with the point mutation in the 'fim box', the promoter is still very weak and vir-regulated; thus the base change T-4 C does not affect either the interaction with the vir components, or the strength of the promoter . In contrast, pRXM2, mutated in the length of the 'C-stretch', directs an amount of CAT gene transcription similar in level to the wild-type promoter in a vir+ background, while a slight increase is observed in a vir- background indicating, for this mutant, the maintenance of promoter strength together with the loss of wild-type vir regulation . Altogether, these data indicate that both the 'fim box' and the 'C-stretch' sequences are indispensable in the proper wild-type configuration for transcription of the fim2 and fimX genes, while the presence of the 'fim box' sequence by itself might be enough to enhance transcription in a vir+ background . Modulation In the PT promoter certain sequences have been shown to be essential for both vir regulation and for the changes in the level of the toxin gene transcription by changes in growth conditions, thus connecting, at the molecular level, the two phenomena of phase variation and modulation .' To determine at which level the fim genes are modulated by changes in growth conditions and whether the homologous sequences we have identified among the three promoters are also involved in this phenomenon, we measured the CAT gene transcription driven in modulating conditions by plasmids pR2, pR2A1 and pR2A2 by CAT assays from extracts from the respective cultures . It has previously been shown that modulation can be observed in several conditions including : growth in medium supplemented with 50 mm MgSO 4 , or 5 mm nicotinic acid, or growth temperature below 35°C . We have chosen to alter the MgSO 4 concentration in the growth medium, which has been shown by others' to be equivalent to other modulating conditions with regard to the modulation of the PT gene transcription . Cells were grown in standard or modulating conditions and the extracts were assayed exactly as for the functional assays described above . The results of this experiment (Table 1) show that fimbrial transcription is effectively shut off when cells are grown in presence of high concentrations of MgSO 4 and that the small residual activity driven by the mutant plasmids is not modulated by the presence of MgSO4 with the exception of mutant pR2A2, which follows the same pattern of virdependent activity driven by plasmids containing vir-regulated promoters . These experiments confirm that the same sequences involved in phase variation are important for the regulatory DNA/protein interactions determining modulation . Discussion and conclusions Cloning of the B . pertussis fimbrial promoters in B . bronchiseptica BB7865 vir+ and BB7866 vir- strains allowed us to identify sequence elements which promote
Regulation of Bordetella pertussis fim genes
399
IL 1
m. m
c CO I -r (D~g° •
0 00 " x ca
c)
n,c m ~ m r d x c-CL
•
N r
(0 00 ar (0 OD CL C~ m .j 0 • c •
(0 (0 00
r + - p
M
0 r
< N LO Oc .C .y (O CL N
z
a) 00
NU
c 2
--x
04 OO C LO • nd00+ ~xr .;
o n -c o(hmLO 2
c 00
•
m ac r N
ti .. O
Q I X
mho~CL E N(0 0 00 cr
. .
O) N c
`Q j
LU a . N 00
r
•
0COw 4 .L X I0 c' 4l
•• CO
N
p~ c
.C Q6 + c t: 0
• •y
cc 00 Q
N
CL O
c
Q y + cra U c 4j
r
w ( J .C j C-4 O) c d 000 + W'm(Nr N a Q
400
B . Riboli eta/
transcription of the fim genes in a vir-regulated manner . In addition these data are the first evidence for fimX being an expressed and vir-regulated gene . The difficulty in the identification of the fimX gene product might reflect the low level of transcription driven by the fimX promoter relative to the other fim genes . Cross-reactivity determined by the high protein homology between fimX, fim2 and fim3 products might have hampered its serological detection . We hypothesize that the product of fimX could either represent a structural fimbrial subunit for fimbriae present at a low copy number on the bacterial surface, or, alternatively, fimX might code for an adhesin . Our results show that the fim genes are under transcriptional control of the vir components and that the regions examined contain all of the elements necessary for vir regulation of these genes . In a parallel analysis of the three fim promoters we have identified a region of high homology in the -60 to -20 region comprising two sequence elements, the 'fim box' and the 'C-stretch' (Fig . 3) . Recent experiments' have shown that in the PT promoter there is a shorter run of cytosines (four situated around -35) the deletion of which causes a dramatic decrease in the rate of transcription from this promoter . Our functional experiments with the fim2 promoter deletion mutants suggest that, for the fim genes, the integrity of both regions is important for optimal transcription and essential for vir regulation . In fact, both the single and the double deletion mutants cause a large decrease in the CAT activity driven by these promoters . While it is possible that altering the distance between the sequences we have identified and other sequences further upstream could be enough to abolish promoter activity, we know that, at least for the fim3 promoter, the region comprising just the 'fim box', 'C-stretch' and 20 by upstream, is large enough to preserve the fim3 promoter strength as compared to longer fim3 upstream sequences . We suggest that the 'fim box' and the 'C-stretch' sequences might constitute the binding regions for two separate, interacting, transcriptional factors, based on the fact that the residual CAT activity, driven by the pR202 promoter (deleted in the 'C-stretch' only), is still vir regulated while both the 'fim box' deletion and the double deletions abolish vir regulation . The results obtained with the fimX promoter mutants are in agreement with this hypothesis : while pRXM1 sequence, carrying a T -+ C alteration in the 'fim box' similar to fim2, displays promoter activity and vir regulation similar to the wild-type pRX, the pRXM2 promoter, which contains a longer 'C-stretch', does not lose strength in respect to pRX but is not vir regulated . The change in distance between the 'fim box' and the binding region for the polymerase complex might disrupt their interaction, necessary for vir regulation . Thus the activation of the transcription of fim genes would require the synergistic activity of both regulatory proteins binding to close sequences and establishing protein/protein interactions with a defined stereospecificity . Our results also confirm that the same specific sequences are required for MgSO,dependent modulation mediated by vir components . The constitutive behaviour of the fim3 promoter we have isolated remains to be explained . The B . pertussis Tohama fim3 gene sequence has been published recently, 14 and it differs from our sequence (derived from B . pertussis BPSA1, the serotype of which is unknown) in the presence of a three cytosines longer 'C-stretch' in the corresponding region . In light of these data, we suggest that in fact the deletion of three cytosines in the fim3 'C-stretch' might disrupt the alignment of DNA binding factors on the helix and the interaction necessary for proper vir regulation of transcription of these genes . After our work had been completed, an extensive analysis of the fim genes' 5' upstream sequences from B . pertussis strains expressing varying amounts of fim3 was reported . 17 Interestingly, the sequences of fim3 promoters which direct different levels
Regulation of Bordetella pertussis fim genes
401
of transcription, differ in small insertions or deletions in the 'C-stretch', which alter the distance between the upstream sequences and the putative -10 box . The SA1 fim3 promoter sequence we have isolated (which is about 30% active with respect to fim2 and is constitutive), differs from the Wellcome 28 one (more active and vir regulated), in the deletion of four residues in the 'C-stretch' . All of our CAT activity data from wild-type and mutant sequences together with the reported results obtained for the fim3 variants, support the hypothesis that the regulation of expression of fim genes is based on proper alignment of regulatory factors in the first 80 bases upstream from the mRNA transcription site . In conclusion, we have shown that the fimX promoter, like that of fim2 is able to promote transcription in B . bronchiseptica and is vir regulated, and we have identified homologous sequence elements which might be involved in the binding of transcriptional activators . Materials and methods
Strains, media and plasmids . The genomic libraries were constructed from B . pertussis strain BPSA1 . 21 In the conjugation experiments we used the vir+ B . bronchiseptica strain CCUG BB7865 and the vir- B . bronchiseptica BB7866, a spontaneously derived vir- mutant of the vir+ strain bearing a deletion in the bvgS gene, 20 both obtained from Sclavo Research Center ." B . bronchiseptica strains were grown on Bordet-Gengou plates 22 or in Stainer-Scholte liquid medium (SS medium), 23 in the presence of 40 µg/ml streptomycin . E. co/i strains JM101,24 SM1025 and pUC plasmids were used in the subcloning experiments and for the construction of mutants . The CAT-gene promoter fusions were made in the low copy number vector pLAFR2, a derivative of broad host range plasmid RK2 . 26 The CAT gene was isolated from the pA10-CAT2 plasmid .27 Cloning of fim gene promoters . fim2, fimX and fim3 promoter regions cloned upstream from the CAT coding gene (Fig . 1), comprise sequences of 383, 539 and 1330 by respectively upstream from the mRNA start points (see arrows in Fig . 3) as determined by primer extension experiments . The fim2 promoter region was obtained from a partial Sau3A genomic library of chromosomal DNA of B . pertussis strain BPSA1, constructed in cosmid pHC79 .28 The library was screened by colony hybridization under stringent conditions with oligonucleotide probes . All positive cosmids contained a 4400 by Pstl fragment bearing both promoter and structural fim2 sequences . For the subsequent CAT-gene promoter fusion in pLAFR2, the fim2 regulatory region was first subcloned in a pUC plasmid and then reisolated as a BamHI-HindIII fragment containing 383 by upstream from the fim2 mRNA start point . This sequence and the Hindl ll-Xbal fragment containing the promoterless CAT gene were then inserted into pLAFR2 digested with BamHlXbal, resulting in the construction of the pR2 plasmid (Fig . 1) . The fimX promoter sequence was isolated from a genomic library in pUC12 obtained by digestion of chromosomal DNA of B . pertussis strain BPSA1 with EcoRl and cloning of the 34 kb region identified in preliminary experiments as containing the fimX structural gene ." The library was screened by colony hybridization under stringent conditions and from a positive plasmid a 539 by Haell-BamHl fragment containing the fimX promoter region was isolated . This Haell-BamHI fragment, made blunt at both ends, and the Hindlll-Xbal fragment containing the promoterless CAT gene, treated with the Klenow fragment of Poll at the HindIIl extremity, were ligated with pLAFR2 digested with BamHI-Xbal, made blunt at the BamHl site, resulting in the pRX plasmid (Fig . 1) . Both promoter and structural fim3 regions were obtained from the same chromosomal library of B . pertussis strain BPSA1 used for the isolation of fim2 gene . The library was screened under stringent conditions with oligonucleotide probes and a 2900 by Pstl fragment bearing both promoter and structural fim3 sequences was isolated from a positive cosmid . For the subsequent CAT-gene promoter fusion in pLAFR2, the fragment containing the fim3 promoter region was first subcloned in pUC plasmid and then reisolated as Pstl-Hindll l fragment containing the 1330 by upstream from the fim3 mRNA start point . This sequence and the Hindlll-Xbal fragment containing the promoterless CAT gene, were then ligated to pLAFR2
402
B . Riboli et al.
digested with Pstl-Xbal, resulting in the pR3 plasmid (Fig . 1 ) ; a plasmid carrying a shorter (80 by long) fim3 upstream sequence (from the Sau3A site indicated in Fig . 1 to the mRNA start point) was constructed deriving it from pR3 . The mutations in the fim2 and fimX promoters were generated by introduction of synthetic oligonucleotides (System 1 Plus DNA Synthesizer, Beckman) in the fimbrial specific region called 'fim box' and in the downstream 'C-stretch' (Fig . 4) . As a negative control plasmid pLAFR-CAT : the Hindlll-Xbal promoterless CAT gene, made blunt at the Hindlll extremity, was cloned in pLAFR2 plasmid digested with Xbal and BamHl previously treated with the Klenow fragment of Poll . Conjugation . For the transfer of these constructions into B. bronchiseptica, the mobilizing strain SM10 of E. coli was used . Conjugations with B . bronchiseptica strains BB7865 and BB7866 were carried out with fresh cultures of the recipient and donor strains on BordetGengou plates for 6 h . Exconjugants were selected on Bordet-Gengou plates containing tetracycline 10 pg/ml and streptomycin 40 jig/ml ." CAT assay. B . bronchiseptica strains were grown in Stainer-Scholte medium in the presence of 10 pg/ml tetracycline and 40 pg/ml streptomycin . After reaching an OD 580 of 0 .7-0 .8, 1 ml of the culture was briefly centrifuged and the cells resuspended in 300 PI of 0 .25 M Tris-HCI pH 7 .8 . Cells were then disrupted by sonication and centrifuged in an Eppendorf centrifuge for 10 min at 4°C . The supernatant was incubated at 65°C for 8 min, centrifuged and used for the assay ." 0 .1 µCI of [ 14 C] chloramphenicol and 20 pl of 4 mm acetylcoenzyme A were added to 150 pl of lysates in 0 .25 M Tris-HCI pH 7 .8 ; all extracts were diluted 1 :150 with the exception of pR2 extract (1 : 450) to maintain the enzymatic activity in the linear range of the reaction, as established by previous experiments . After incubation at 37°C for 1 h, the reaction mixture was stopped by extraction of the chloramphenicol and its derivates with 2 ml of cold ethyl acetate . The organic phase was evaporated and the different chloramphenicol forms were separated by thin-layer chromatography on silica gel plates using a 95 : 5 (v/v) chloroform/methanol mixture . Qualitative results were then visualized by autoradiography of the thin-layer plates . Previous experiments verified that the dilutions used for each sample analysed were in the linear range of the enzymatic reaction . After autoradiography promoters strength was quantitatively valuated by cutting out the nonacetylated and monoacetylated chloramphenicol forms and measuring their radioactivity with a Beckman 7500 beta-counter . Modulation . A single colony of the vir+ B . bronchiseptica BB7865 and vir- BB7866, harbouring the proper plasmids, were inoculated in flasks containing either 10 ml of StainerScholte medium or 10 ml of the same medium supplemented with MgSO 4 to a final concentration of 50 mm . After overnight growth at 35°C, the cultures were used to inoculate fresh medium to an initial OD580 of 0 .1 .' After growth to an OD 580 of 0 .7, the cells were treated as already described for CAT assay . Primer extension . mRNA from cultures of B. bronchiseptica BB7865 and BB7866 containing the promoter-CAT constructs and grown exactly in the same conditions as for the CAT assay, was isolated following methods described elsewhere .' The primer extension analysis were performed as previously described, 29 using a primer complementary to the first 30 nucleotides of the CAT coding region . The products of the transcriptions were analysed on polyacrylamide gels in parallel with a sequence ladder used as size standard (data not shown) ; 10 ng of total RNA were used for each construct .
We wish to thank Rino Rappuoli for helpful comments and critical reading of the manuscript . We are also grateful to Emilia lennaco for her skilful secretarial assistance . This work was supported by a grant from ENI .
References 1 . Cowell JL, Urisu A, Zhang JM, Steven AC, Manclark CR . The filamentous hemagglutinin and fimbriae of Bordete/la pertussis : properties and roles in attachment . In : Leive L, ed. Microbiology. Washington DC : American Society for Microbiology, 1986 ; 55-8 .
Regulation of Bordetella pertussis fim genes
403
2 . Mooi FR, van der Heide HGJ, ter Avest AR et al. Characterization of fimbrial subunits from Bordetella species . Microbial Pathogenesis 1987 ; 2 : 473-84 . 3 . Relman DA, Domenghini M, Tuomanen E, Rappuoli R, Falcow S . Filamentous hemagglutinin of Bordetella pertussis : nucleotide sequence and crucial role in adherence . Proc Natl Acad Sci USA 1989 ; 86 :2637-41 . 4 . Ashworth LAE, Robinson A, Funnell S, Gorringe AR, Irons LI, Seabrook RN . Agglutinogens and fimbriae of Bordetella pertussis . Tokai Exp Clin Mad 1988 ; 13 (suppl) : 203-10 . 5 . Weiss AA, Hewlett EL . Virulence factors of Bordetella pertussis . Annu Rev Microbiol 1986 ; 40 : 66186 . 6 . Weiss AA, Falkow S . Genetic analysis of phase change in Bordetella pertussis . Infect Immun 1984 ; 43 : 263-9 . 7 . Gross R, Rappuoli R . Pertussis toxin promoter sequences involved in modulation . J Bacteriol 1989; 171 : 4026-30 . 8 . Weiss AA, Hewlett EL, Myers GA, Falkow S . Tn5-induced mutations affecting virulence factors of Bordetella pertussis . Infect Immun 1983 ; 42 : 33-41 . 9 . Stibitz S, Aaronson W, Monack D, Falkow S . Phase variation in Bordetella pertussis by frameshift mutation in gene for a novel two-component system . Nature 1989 ; 338 : 266-9 . 10 . Arico B, Miller JF, Roy C et al. Sequences required for expression of Bordetella pertussis virulence factors share homology with prokaryotic signal transduction proteins . Proc Natl Acad Sci USA 1989 ; 86 : 6671-5 . 11 . Scarlato V, Prugnola A, Arico B, Rappuoli R . Positive transcriptional feedback at the bvg locus controls expression of virulence factors in Bordetella pertussis . Proc Natl Acad Sci USA 1990; 87 : 6753-7 . 12 . Albright LM, Huala E, Ausubel FM . Prokaryotic signal transduction mediated by sensor and regulator protein pairs . Ann Rev Genetics 1989 ; 23 : 311-36 . 13 . Livey I, Duggleby CJ, Robinson A . Cloning and nucleotide sequence analysis of the serotype 2 fimbrial subunit gene of Bordetella pertussis . Mol Microbiol 1987 ; 1 : 203-9 . 14 . Mooi FR, ter Avest A, van der Heide HGJ . Structure of the Bordetella pertussis gene coding for the serotype 3 fimbrial subunit . FEMS Microbiol Lett 1990 ; 66 : 327-32 . 15 . Cuzzoni A, Pedroni P, Riboli B, Grandi G, de Ferra F . Nucleotide sequence of the fim3 gene from Bordetella pertussis and homology to fim2 and fimX gene products . Nucleic Acids Res 1990 ; 18 : 1640 . 16 . Pedroni P, Riboli B, de Ferra F et al. Cloning of a novel pilin-like gene from Bordetella pertussis : homology to the fim2 gene . Mol Microbiol 1988 ; 2 : 539-43 . 17 . Willems R, Paul A, van der Heide HGJ, ter Avest AR, Mooi FR . Fimbrial phase variation in Bordetella pertussis: a novel mechanism for transcription regulation . EMBO Jour 1990 ; 9 : 2803-9 . 18 . Gross R, Rappuoli R . Positive regulation of pertussis toxin expression . Proc Natl Acad Sci USA 1988 ; 85 :3913-17 . 19 . Arico B, Monack DM, Falkow S, Rappuoli R . Structure and molecular properties of the bvg locus in Bordetella species . Mol Microbiol 1990 ; in press . 20 . Monack DM, Arico B, Rappuoli R, Falkow S . Phase variants of Bordetella bronchiseptica arise by spontaneous deletion in the vir locus . Mol Microbiol 1989 ; 3 : 1719-28. 21 . Arico B, Rappuoli R . Bordetella parapertussis and Bordetella bronchiseptica contain transcriptionally silent pertussis toxin genes . J Bacteriol 1987 ; 169: 2847-53 . 22 . Bordet J, Gengou 0 . L'endotoxine coquelucheuse. Ann Inst Pasteur Paris 1909 ; 23 : 415-19 . 23 . Stainer DW, Scholte MJ . A simple chemically defined medium for the production of phase I Bordetella pertussis. J Gen Microbiol 1971, 63 : 211-20 . 24 . Yanisch-Perron C, Vieira J, Messing J . Improved M13 phage cloning vectors and host strains : nucleotide sequences of the M13mp19 and pUC19 vectors . Gene 1985, 33 : 103-19 . 25 . Simon R, Priefer U, Publer A . A broad host range mobilization system for in vivo genetic engineering : transposon mutagenesis in Gram negative bacteria . Bio/Technol 1983; 1 : 784-91 . 26 . Friedman AM, Long SR, Bown SE, Buikema WJ, Ausubel FM . Construction of a broad host range cosmid cloning vector and its use in the genetic analysis of Rhizobium mutants . Gene 1982 ; 18 : 289-96 . 27 . D'Onofrio C, Colantuoni V, Cortese R . Structure and cell-specific expression of a cloned human retinol binding protein gene : the 5'-flanking region contains hepatoma specific transcriptional signals . EMBO J 1985 ; 4 :1981-9 . 28 . Hohn B, Collins J . A small cosmid for efficient cloning of large DNA fragments . Gene 1980; 11 : 291-9 . 29 . Bensi G, Raugei G, Klefenz H, Cortese R . Structure and expression of the human haptoglobin locus . EMBO J 1985 ; 4 :119-26 .
Expression of Bordetella pertussis fimbrial (fim) genes in Bordetella bronchiseptica : fimX is expressed at a low level and vir-regulated B . Riboli, P . Pedroni, A . Cuzzoni, G . Grandi and F . de Ferra* Eniricerche S.p .A ., Department of Genetic Engineering and Microbiology, Via F . Maritano 2620097 San Donato Milanese, Milan, Italy (Received November 23, 1990 ; accepted in revised form January 26, 1991)
Riboli, B . (Eniricerche S .p .A ., Dept of Genetic Engineering and Microbiology, Via F . Maritano 26-20097 San Donato Milanese, Milan, Italy), P . Pedroni, A . Cuzzoni, G . Grandi and F . de Ferra . Expression of Bordetella pertussis fimbrial (fim) genes in Bordetella bronchisepta : fimX is expressed at a low level and vir-regulated . Microbial Pathogenesis 1991 ; 10 : 393-403 . To identify the elements involved in Bordetella pertussis fimbriae regulation and to determine whether fimX is an expressed gene, the promoter regions of fimX, fim2 and fim3 from strain BPSA1 were isolated and linked to the promoterless CAT gene in pLAFR2 . By following CAT activity in Bordetella bronchiseptica vir+ and vir- strains we established that the fimX promoter, like those for fim2 and fim3, is active, although at a low level, and vir-regulated . This suggests that the fimX protein might be produced in minute quantities which are not detectable by conventional methods . Comparison of the three fim promoter sequences and transcriptional activities identifies two conserved elements necessary for transcription in the -60 to -20 region : the 'firn box' and the 'C-stretch' . Mutations in these two sequences drastically reduce transcription and alter the interaction with vir components, suggesting a role for the two elements in the regulation of fim genes . Finally, we suggest that the apparent constitutive nature of fim3 in BPSA1 is due to a modification in the length of the 'C-stretch' . Key words : Bordetella pertussis; fimbriae; fim genes ; regulation .
Introduction The membrane-associated fimbriae (or pili) of Bordetella pertussis are classified among the B . pertussis virulence determinants having the possible role in mediating, together with other membrane components, 1-3 the attachment of the bacteria to the ciliated epithelium of the upper respiratory tract in the first stages of the disease . Purified fimbrial preparations have been shown to induce immunological protection against subsequent infection by isotypic strains,' and therefore they have been considered as good candidates for inclusion in acellular pertussis vaccines . Different isolates of B . pertussis can be distinguished by their cross-reactivity with 'typing' sera which identify major antigenic determinants on the surface of B . pertussis . While some of these antigens are present in all B . pertussis strains, the antigens associated with the fimbriae` are found in different combinations in different strains, and also in different
Author to whom correspondence should be addressed . 0882-4010/91/050393+11 $03 .00/0
© 1991 Academic Press Limited
394
B . Riboli et al.
isolates from the same strain .' This phenomenon (antigenic variation) is based on the differential expression of multiple fim genes by B. pertussis strains . Like other virulence associated factors of B . pertussis, fimbriae are not expressed phenotypically in the avirulent phase of B . pertussis (phase variation) 6 .6 and are reversibly regulated by growth conditions (modulation) .' A single genetic locus (named vir or bvg) has been identified by transposon mutagenesis which controls the phase variation and modulation phenomena ." The vir locus has been originally proposed to encode a positive pleiotropic inducer(s) which coordinately turns on the expression of virulence factor genes 6 and its recent cloning and characterization brings support to this hypothesis .", " The putative products of the two vir-related genes, bvgA and bvgS, share homologies with a series of bacterial regulatory proteins belonging to the 'two-component' systems ." In general one of the two components is a membrane-associated receptor for changes in metabolite concentrations or growth conditions (sensor) which modifies by phosphorylation the second component (regulator), a cytoplasmic DNA-binding protein which, when activated, either promotes or represses transcription of the genes regulated by the system . In the past few years, several of the genes coding for B . pertussis virulence factors have been cloned, including the pertussis toxin (PT) gene, the filamentous hemagglutinin (FHA) gene, the gene coding for the 69 kDa protein, the adenylate cyclase gene (cya) and the genes coding for the major fimbrial components corresponding to serotypes 2 and 3, named fim2, t 3 fim3, 21415 and fimX 16 the gene product of which is unknown . To determine whether fimX might be an active gene and to study the elements involved in fimbrial expression and regulation, we have isolated fimX, fim2 and fim3 putative regulatory regions, functionally defined their promoter sequences, and identified mutations which disrupt the productive interaction of the vir components with the promoters . With these experiments we show that the fimX promoter is active and vir regulated, but less strong than the other two . We have also identified conserved regions in the three promoters, the integrity of which is essential for the proper expression and regulation of fimbrial genes . Since the completion of our work, Willems et al." have published an analysis of fim genes' upstream sequences from B . pertussis strains which express variable levels of fim3 . We will also discuss our results in the context of these recent findings .
Results Cloning and functional assay of fim promoters In order to identify the regulatory sequences involved in the expression of the B . pertussis fimbrial genes, we isolated the genomic clones corresponding to the three fim genes fim2, fim3 and fimX from cosmid and plasmid libraries derived from B. pertussis strain BPSA1 . Clones containing the fimbrial coding regions were previously isolated by homology to a degenerate probe hybridizing to the conserved amino acid terminus of the mature portion of the fimbrial subunits,"' and the identity of the clones was assigned by sequencing and/or hybridization to probes specific for each type of fimbriae . Subsequently, DNA restriction fragments containing the coding and 5' upstream regions were subcloned in pUC plasmids for further analysis . To determine whether the promoter regions of the fim genes were under transcriptional regulation by the vir components, we took advantage of the functional relationship between the B. pertussis and B . bronchiseptica species, where it has been shown that the vir components of B . bronchiseptica cross-interact with the PT gene regulatory sequences in a physiological manner ." The fim upstream sequences were cloned in the broad
395
Regulation of Bordetella pertussis fim genes 5' upstream sequences Sphl
SO/71 I
S1ul
fim2
*ATG
t
383 by
Promoterless CAT gene 1630 by
mRNA start point
Barn HI I-/cell Avol Awl ll I
fimX
539 by
*ATG
Promoter less 1630
t
CAT gene
by
mRNA start point
Avail
PS/
I
fim3 I
*ATG
Sau3A I
1330 by
Promoterless CAT gene 1630
t
by
mRNA start point
Fig . 1 . fim genes' 5' upstream regions cloned in pLAFR2 and analysed in the CAT assay experiments .
host range, low copy number plasmid pLAFR2 in E. coli, juxtaposed to the promoterless CAT gene (see Materials and methods and Fig . 1) and the constructs were introduced in the B . bronchiseptica vir+ strain BB7865 and in the B . bronchiseptica vir- BB7866 by conjugation . The mutation carried by the BB7866 vir- strain has been characterized as a deletion in the bvgS gene, predicted to result in the synthesis, in this strain, of only the amino-terminal region of BvgS . 19,20 Extracts of the conjugants were assayed for CAT activity at the mid-logarithmic phase of growth . Transcription of the CAT gene in the vir+ B . bronchiseptica strain BB7865 revealed strong promoters in the fim2 and fim3 upstream sequences and a weak promoter in the fimX upstream sequence (Fig . 2 and Table 1) . In B . bronchiseptica strain BB7866, the fim2 and fimX promoters were inactive, indicating that the activation of transcription promoted by pR2 and pRX depends on the presence of functional vir components (Fig . 2) . On the other hand, in this assay the plasmid carrying the fim3 upstream sequence promotes CAT transcription constitutively, at the same level in a vir+ or vir- background (Table 1) . The same amounts of CAT transcription in vir+ and vir- background were observed to be
Table 1
Activity of fimbrial promoters vir+
pR2 pR3 pRX
vir-
vir+ plus MgSO 4
100.00% 33.70% 1 .63%
0 .34% 35 .02% 0 .14%
0 .57%
pR2A1 pR2A2 pR2A3
0 .48% 5.00% 1 .65%
0 .44% 0 .25% 1 .42%
0 .38% 0 .29%
pLAFR-CAT
0.39%
0 .38%
Plasmids pR2, pR3, pRX and the derivatives pR2A1, pR2A2 and pR2A3 were introduced in B. bronchiseptica BB7865 (vir+) and BB7866 (vir-) strains . Results of the quantitative assay are expressed as percent acetylation with respect to CAT activity of pR2 in BB7865 extracts, the absolute value of which is 94 .3 U/pg (one CAT unit is defined as the amount of enzyme that transfers 1 nmole of acetyl moiety per minute) . The data represent the average of at least two independent experiments . (- = not done) .
396
B . Riboli eta[ 1
2
3
4
5
6
Fig . 2 . Thin-layer chromatography CAT assay of extracts containing fim2 and fimX 5' upstream sequences in B . bronchiseptica BB7865 (vir+) and B. bronchiseptica BB7866 (vir-) strains . The assays were performed as described in Materials and methods . Lanes : 1, pLAFR-CAT in B. b . 7865 (vir+) ; 2, pLAFR-CAT in B . b. 7866 (vir-) ; 3, pR2 (fim2 promoter) in B. b . 7865 (vir+) ; 4, pR2 (fim2 promoter) in B . b. 7866 (vir-) ; 5, pRX (fimX promoter) in B . b. 7865 (vir+) ; 6, pRX (fimX promoter) in B . b . 7866 (vir-) .
promoted by a shorter fim3-CAT construct which includes only 80 by sequence upstream from the mRNA start point (data not shown) . The fact that the fimX 5' upstream region drives the transcription of the CAT gene in a vir-regulated manner, represents indirect evidence that this gene must be expressed in B. pertussis cells during the virulent phase . Primer extension analysis The exact start point of transcription of the CAT-coding mRNAs was determined by analysing the distance between the 5' terminus of the RNA and the first bases of the CAT-coding region by reverse transcriptase extension of a primer which hybridizes to the first 30 bases of the CAT-coding region . The length of the major extended fragments revealed start points of transcription at 72/73, 73, and 72 bases of distance from the CAT initiator codon for fim2, fim3 and fimX respectively (data not shown) and are indicated with an arrow on the 5' upstream region sequences in Fig . 3 . No extension was observed from sample RNAs from B . bronchiseptica vir- extracts (with the exception of the RNA derived from the culture containing the fim3 promoter harbouring plasmid), and from control incubations not containing RNA . This experiment shows that the sequences determining the promotion of CAT transcription are in fact located on the cloned fragments under analysis .
Functional assay of fim genes promoters Analysis of the sequences lying upstream from the putative start point of transcription revealed regions of homology between the three promoters (Fig . 3) which can be
Regulation of Bordetella pertussis fim genes
397
fim2
TGTTTCCCAC
CGGaATCA CCCCCCCCCCCCCCCTAAGACCTAAGATCGTGGCTCCAT
fimX
MP TTCCTAC
ATCCATCAG CCCCCC GAGGCGTCTAATAATCTTGCACACACAT
fim3
MPTTCCCACACAACCATCA
f i CCCCCCCC CGGACCTGATATTCTGATGCCGACGCCA\GCACAT I
fim box
C-stretch
Fig . 3 . Homologies among the fim promoters . 'fim boxes' and 'C-stretches' are marked . The arrows indicate mRNA start points as deduced from primer extension experiments .
identified as (i) a 'C-stretch' situated around nucleotide -35 and (ii) a second homology region just upstream from it, named here 'fim box' which is not immediately analogous to any sequence from other B . pertussis genes by computer analysis . The particular positioning of these sequences and their high degree of homology in all three genes compelled us to investigate further their possible role in the promotion of transcription and vir regulation of these genes by functional assays . Three mutants were constructed in which either the 'fim box' (pR2A1 plasmid) or the 'C-stretch'
(pR2A2 plasmid) or both (pR2A3 plasmid) were deleted from pR2 which contains the fim2 promoter (Fig . 4) . Functional assays on these deletion-mutants in a vir+ or vir- background were designed to determine whether either of these two conserved sequences is necessary for the fim genes vir-regulated promotion of transcription . Additionally, two mutants of the fimX promoter region were designed in an attempt to identify the sequence elements which determine the difference in strength between the relatively weaker promoter fimX with respect to fim2 (Fig . 4) . The first mutant (pRXM1) carries a point mutation in the 'fim box' (T C) which makes this sequence identical to the corresponding fim2 'fim box' sequence, while in the second mutant (pRXM2) the 'C-stretch' is lengthened from seven bases to the 16 cytosines of the fim2 promoter . The mutant plasmids were reintroduced into the vir+ B . bronchiseptica BB7865 and vir- BB7866 by conjugation and the CAT activity was assayed from the extracts of the respective conjugants . The results of this experiment for the fim2 deletion mutants are shown in Table 1 . While B . bronchiseptica 7865 (vir+) extracts containing the pR2 construct, carrying about 400 bases of upstream sequence from the fim2 gene display a CAT activity
pR2AI
fim2
TGTCTCCCAC
pR2A2
fCGGI \1CAGGCCCCCCCCCCCCCCCTAAGACCTMGATCGTGGCTCCAT
pR2A3
fimX
M4IICCTACA .ATCC~TCAACCCCCCGAGGCGTCTAATMTCTTGCACACACAT
/
C pRXMI
NN
i .000CCCCC pRM2
Fig . 4 . Deletion mutants of pR2 plasmid (pR2A1, pR2A2 and pR2A3) and modification mutants of pRX plasmid (pRXM1, pRXM2) . 'fim boxes' are indicated and 'C-stretches' are underlined . Brackets indicate the sequences deleted in the pR2 mutants, and the extra Cs inserted in the pRX mutant . The arrow indicates the point mutation (T C) .
398
B . Riboli et al .
which is similar to the PT promoter, the deletion mutants pR2A1 and A2 which carry deletions either in the 'fim-specific' sequence or in the 'C-stretch', show a large decrease in CAT activity with 0 .48% and 5 .00% residual activity, respectively (Fig . 5 and Table 1) . Interestingly, it appears that the residual CAT activity in the extract containing pR2A2 (deleted only in the 'C-stretch') is still dependent on the presence of the vir components, so that there is a further decrease (from 5 .00 to 0 .25%) in the CAT activity promoted by plasmid pR2A2 in B . bronchiseptica 7866 . In contrast, both pR2A1, deleted in the 'fim box' only, and pR2A3, with the double deletion, show no difference in CAT activity between the vir+ or vir- strains . CAT activity data in the extracts containing the fimX mutants (Fig . 5) indicate that in pRXM1, with the point mutation in the 'fim box', the promoter is still very weak and vir-regulated; thus the base change T-4 C does not affect either the interaction with the vir components, or the strength of the promoter . In contrast, pRXM2, mutated in the length of the 'C-stretch', directs an amount of CAT gene transcription similar in level to the wild-type promoter in a vir+ background, while a slight increase is observed in a vir- background indicating, for this mutant, the maintenance of promoter strength together with the loss of wild-type vir regulation . Altogether, these data indicate that both the 'fim box' and the 'C-stretch' sequences are indispensable in the proper wild-type configuration for transcription of the fim2 and fimX genes, while the presence of the 'fim box' sequence by itself might be enough to enhance transcription in a vir+ background . Modulation In the PT promoter certain sequences have been shown to be essential for both vir regulation and for the changes in the level of the toxin gene transcription by changes in growth conditions, thus connecting, at the molecular level, the two phenomena of phase variation and modulation .' To determine at which level the fim genes are modulated by changes in growth conditions and whether the homologous sequences we have identified among the three promoters are also involved in this phenomenon, we measured the CAT gene transcription driven in modulating conditions by plasmids pR2, pR2A1 and pR2A2 by CAT assays from extracts from the respective cultures . It has previously been shown that modulation can be observed in several conditions including : growth in medium supplemented with 50 mm MgSO 4 , or 5 mm nicotinic acid, or growth temperature below 35°C . We have chosen to alter the MgSO 4 concentration in the growth medium, which has been shown by others' to be equivalent to other modulating conditions with regard to the modulation of the PT gene transcription . Cells were grown in standard or modulating conditions and the extracts were assayed exactly as for the functional assays described above . The results of this experiment (Table 1) show that fimbrial transcription is effectively shut off when cells are grown in presence of high concentrations of MgSO 4 and that the small residual activity driven by the mutant plasmids is not modulated by the presence of MgSO4 with the exception of mutant pR2A2, which follows the same pattern of virdependent activity driven by plasmids containing vir-regulated promoters . These experiments confirm that the same sequences involved in phase variation are important for the regulatory DNA/protein interactions determining modulation . Discussion and conclusions Cloning of the B . pertussis fimbrial promoters in B . bronchiseptica BB7865 vir+ and BB7866 vir- strains allowed us to identify sequence elements which promote
Regulation of Bordetella pertussis fim genes
399
IL 1
m. m
c CO I -r (D~g° •
0 00 " x ca
c)
n,c m ~ m r d x c-CL
•
N r
(0 00 ar (0 OD CL C~ m .j 0 • c •
(0 (0 00
r + - p
M
0 r
< N LO Oc .C .y (O CL N
z
a) 00
NU
c 2
--x
04 OO C LO • nd00+ ~xr .;
o n -c o(hmLO 2
c 00
•
m ac r N
ti .. O
Q I X
mho~CL E N(0 0 00 cr
. .
O) N c
`Q j
LU a . N 00
r
•
0COw 4 .L X I0 c' 4l
•• CO
N
p~ c
.C Q6 + c t: 0
• •y
cc 00 Q
N
CL O
c
Q y + cra U c 4j
r
w ( J .C j C-4 O) c d 000 + W'm(Nr N a Q
400
B . Riboli eta/
transcription of the fim genes in a vir-regulated manner . In addition these data are the first evidence for fimX being an expressed and vir-regulated gene . The difficulty in the identification of the fimX gene product might reflect the low level of transcription driven by the fimX promoter relative to the other fim genes . Cross-reactivity determined by the high protein homology between fimX, fim2 and fim3 products might have hampered its serological detection . We hypothesize that the product of fimX could either represent a structural fimbrial subunit for fimbriae present at a low copy number on the bacterial surface, or, alternatively, fimX might code for an adhesin . Our results show that the fim genes are under transcriptional control of the vir components and that the regions examined contain all of the elements necessary for vir regulation of these genes . In a parallel analysis of the three fim promoters we have identified a region of high homology in the -60 to -20 region comprising two sequence elements, the 'fim box' and the 'C-stretch' (Fig . 3) . Recent experiments' have shown that in the PT promoter there is a shorter run of cytosines (four situated around -35) the deletion of which causes a dramatic decrease in the rate of transcription from this promoter . Our functional experiments with the fim2 promoter deletion mutants suggest that, for the fim genes, the integrity of both regions is important for optimal transcription and essential for vir regulation . In fact, both the single and the double deletion mutants cause a large decrease in the CAT activity driven by these promoters . While it is possible that altering the distance between the sequences we have identified and other sequences further upstream could be enough to abolish promoter activity, we know that, at least for the fim3 promoter, the region comprising just the 'fim box', 'C-stretch' and 20 by upstream, is large enough to preserve the fim3 promoter strength as compared to longer fim3 upstream sequences . We suggest that the 'fim box' and the 'C-stretch' sequences might constitute the binding regions for two separate, interacting, transcriptional factors, based on the fact that the residual CAT activity, driven by the pR202 promoter (deleted in the 'C-stretch' only), is still vir regulated while both the 'fim box' deletion and the double deletions abolish vir regulation . The results obtained with the fimX promoter mutants are in agreement with this hypothesis : while pRXM1 sequence, carrying a T -+ C alteration in the 'fim box' similar to fim2, displays promoter activity and vir regulation similar to the wild-type pRX, the pRXM2 promoter, which contains a longer 'C-stretch', does not lose strength in respect to pRX but is not vir regulated . The change in distance between the 'fim box' and the binding region for the polymerase complex might disrupt their interaction, necessary for vir regulation . Thus the activation of the transcription of fim genes would require the synergistic activity of both regulatory proteins binding to close sequences and establishing protein/protein interactions with a defined stereospecificity . Our results also confirm that the same specific sequences are required for MgSO,dependent modulation mediated by vir components . The constitutive behaviour of the fim3 promoter we have isolated remains to be explained . The B . pertussis Tohama fim3 gene sequence has been published recently, 14 and it differs from our sequence (derived from B . pertussis BPSA1, the serotype of which is unknown) in the presence of a three cytosines longer 'C-stretch' in the corresponding region . In light of these data, we suggest that in fact the deletion of three cytosines in the fim3 'C-stretch' might disrupt the alignment of DNA binding factors on the helix and the interaction necessary for proper vir regulation of transcription of these genes . After our work had been completed, an extensive analysis of the fim genes' 5' upstream sequences from B . pertussis strains expressing varying amounts of fim3 was reported . 17 Interestingly, the sequences of fim3 promoters which direct different levels
Regulation of Bordetella pertussis fim genes
401
of transcription, differ in small insertions or deletions in the 'C-stretch', which alter the distance between the upstream sequences and the putative -10 box . The SA1 fim3 promoter sequence we have isolated (which is about 30% active with respect to fim2 and is constitutive), differs from the Wellcome 28 one (more active and vir regulated), in the deletion of four residues in the 'C-stretch' . All of our CAT activity data from wild-type and mutant sequences together with the reported results obtained for the fim3 variants, support the hypothesis that the regulation of expression of fim genes is based on proper alignment of regulatory factors in the first 80 bases upstream from the mRNA transcription site . In conclusion, we have shown that the fimX promoter, like that of fim2 is able to promote transcription in B . bronchiseptica and is vir regulated, and we have identified homologous sequence elements which might be involved in the binding of transcriptional activators . Materials and methods
Strains, media and plasmids . The genomic libraries were constructed from B . pertussis strain BPSA1 . 21 In the conjugation experiments we used the vir+ B . bronchiseptica strain CCUG BB7865 and the vir- B . bronchiseptica BB7866, a spontaneously derived vir- mutant of the vir+ strain bearing a deletion in the bvgS gene, 20 both obtained from Sclavo Research Center ." B . bronchiseptica strains were grown on Bordet-Gengou plates 22 or in Stainer-Scholte liquid medium (SS medium), 23 in the presence of 40 µg/ml streptomycin . E. co/i strains JM101,24 SM1025 and pUC plasmids were used in the subcloning experiments and for the construction of mutants . The CAT-gene promoter fusions were made in the low copy number vector pLAFR2, a derivative of broad host range plasmid RK2 . 26 The CAT gene was isolated from the pA10-CAT2 plasmid .27 Cloning of fim gene promoters . fim2, fimX and fim3 promoter regions cloned upstream from the CAT coding gene (Fig . 1), comprise sequences of 383, 539 and 1330 by respectively upstream from the mRNA start points (see arrows in Fig . 3) as determined by primer extension experiments . The fim2 promoter region was obtained from a partial Sau3A genomic library of chromosomal DNA of B . pertussis strain BPSA1, constructed in cosmid pHC79 .28 The library was screened by colony hybridization under stringent conditions with oligonucleotide probes . All positive cosmids contained a 4400 by Pstl fragment bearing both promoter and structural fim2 sequences . For the subsequent CAT-gene promoter fusion in pLAFR2, the fim2 regulatory region was first subcloned in a pUC plasmid and then reisolated as a BamHI-HindIII fragment containing 383 by upstream from the fim2 mRNA start point . This sequence and the Hindl ll-Xbal fragment containing the promoterless CAT gene were then inserted into pLAFR2 digested with BamHlXbal, resulting in the construction of the pR2 plasmid (Fig . 1) . The fimX promoter sequence was isolated from a genomic library in pUC12 obtained by digestion of chromosomal DNA of B . pertussis strain BPSA1 with EcoRl and cloning of the 34 kb region identified in preliminary experiments as containing the fimX structural gene ." The library was screened by colony hybridization under stringent conditions and from a positive plasmid a 539 by Haell-BamHl fragment containing the fimX promoter region was isolated . This Haell-BamHI fragment, made blunt at both ends, and the Hindlll-Xbal fragment containing the promoterless CAT gene, treated with the Klenow fragment of Poll at the HindIIl extremity, were ligated with pLAFR2 digested with BamHI-Xbal, made blunt at the BamHl site, resulting in the pRX plasmid (Fig . 1) . Both promoter and structural fim3 regions were obtained from the same chromosomal library of B . pertussis strain BPSA1 used for the isolation of fim2 gene . The library was screened under stringent conditions with oligonucleotide probes and a 2900 by Pstl fragment bearing both promoter and structural fim3 sequences was isolated from a positive cosmid . For the subsequent CAT-gene promoter fusion in pLAFR2, the fragment containing the fim3 promoter region was first subcloned in pUC plasmid and then reisolated as Pstl-Hindll l fragment containing the 1330 by upstream from the fim3 mRNA start point . This sequence and the Hindlll-Xbal fragment containing the promoterless CAT gene, were then ligated to pLAFR2
402
B . Riboli et al.
digested with Pstl-Xbal, resulting in the pR3 plasmid (Fig . 1 ) ; a plasmid carrying a shorter (80 by long) fim3 upstream sequence (from the Sau3A site indicated in Fig . 1 to the mRNA start point) was constructed deriving it from pR3 . The mutations in the fim2 and fimX promoters were generated by introduction of synthetic oligonucleotides (System 1 Plus DNA Synthesizer, Beckman) in the fimbrial specific region called 'fim box' and in the downstream 'C-stretch' (Fig . 4) . As a negative control plasmid pLAFR-CAT : the Hindlll-Xbal promoterless CAT gene, made blunt at the Hindlll extremity, was cloned in pLAFR2 plasmid digested with Xbal and BamHl previously treated with the Klenow fragment of Poll . Conjugation . For the transfer of these constructions into B. bronchiseptica, the mobilizing strain SM10 of E. coli was used . Conjugations with B . bronchiseptica strains BB7865 and BB7866 were carried out with fresh cultures of the recipient and donor strains on BordetGengou plates for 6 h . Exconjugants were selected on Bordet-Gengou plates containing tetracycline 10 pg/ml and streptomycin 40 jig/ml ." CAT assay. B . bronchiseptica strains were grown in Stainer-Scholte medium in the presence of 10 pg/ml tetracycline and 40 pg/ml streptomycin . After reaching an OD 580 of 0 .7-0 .8, 1 ml of the culture was briefly centrifuged and the cells resuspended in 300 PI of 0 .25 M Tris-HCI pH 7 .8 . Cells were then disrupted by sonication and centrifuged in an Eppendorf centrifuge for 10 min at 4°C . The supernatant was incubated at 65°C for 8 min, centrifuged and used for the assay ." 0 .1 µCI of [ 14 C] chloramphenicol and 20 pl of 4 mm acetylcoenzyme A were added to 150 pl of lysates in 0 .25 M Tris-HCI pH 7 .8 ; all extracts were diluted 1 :150 with the exception of pR2 extract (1 : 450) to maintain the enzymatic activity in the linear range of the reaction, as established by previous experiments . After incubation at 37°C for 1 h, the reaction mixture was stopped by extraction of the chloramphenicol and its derivates with 2 ml of cold ethyl acetate . The organic phase was evaporated and the different chloramphenicol forms were separated by thin-layer chromatography on silica gel plates using a 95 : 5 (v/v) chloroform/methanol mixture . Qualitative results were then visualized by autoradiography of the thin-layer plates . Previous experiments verified that the dilutions used for each sample analysed were in the linear range of the enzymatic reaction . After autoradiography promoters strength was quantitatively valuated by cutting out the nonacetylated and monoacetylated chloramphenicol forms and measuring their radioactivity with a Beckman 7500 beta-counter . Modulation . A single colony of the vir+ B . bronchiseptica BB7865 and vir- BB7866, harbouring the proper plasmids, were inoculated in flasks containing either 10 ml of StainerScholte medium or 10 ml of the same medium supplemented with MgSO 4 to a final concentration of 50 mm . After overnight growth at 35°C, the cultures were used to inoculate fresh medium to an initial OD580 of 0 .1 .' After growth to an OD 580 of 0 .7, the cells were treated as already described for CAT assay . Primer extension . mRNA from cultures of B. bronchiseptica BB7865 and BB7866 containing the promoter-CAT constructs and grown exactly in the same conditions as for the CAT assay, was isolated following methods described elsewhere .' The primer extension analysis were performed as previously described, 29 using a primer complementary to the first 30 nucleotides of the CAT coding region . The products of the transcriptions were analysed on polyacrylamide gels in parallel with a sequence ladder used as size standard (data not shown) ; 10 ng of total RNA were used for each construct .
We wish to thank Rino Rappuoli for helpful comments and critical reading of the manuscript . We are also grateful to Emilia lennaco for her skilful secretarial assistance . This work was supported by a grant from ENI .
References 1 . Cowell JL, Urisu A, Zhang JM, Steven AC, Manclark CR . The filamentous hemagglutinin and fimbriae of Bordete/la pertussis : properties and roles in attachment . In : Leive L, ed. Microbiology. Washington DC : American Society for Microbiology, 1986 ; 55-8 .
Regulation of Bordetella pertussis fim genes
403
2 . Mooi FR, van der Heide HGJ, ter Avest AR et al. Characterization of fimbrial subunits from Bordetella species . Microbial Pathogenesis 1987 ; 2 : 473-84 . 3 . Relman DA, Domenghini M, Tuomanen E, Rappuoli R, Falcow S . Filamentous hemagglutinin of Bordetella pertussis : nucleotide sequence and crucial role in adherence . Proc Natl Acad Sci USA 1989 ; 86 :2637-41 . 4 . Ashworth LAE, Robinson A, Funnell S, Gorringe AR, Irons LI, Seabrook RN . Agglutinogens and fimbriae of Bordetella pertussis . Tokai Exp Clin Mad 1988 ; 13 (suppl) : 203-10 . 5 . Weiss AA, Hewlett EL . Virulence factors of Bordetella pertussis . Annu Rev Microbiol 1986 ; 40 : 66186 . 6 . Weiss AA, Falkow S . Genetic analysis of phase change in Bordetella pertussis . Infect Immun 1984 ; 43 : 263-9 . 7 . Gross R, Rappuoli R . Pertussis toxin promoter sequences involved in modulation . J Bacteriol 1989; 171 : 4026-30 . 8 . Weiss AA, Hewlett EL, Myers GA, Falkow S . Tn5-induced mutations affecting virulence factors of Bordetella pertussis . Infect Immun 1983 ; 42 : 33-41 . 9 . Stibitz S, Aaronson W, Monack D, Falkow S . Phase variation in Bordetella pertussis by frameshift mutation in gene for a novel two-component system . Nature 1989 ; 338 : 266-9 . 10 . Arico B, Miller JF, Roy C et al. Sequences required for expression of Bordetella pertussis virulence factors share homology with prokaryotic signal transduction proteins . Proc Natl Acad Sci USA 1989 ; 86 : 6671-5 . 11 . Scarlato V, Prugnola A, Arico B, Rappuoli R . Positive transcriptional feedback at the bvg locus controls expression of virulence factors in Bordetella pertussis . Proc Natl Acad Sci USA 1990; 87 : 6753-7 . 12 . Albright LM, Huala E, Ausubel FM . Prokaryotic signal transduction mediated by sensor and regulator protein pairs . Ann Rev Genetics 1989 ; 23 : 311-36 . 13 . Livey I, Duggleby CJ, Robinson A . Cloning and nucleotide sequence analysis of the serotype 2 fimbrial subunit gene of Bordetella pertussis . Mol Microbiol 1987 ; 1 : 203-9 . 14 . Mooi FR, ter Avest A, van der Heide HGJ . Structure of the Bordetella pertussis gene coding for the serotype 3 fimbrial subunit . FEMS Microbiol Lett 1990 ; 66 : 327-32 . 15 . Cuzzoni A, Pedroni P, Riboli B, Grandi G, de Ferra F . Nucleotide sequence of the fim3 gene from Bordetella pertussis and homology to fim2 and fimX gene products . Nucleic Acids Res 1990 ; 18 : 1640 . 16 . Pedroni P, Riboli B, de Ferra F et al. Cloning of a novel pilin-like gene from Bordetella pertussis : homology to the fim2 gene . Mol Microbiol 1988 ; 2 : 539-43 . 17 . Willems R, Paul A, van der Heide HGJ, ter Avest AR, Mooi FR . Fimbrial phase variation in Bordetella pertussis: a novel mechanism for transcription regulation . EMBO Jour 1990 ; 9 : 2803-9 . 18 . Gross R, Rappuoli R . Positive regulation of pertussis toxin expression . Proc Natl Acad Sci USA 1988 ; 85 :3913-17 . 19 . Arico B, Monack DM, Falkow S, Rappuoli R . Structure and molecular properties of the bvg locus in Bordetella species . Mol Microbiol 1990 ; in press . 20 . Monack DM, Arico B, Rappuoli R, Falkow S . Phase variants of Bordetella bronchiseptica arise by spontaneous deletion in the vir locus . Mol Microbiol 1989 ; 3 : 1719-28. 21 . Arico B, Rappuoli R . Bordetella parapertussis and Bordetella bronchiseptica contain transcriptionally silent pertussis toxin genes . J Bacteriol 1987 ; 169: 2847-53 . 22 . Bordet J, Gengou 0 . L'endotoxine coquelucheuse. Ann Inst Pasteur Paris 1909 ; 23 : 415-19 . 23 . Stainer DW, Scholte MJ . A simple chemically defined medium for the production of phase I Bordetella pertussis. J Gen Microbiol 1971, 63 : 211-20 . 24 . Yanisch-Perron C, Vieira J, Messing J . Improved M13 phage cloning vectors and host strains : nucleotide sequences of the M13mp19 and pUC19 vectors . Gene 1985, 33 : 103-19 . 25 . Simon R, Priefer U, Publer A . A broad host range mobilization system for in vivo genetic engineering : transposon mutagenesis in Gram negative bacteria . Bio/Technol 1983; 1 : 784-91 . 26 . Friedman AM, Long SR, Bown SE, Buikema WJ, Ausubel FM . Construction of a broad host range cosmid cloning vector and its use in the genetic analysis of Rhizobium mutants . Gene 1982 ; 18 : 289-96 . 27 . D'Onofrio C, Colantuoni V, Cortese R . Structure and cell-specific expression of a cloned human retinol binding protein gene : the 5'-flanking region contains hepatoma specific transcriptional signals . EMBO J 1985 ; 4 :1981-9 . 28 . Hohn B, Collins J . A small cosmid for efficient cloning of large DNA fragments . Gene 1980; 11 : 291-9 . 29 . Bensi G, Raugei G, Klefenz H, Cortese R . Structure and expression of the human haptoglobin locus . EMBO J 1985 ; 4 :119-26 .
