308
EXPRESSION IN Y E A S T
[25]
in the cells differed; (3) the strains in which the cassettes were expressed differed; and (4) our strains contained a large excess of GALIO promoters on pKH4-related vectors that could have potentially provided a sink for excess GAIA protein at early times of induction. Since the GALlOp-GAL4 cassette works when either integrated into a chromosome or carried on a CEN vector, it has potential utility in yeasts other than S. cerevisiae providing they carry GAL regulatory functions analogous to those in S. cerevisiae. For transfer of the expression cassette to such yeasts, one need simply transfer either the 3.4-kb GALIOp-GAL4 EcoRI-HindIII fragment from pKHint-A or the 5.8-kb 5'-his3-GALIOpGAL4-URA3-his3-3' BamHI fragment from pKHint-C to a suitable CEN vector for subsequent transformation into the desired yeast. Alternatively, these fragments can be integrated into the genome using the his3 sequences as outlined here, providing the recipient carries homologous HIS3 sequences. In summary, S. cerevisiae strain Sc340 and/or the readily movable GALlOp-GAL4 cassette should prove generally useful for optimized and regulated expression of GALp-gene fusions carried on high-copy vectors in yeast.
[ 2 5 ] E x p r e s s i o n o f H e t e r o l o g o u s P r o t e i n s in S a c c h a r o m y c e s cerevisiae U s i n g t h e A D H 2 P r o m o t e r B y VIRGINIA L. PRICE, WAYNE E. TAYLOR, WILLIAM CLEVENGER, MARLIS WORTHINGTON, and ELTON T. YOUNG
Introduction The yeast alcohol dehydrogenase 2 gene (ADH2) is one of many yeast genes whose expression is regulated by glucose repression. The transcription of ADH2 is undetectable when yeast are grown on glucose and is derepressed to a level representing about 1% of soluble cellular protein when yeast are grown on a nonfermentable carbon source. The ADH2 promoter has been extensively analyzed by both site-specific mutagenesis and deletion analysis to reveal two cis-acting regulatory components (upstream activation sequences, or UAS) mediating derepression.',2 Either UAS element alone is sufficient to confer glucose-regulated expression on a heterologous promoter; both UAS elements together act D. R. Beier, A. T. Sledziewski, and E. T. Young, Mol. Cell. Biol. 5, 1743 (1986). 2j. Shuster, J. Yu, D. Cox, R. V. L. Chan, M. Smith, and E. T. Youn~ Mol. Cell. Biol. 6, 1894 (1986).
METHODS IN ENZYMOLOGY, VOL, 185
Copyright © 1990 by Academic Press, Inc. All rights of reproduction in any form reserved.
[25]
EXPRESSION USINGADH2 PROMOTER
309
synergistically to confer maximum expression on the promoter while keeping it tightly repressed on glucose.3 A protein encoded by the gene ADR1 has been identified as a positive activator of ADH2 transcription. 4 The ADR1 protein contains two zinc fingers5 enabling it to bind specifically to UAS 1,6 a perfect 22 base pair. (bp) inverted repeat. Glucose repression of ADH2 is due to a lack of positive activation by ADR1 rather than due to a negative mechanism acting through DNA-binding repressor proteins. 7 Recent data suggest that A D R I may be a phosphoprotein whose phosphorylation state could be regulated by glucose repression,s The A D H 2 promoter is very amenable for use in the expression of hctcrologous genes, not only because it provides a strong transcriptional start signal, but also because transcription from the A D H 2 promoter is tightly repressed by glucose in the growth medium, l,' Cultures can be grown to a high dcnsity in the presence of glucose, which keeps the promoter repressed. W h e n the glucose in the medium is depleted by mctabolism, the promoter is dereprcsscd to a high level.This procedure avoids changing the growth medium, adding inducing compounds, or changing the temperature in order to induce the promoter. Possible cytotoxic effectsof the heterologous protein are avoided since initialcellgrowth occurs in the absence of the protein. In addition, the cloned regulatory gene, ADRI, can be used to enhance expression from the A D H 2 promoter (see below). In this articlc,we describe the construction of various A D H 2 promoter plasmids for expression of hcterologous proteins in yeast as well as for secretioninto the culture medium. Construction of A D H 2 P r o m o t e r Plasmids A 4.7-kilobase-pair (kb) B a m H I - E c o R I DNA fragment containing the ADH2 structural gene was subcloned into pBR322 at the BamHI and EcoRI sites (pADH2, Fig. 1A).9 This fragment contains 1.2 kb of DNA sequences 5' to the ADH2 coding region and 2.7 kb of DNA 3' to the ADH2 coding region, and includes both the ADH2 promoter and a transcription terminator. To isolate the promoter fragment from the ADH2 structural gene for the insertion of heterologous coding sequences, a series 3 j. Yu, M. S. Donoviel, and E. T. Young, Mol. Cell. Biol. 9, 34 (1989). 4 C. L. Denis, M. Ciriacy, and E. T. Young, J. Mol. Biol. 148, 355 (1981). s T. Hartshorne, H. Blumberg, and E. T. Young, Nature (London) 320, 283 (1986). 6 A. Eisen, W. E. Taylor, H. Blumberg, and E. T. Young, Mol. Cell. Biol. 8, 4552 (1988). M. Irani, W. E. Taylor, and E. T. Young, Mol. Cell. Biol. 7, 1233 (1987). s C. L. Denis and C. Gallo, Mol. Cell. Biol. 6, 4026 (1986). 9 j. R. Broach, this series, Vol. 101. p. 307.
3 I0
A
EXPRESSION IN
Hpal
['25]
YEAST
EcoR%r I Hind111"
Hindin I
Hpa T
Born + Klenow, fill-in
XhoI
,
+ HindTITlinkers + Hind]][ + T41igase
Ap r V \
~
J
EcoRI
EcoRI Met Asp Pro Ile Ser AspLeu Ser ThrCysSerProSer CATGGATCCGATATCAGATCTGTCGACCTGCAGCCCAAGCT d.
, NcoI BornE~oRVBQ,I S~LI Ps,I
o.
,
b.
P'F so~ixgol B~R Srol
S,,~:
,
Sst~ Srnol Born Xbol Soll Pstl I
i
i
i
i
i
I
B a ~ o l l N ~ ~
re~ t~,~oto~~ori
{
XboI~
\
)
~pBR322
YI- pC-HAUHE (o, b, or d )
,./¢A~PstI pr
Leu-2 "LJ "EcoRI EcoRT "~,~,.~T"~'2/z EcoRI
XboI
FIG. 1. ADH2 promoter plasmids. (A) Plasmid pADH2 contains the ADH2 structural
gene, promoter, and terminator cloned into the BarnHl and EcoRI sites of pBR322, as described in the text. This plasmid was used to generate pADH2-2 by Bal31 deletions. pADH2-2 contains the ADH2 promoter sequence, a HindlII site at position - 1 to the ADH2 initiation codon, the C-terminal 279 bp of the ADH2 structural gene, and the ADH2 transcription terminator. (B)Plasmid YEpC-pADH2a, b, and d are yeast expression plasmids derived from pC1/1 (see text and Ref. 9) that contain a polylinker following the ADH2 promoter. YEpC-pADH2aand b contain the pUC13 polylinker in both orientations. YEpCPADH2d contains a polylink encodingthe initiation codon ATG. The nucleotide sequence of polylinker d is shown above line d, which depicts the restriction sites. o f Bal31 deletions were made as shown in Fig. 1A. Plasmid p A D H 2 was digested with E c o R V , which cleaves uniquely in the plasmid at nucleotide 69 in the A D H 2 structural gene, and Bal31 deletions were generated. D N A polymerase (Klenow fragment) was used to fill in overhanging ends and HindlII linkers were ligated onto the Bal31-generated ends. The D N A was then digested with HindlII to remove excess linkers and to cut the A D H 2 gene at its unique HindlII site at a m i n o acid 254. Ligation o f the resulting mixture created deletions extending leftward (5') variable distances from the E c o R V site and containing a c o m m o n 3' end point defined by the HindlII site in the A D H 2 structural gene.
[25]
EXPRESSION USlNC ADH2 PROMOTER
31 1
The deletions of interest were of two categories: (1) A deletion to -- 2 relative to the ADH2 translation initiation ATG, which therefore included the promoter and 5' untranslated region of ADH2 (plasmid pADH2-2). The presence of the natural mRNA start site and 5' untranslated region may aid in the translation of heterologous proteins. (2) Deletions to + 19, + 26, and + 27 bp (relative to the ADH2 ATG) provide, in addition to the above elements, the ATG initiation codon and a restriction site (HindlII) in three reading frames to fuse heterologous coding sequences lacking translational starts. These plasmids are designated p A D H 2 + 19, pADH2 + 26, and pADH2 + 27, respectively (not shown). Construction of Yeast Expression Plasmids Containing ADH2 P r o m o t e r The ADH2 promoter was inserted into the yeast-Escherichia coli shuttle vector pC 1/1 for expression in yeast, pC 1/1 is a multicopy 2-/tm plasmid that was constructed by insertion of pBR322 into the entire 2-gin form B plasmid at the EcoRI site which maps at 0 b p . 9 In this vector (see Fig. 1B), the selectable marker is the defective (promoterless) LEU2d gene, which was inserted into the blunted PstI site of the 2-gm plasmid.~° When pC1/1 is transformed into a cir ° yeast strain (lacking endogenous 2-gm plasmid) and grown selectively in leucine-deficient medium, the plasmid copy number reaches very high levels of 400- 500 copies per cell.7 When the ADH2 gene was cloned into this plasmid, the ADHII protein was overproduced about 20-fold, reaching approximately 20% of total cellular protein (unpublished observations). To generate a cloning site downstream of the ADH2 promoter, a set of plasmids was constructed by first inserting the polylinker from pUC13 into the HindlII site of plasmid pADH2-2. Then, the DNA fragment from the HpaI site (900 bp 5' to the polylinker) to the XhoI site (1.45 kb 3' to the polylinker) containing the ADH2 promoter, polylinker, and transcription terminator was inserted into the Sail site of vector pC 1/1. The addition of the ADH2 promoter and terminator to pCl/1 generated plasmids YEpC-PADH2a and YEpC-PADH2b containing the polylinker in the two orientations illustrated in Fig. 1B with unique restriction sites SmaI, BamHI, and Sail. This expression vector does not have an ATG codon within the 5' untranslated region of the polylinker. Therefore, it can be used for the cloning and expression of an intact gene having its own initiation codon. to j. D. Beggs, in "Molecular Genetics in Yeast" (D. Von Wettstein, A. Stenderup, M. Kielland-Brandt, and J. Friis, eds.), p. 383 (Alfred Benzon Symposium, Vol. 16). Munksgaard, Copenhagen, 1981.
312
EXPRESSION IN YEAST
[25]
A third yeast expression vector was made that is identical to YEpCPADH2a and b except that the polylinker region is replaced with a different polylinker containing an initiator ATG codon at its 5' end (YEpCPADH2d, Fig. 1B). This polylinker contains an NcoI site (not unique) at the ATG followed by the unique restriction sites BamHI, BglII, and SalI. Such a vector can be used to express coding regions lacking an initiator methionine. In all of the expression vectors described, the polylinker is located between the promoter and the transcription terminator of ADH2. This ensures that transcription initiated at the ADH2 promoter will not continue around the plasmid, possibly interfering with plasmid replication. Construction of Yeast Expression Plasmid Allowing Regulated Secretion of Heterologous Proteins A yeast expression vector was also constructed that contained the ADH2 promoter joined to the leader peptide from the secreted pheromone or-factor. This allows secretion of heterologous proteins whose transcription is regulated by the ADH2 promoter. This yeast-E, coli shuttle vector, designated paADH2 ~1 (Fig. 2A), contains most of pBR322 (from the SphI site at nucleotide 562, not regenerated in the vector, to the EcoRI site at nucleotide 4361), which includes the origin of replication and the ampicillin resistance marker. Sequences from yeast include (1) the TRP1 gene as a selectable yeast marker derived from plasmid YRp7; 12 (2)the 2-/tm origin of replication contained on the PstI to SpeI fragment obtained from plasmid YEp 13.9 This fragment also contains a transcription termination signal which is used to terminate transcripts from the ADH2 promoter. Unlike plasmid pC 1/l, plasmid potADH2 must be transformed into a cir + yeast strain, as it does not carry the entire 2-/tm plasmid genome; (3) the ADH2 promoter fragment from the BamHI site (not regenerated) to the HindIII site from plasmid pADH2-2; and (4) a DNA fragment coding for the 85-amino acid signal peptide derived from the a-factor gene to allow secretion of proteins. The tx-factor signal peptide was fused to the ADH2 promoter by means of a synthetic oligodeoxynucleotide that joined the HindIII site in the ADH2 promoter to the PstI site at nucleotide 24 in the or-factor leader sequence (regenerating the first eight amino acids of the or-factor leader). The HindIII site is not regenerated at the junction of the promoter and leader sequence. l l V. Price, D. Mochizuki, C. March, D. Cosman, M. Deeley, R. Klinke, W. Clevenger, S. Gillis, P. Baker, and D. Urdal, Gene 55, 287 (1987). 12 K. Struhl, D. Stinchcomb, S. Scherer, and R. Davis, Proc. NatL Acad. Sci. U.S.A. 76, 1035 (1979).
[25]
EXPRESSION USING ADH2 PROMOTER
313
Bgl]I
romol r /
ADH2p
ADH2~X,~ ~/'SpeI promoter~hm,-~,5
"= c
/
e ~
/
G)
°
/
15
/
O
o
lO ~ ::3.
•. . ~
0
2 5
1
r
0
"~
,
4
,
,
8 Hours
,
,
12
,
,
16
0
FIG. 3. Derepression of the ADH2 promoter in the absenc~ of glucose. The dashed line represents the growth (At0o)of Saccharomyces cerevisiaetransformed with plasmid paADH2 containing the eDNA encoding the cytokine murine GM-CSF. The culture was grown as described in the text. The arrow indicates the point at which glucosewas no longer detectable in the culture medium (Diastix glucosetest strips, Miles Laboratories,Elkhart, IN). The solid line shows the amount of secreted murine GM-CSF in the culture medium as determined by radioimmunoassay.
316
EXPRESSION IN YEAST
[25]
normally provided by a single-copy chromosomal gene). When ADR 1 is overexpressed, the chromosomal ADH2 locus is constitutively expressed and derepression to a much higher level occurs. 7,17 The overproduction of ADR 1 and its effect on transcription from the ADH2 promoter carried on a plasmid were therefore of interest. The expression of ADRI from its own promoter is relatively weak, based on analyses of ADRI mRNA and fl-galactosidase activity of an ADRl-fl-galactosidase fusion protein. 17 One means of increasing ADR 1 levels in yeast would be to express the gene from a very strong promoter. However, overexpression of ADR 1 on glucose-containing medium allows the ADH2 promoter to partially escape glucose repression. Hence, we sought a regulated promoter in order to maintain a low level of ADR 1 during glucose repression. It was thought that the ADH2 promoter itself could achieve this and, additionally, place the overexpression of ADR1 under glucose control. Placing the expression of ADR1 under control of the ADH2 promoter also might create a form of runaway "autoregulation" of ADR1 synthesis: the more ADR1 protein made, the more positive activation of the promoter, thus more ADRI made, etc. In order to initiate the cycle, the chromosomal copy of ADR1 is retained under the control of its own promoter, which allows a level of ADR1 to be present on glucose that can be posttranslationally modified to initiate the cycle. An integrating plasmid was constructed using the yeast integrating vector YIp512 and inserting the 1.2-kb ADH2 promoter fragment (from the BamHI site to the HindIII site from plasmid pADH2-2) followed by the ADR1 gene and the transcription termination sequences derived from the a-factor gene. Figure 2B illustrates two vectors that were made. pBC36 contains a 3.3-kb DNA fragment of the ADR1 gene from the Ncfl site, which includes 120 bp 5' to the initiation ATG codon, and DNA encoding the N-terminal 1068 amino acids (out of 1323 total amino acids) to the BamHI site. This portion of the ADR l protein is functional in activating the ADH2 promoter. 17 A second vector, pBC72, is identical to pBC36 except it includes the entire ADR1 coding region on a 6-kb NctI fragment. Plasmid pBC36 was integrated into the yeast chromosome at the ADR1 locus by first linearizing the plasmid with BglII, which cleaves at nucleotide- 1922 in the ADR1 gene (relative to the ATG). Transformation of yeast strain XV617 (MATa, ste5, his6, leu2, trpl, ura3) was done, selecting for Ura + transformants. Total DNA from four transformants was isolated and subjected to Southern blot analysis, which confirmed the integration of pBC36 at the ADR1 locus in all four cases (data not shown). This yeast strain was designated XV36. pBC72, on the other hand, was integrated ,7 H. Blumberg, T. Hartshorne, and E. T. Young, 34ol. Cell. Biol. 8, 1868 (1988).
[25]
EXPRESSION USINGADH2 PROMOTER
317
876 bp upstream of the ADH2 coding region by targeting to the MstII site. Again, four Ura + transformants were subjected to Southern blot analysis and the site of integration at the ADH2 locus was verified. This strain was designated XV72. The glucose regulation of ADRI mRNA synthesis was demonstrated for strain XV36 by SI and Northern blot analysis (data not shown). The A D R I mRNA derived from the gene fusion was undetectable during repressed growth, and was derepressed to a very high level when glucose was absent, consistent with the ADR1 gene being under the control of the ADH2 promoter. Comparison of the ADRI mRNA levels in the parent strain, XV617, and in strain XV36 also showed that ADR1 mRNA is greatly overproduced in strain XV36. To assess the effects of excess ADR1 protein on expression from the ADH2 promoter, the endogenous ADHII levels in strains XV617, XV36, and XV72 were compared. Strains XV36 and XV72 showed a 4-fold and a 5.5-fold increase in ADHII levels, respectively, over the parent strain, XV617 (not shown). The effect of excess ADR1 on heterologous gene expression from the ADH2 promoter was determined in a strain containing an integrated copy of the ADH2 promoter fused to the lacZ gene. Plasmid pADH2-lacZ (Fig. 4) is a YIp5-derived integrating plasmid containing the ADH2 promoter and DNA sequences corresponding to the N-terminal 23 amino acids of ADH2 (to the EcoRV site) fused to the lacZ gene from plasmid pMCI871.18 This plasmid was integrated at the ADH2 locus in strain XV36, which overexpresses ADRI mRNA, and in strain XV617 to serve as a control. Comparison of the regulated expression of fl-galactosidase in the two strains showed a 4- to 10-fold increase in fl-galactosidase levels in strain XV36 on derepression (Fig. 4). Under repressed conditions (growth on glucose), fl-galactosidase activity was very low, and similar to the activity of the parent strain, XV617, containing the A D H 2 - lacZ gene fusion. These results indicate that an excess of ADR 1 protein can enhance expression of foreign proteins from the ADH2 promoter and that the excess of positive activator can be regulated by glucose repression of the ADH2 promoter. The level of activity obtained from a single copy of the ADH2 promoter and excess ADRI provided by the same promoter is similar to the level of activation provided by a single-copy of the normal ADR1 gene and the ADH2 promoter on a high-copy plasmid. The advantages of the former system are 2-fold: All genes are stably integrated into a chromosome and the ADH2 promoter remains tightly repressed.
18 M. Casadaban, A. Martinez-Arias, S. Shapira, and J. Chou, this series, Vol. 100, p. 293.
318
[25]
EXPRESSION IN YEAST
900
~"
8oo
7OO
_>" 6oo .>_
"G 500 "-6 400 (D c~ 300
/
200
../
.o---~~ o
100 .
0
2
4
6
.
8
.
.
10
,
20
Hours FIG. 4. Regulated overproduction of ADR 1 stimulates ADH2-promoted expression of an ADH2-fl-galactosidase fusion protein. Strains XVtl7 and XV36 contain an ADH2-1acZ gene fusion integrated at the ADH2 locus. Strain XV36 contains an ADHR1 plasmid integrated at the ADR1 locus. Strains were grown in YPD and derepressedby shiftingto complete medium containing ethanol (2%)and glycerol(3%)as carbon sources. Sampleswere taken for fl-galactosidase (flGal)assays at the times indicated, p-Galactosidase activity is shown as the change in A420per minute per unit absorbance at A ~ multiplied by 1000. It was hoped that the A D R 1 runaway system would lead to even higher levels o f expression from a high-copy-number plasmid containing the A D H 2 p r o m o t e r driving a heterologous gene. We tested this idea using the .4DH2 gene itself on a high-copy plasmid. The A D H 2 activities in strain XV36 or XV72 containing Y E p A D H 2 were no higher than the activity in strain XV617 with the plasmid (30,000 U / m g after depression). This level is so high already that other factors may become limiting when both A D R 1 and the A D H 2 p r o m o t e r are present in large quantifies. Moreover, high levels o f A D R 1 seem to lead to toxicity during derepression, which m a y limit the ultimate level o f expression. Acknowledgments This work was supported by Immunex Corporation, Merck, Sharpe and Dohme Research Laboratories, and The National Institutes of Health.
EXPRESSION IN Y E A S T
[25]
in the cells differed; (3) the strains in which the cassettes were expressed differed; and (4) our strains contained a large excess of GALIO promoters on pKH4-related vectors that could have potentially provided a sink for excess GAIA protein at early times of induction. Since the GALlOp-GAL4 cassette works when either integrated into a chromosome or carried on a CEN vector, it has potential utility in yeasts other than S. cerevisiae providing they carry GAL regulatory functions analogous to those in S. cerevisiae. For transfer of the expression cassette to such yeasts, one need simply transfer either the 3.4-kb GALIOp-GAL4 EcoRI-HindIII fragment from pKHint-A or the 5.8-kb 5'-his3-GALIOpGAL4-URA3-his3-3' BamHI fragment from pKHint-C to a suitable CEN vector for subsequent transformation into the desired yeast. Alternatively, these fragments can be integrated into the genome using the his3 sequences as outlined here, providing the recipient carries homologous HIS3 sequences. In summary, S. cerevisiae strain Sc340 and/or the readily movable GALlOp-GAL4 cassette should prove generally useful for optimized and regulated expression of GALp-gene fusions carried on high-copy vectors in yeast.
[ 2 5 ] E x p r e s s i o n o f H e t e r o l o g o u s P r o t e i n s in S a c c h a r o m y c e s cerevisiae U s i n g t h e A D H 2 P r o m o t e r B y VIRGINIA L. PRICE, WAYNE E. TAYLOR, WILLIAM CLEVENGER, MARLIS WORTHINGTON, and ELTON T. YOUNG
Introduction The yeast alcohol dehydrogenase 2 gene (ADH2) is one of many yeast genes whose expression is regulated by glucose repression. The transcription of ADH2 is undetectable when yeast are grown on glucose and is derepressed to a level representing about 1% of soluble cellular protein when yeast are grown on a nonfermentable carbon source. The ADH2 promoter has been extensively analyzed by both site-specific mutagenesis and deletion analysis to reveal two cis-acting regulatory components (upstream activation sequences, or UAS) mediating derepression.',2 Either UAS element alone is sufficient to confer glucose-regulated expression on a heterologous promoter; both UAS elements together act D. R. Beier, A. T. Sledziewski, and E. T. Young, Mol. Cell. Biol. 5, 1743 (1986). 2j. Shuster, J. Yu, D. Cox, R. V. L. Chan, M. Smith, and E. T. Youn~ Mol. Cell. Biol. 6, 1894 (1986).
METHODS IN ENZYMOLOGY, VOL, 185
Copyright © 1990 by Academic Press, Inc. All rights of reproduction in any form reserved.
[25]
EXPRESSION USINGADH2 PROMOTER
309
synergistically to confer maximum expression on the promoter while keeping it tightly repressed on glucose.3 A protein encoded by the gene ADR1 has been identified as a positive activator of ADH2 transcription. 4 The ADR1 protein contains two zinc fingers5 enabling it to bind specifically to UAS 1,6 a perfect 22 base pair. (bp) inverted repeat. Glucose repression of ADH2 is due to a lack of positive activation by ADR1 rather than due to a negative mechanism acting through DNA-binding repressor proteins. 7 Recent data suggest that A D R I may be a phosphoprotein whose phosphorylation state could be regulated by glucose repression,s The A D H 2 promoter is very amenable for use in the expression of hctcrologous genes, not only because it provides a strong transcriptional start signal, but also because transcription from the A D H 2 promoter is tightly repressed by glucose in the growth medium, l,' Cultures can be grown to a high dcnsity in the presence of glucose, which keeps the promoter repressed. W h e n the glucose in the medium is depleted by mctabolism, the promoter is dereprcsscd to a high level.This procedure avoids changing the growth medium, adding inducing compounds, or changing the temperature in order to induce the promoter. Possible cytotoxic effectsof the heterologous protein are avoided since initialcellgrowth occurs in the absence of the protein. In addition, the cloned regulatory gene, ADRI, can be used to enhance expression from the A D H 2 promoter (see below). In this articlc,we describe the construction of various A D H 2 promoter plasmids for expression of hcterologous proteins in yeast as well as for secretioninto the culture medium. Construction of A D H 2 P r o m o t e r Plasmids A 4.7-kilobase-pair (kb) B a m H I - E c o R I DNA fragment containing the ADH2 structural gene was subcloned into pBR322 at the BamHI and EcoRI sites (pADH2, Fig. 1A).9 This fragment contains 1.2 kb of DNA sequences 5' to the ADH2 coding region and 2.7 kb of DNA 3' to the ADH2 coding region, and includes both the ADH2 promoter and a transcription terminator. To isolate the promoter fragment from the ADH2 structural gene for the insertion of heterologous coding sequences, a series 3 j. Yu, M. S. Donoviel, and E. T. Young, Mol. Cell. Biol. 9, 34 (1989). 4 C. L. Denis, M. Ciriacy, and E. T. Young, J. Mol. Biol. 148, 355 (1981). s T. Hartshorne, H. Blumberg, and E. T. Young, Nature (London) 320, 283 (1986). 6 A. Eisen, W. E. Taylor, H. Blumberg, and E. T. Young, Mol. Cell. Biol. 8, 4552 (1988). M. Irani, W. E. Taylor, and E. T. Young, Mol. Cell. Biol. 7, 1233 (1987). s C. L. Denis and C. Gallo, Mol. Cell. Biol. 6, 4026 (1986). 9 j. R. Broach, this series, Vol. 101. p. 307.
3 I0
A
EXPRESSION IN
Hpal
['25]
YEAST
EcoR%r I Hind111"
Hindin I
Hpa T
Born + Klenow, fill-in
XhoI
,
+ HindTITlinkers + Hind]][ + T41igase
Ap r V \
~
J
EcoRI
EcoRI Met Asp Pro Ile Ser AspLeu Ser ThrCysSerProSer CATGGATCCGATATCAGATCTGTCGACCTGCAGCCCAAGCT d.
, NcoI BornE~oRVBQ,I S~LI Ps,I
o.
,
b.
P'F so~ixgol B~R Srol
S,,~:
,
Sst~ Srnol Born Xbol Soll Pstl I
i
i
i
i
i
I
B a ~ o l l N ~ ~
re~ t~,~oto~~ori
{
XboI~
\
)
~pBR322
YI- pC-HAUHE (o, b, or d )
,./¢A~PstI pr
Leu-2 "LJ "EcoRI EcoRT "~,~,.~T"~'2/z EcoRI
XboI
FIG. 1. ADH2 promoter plasmids. (A) Plasmid pADH2 contains the ADH2 structural
gene, promoter, and terminator cloned into the BarnHl and EcoRI sites of pBR322, as described in the text. This plasmid was used to generate pADH2-2 by Bal31 deletions. pADH2-2 contains the ADH2 promoter sequence, a HindlII site at position - 1 to the ADH2 initiation codon, the C-terminal 279 bp of the ADH2 structural gene, and the ADH2 transcription terminator. (B)Plasmid YEpC-pADH2a, b, and d are yeast expression plasmids derived from pC1/1 (see text and Ref. 9) that contain a polylinker following the ADH2 promoter. YEpC-pADH2aand b contain the pUC13 polylinker in both orientations. YEpCPADH2d contains a polylink encodingthe initiation codon ATG. The nucleotide sequence of polylinker d is shown above line d, which depicts the restriction sites. o f Bal31 deletions were made as shown in Fig. 1A. Plasmid p A D H 2 was digested with E c o R V , which cleaves uniquely in the plasmid at nucleotide 69 in the A D H 2 structural gene, and Bal31 deletions were generated. D N A polymerase (Klenow fragment) was used to fill in overhanging ends and HindlII linkers were ligated onto the Bal31-generated ends. The D N A was then digested with HindlII to remove excess linkers and to cut the A D H 2 gene at its unique HindlII site at a m i n o acid 254. Ligation o f the resulting mixture created deletions extending leftward (5') variable distances from the E c o R V site and containing a c o m m o n 3' end point defined by the HindlII site in the A D H 2 structural gene.
[25]
EXPRESSION USlNC ADH2 PROMOTER
31 1
The deletions of interest were of two categories: (1) A deletion to -- 2 relative to the ADH2 translation initiation ATG, which therefore included the promoter and 5' untranslated region of ADH2 (plasmid pADH2-2). The presence of the natural mRNA start site and 5' untranslated region may aid in the translation of heterologous proteins. (2) Deletions to + 19, + 26, and + 27 bp (relative to the ADH2 ATG) provide, in addition to the above elements, the ATG initiation codon and a restriction site (HindlII) in three reading frames to fuse heterologous coding sequences lacking translational starts. These plasmids are designated p A D H 2 + 19, pADH2 + 26, and pADH2 + 27, respectively (not shown). Construction of Yeast Expression Plasmids Containing ADH2 P r o m o t e r The ADH2 promoter was inserted into the yeast-Escherichia coli shuttle vector pC 1/1 for expression in yeast, pC 1/1 is a multicopy 2-/tm plasmid that was constructed by insertion of pBR322 into the entire 2-gin form B plasmid at the EcoRI site which maps at 0 b p . 9 In this vector (see Fig. 1B), the selectable marker is the defective (promoterless) LEU2d gene, which was inserted into the blunted PstI site of the 2-gm plasmid.~° When pC1/1 is transformed into a cir ° yeast strain (lacking endogenous 2-gm plasmid) and grown selectively in leucine-deficient medium, the plasmid copy number reaches very high levels of 400- 500 copies per cell.7 When the ADH2 gene was cloned into this plasmid, the ADHII protein was overproduced about 20-fold, reaching approximately 20% of total cellular protein (unpublished observations). To generate a cloning site downstream of the ADH2 promoter, a set of plasmids was constructed by first inserting the polylinker from pUC13 into the HindlII site of plasmid pADH2-2. Then, the DNA fragment from the HpaI site (900 bp 5' to the polylinker) to the XhoI site (1.45 kb 3' to the polylinker) containing the ADH2 promoter, polylinker, and transcription terminator was inserted into the Sail site of vector pC 1/1. The addition of the ADH2 promoter and terminator to pCl/1 generated plasmids YEpC-PADH2a and YEpC-PADH2b containing the polylinker in the two orientations illustrated in Fig. 1B with unique restriction sites SmaI, BamHI, and Sail. This expression vector does not have an ATG codon within the 5' untranslated region of the polylinker. Therefore, it can be used for the cloning and expression of an intact gene having its own initiation codon. to j. D. Beggs, in "Molecular Genetics in Yeast" (D. Von Wettstein, A. Stenderup, M. Kielland-Brandt, and J. Friis, eds.), p. 383 (Alfred Benzon Symposium, Vol. 16). Munksgaard, Copenhagen, 1981.
312
EXPRESSION IN YEAST
[25]
A third yeast expression vector was made that is identical to YEpCPADH2a and b except that the polylinker region is replaced with a different polylinker containing an initiator ATG codon at its 5' end (YEpCPADH2d, Fig. 1B). This polylinker contains an NcoI site (not unique) at the ATG followed by the unique restriction sites BamHI, BglII, and SalI. Such a vector can be used to express coding regions lacking an initiator methionine. In all of the expression vectors described, the polylinker is located between the promoter and the transcription terminator of ADH2. This ensures that transcription initiated at the ADH2 promoter will not continue around the plasmid, possibly interfering with plasmid replication. Construction of Yeast Expression Plasmid Allowing Regulated Secretion of Heterologous Proteins A yeast expression vector was also constructed that contained the ADH2 promoter joined to the leader peptide from the secreted pheromone or-factor. This allows secretion of heterologous proteins whose transcription is regulated by the ADH2 promoter. This yeast-E, coli shuttle vector, designated paADH2 ~1 (Fig. 2A), contains most of pBR322 (from the SphI site at nucleotide 562, not regenerated in the vector, to the EcoRI site at nucleotide 4361), which includes the origin of replication and the ampicillin resistance marker. Sequences from yeast include (1) the TRP1 gene as a selectable yeast marker derived from plasmid YRp7; 12 (2)the 2-/tm origin of replication contained on the PstI to SpeI fragment obtained from plasmid YEp 13.9 This fragment also contains a transcription termination signal which is used to terminate transcripts from the ADH2 promoter. Unlike plasmid pC 1/l, plasmid potADH2 must be transformed into a cir + yeast strain, as it does not carry the entire 2-/tm plasmid genome; (3) the ADH2 promoter fragment from the BamHI site (not regenerated) to the HindIII site from plasmid pADH2-2; and (4) a DNA fragment coding for the 85-amino acid signal peptide derived from the a-factor gene to allow secretion of proteins. The tx-factor signal peptide was fused to the ADH2 promoter by means of a synthetic oligodeoxynucleotide that joined the HindIII site in the ADH2 promoter to the PstI site at nucleotide 24 in the or-factor leader sequence (regenerating the first eight amino acids of the or-factor leader). The HindIII site is not regenerated at the junction of the promoter and leader sequence. l l V. Price, D. Mochizuki, C. March, D. Cosman, M. Deeley, R. Klinke, W. Clevenger, S. Gillis, P. Baker, and D. Urdal, Gene 55, 287 (1987). 12 K. Struhl, D. Stinchcomb, S. Scherer, and R. Davis, Proc. NatL Acad. Sci. U.S.A. 76, 1035 (1979).
[25]
EXPRESSION USING ADH2 PROMOTER
313
Bgl]I
romol r /
ADH2p
ADH2~X,~ ~/'SpeI promoter~hm,-~,5
"= c
/
e ~
/
G)
°
/
15
/
O
o
lO ~ ::3.
•. . ~
0
2 5
1
r
0
"~
,
4
,
,
8 Hours
,
,
12
,
,
16
0
FIG. 3. Derepression of the ADH2 promoter in the absenc~ of glucose. The dashed line represents the growth (At0o)of Saccharomyces cerevisiaetransformed with plasmid paADH2 containing the eDNA encoding the cytokine murine GM-CSF. The culture was grown as described in the text. The arrow indicates the point at which glucosewas no longer detectable in the culture medium (Diastix glucosetest strips, Miles Laboratories,Elkhart, IN). The solid line shows the amount of secreted murine GM-CSF in the culture medium as determined by radioimmunoassay.
316
EXPRESSION IN YEAST
[25]
normally provided by a single-copy chromosomal gene). When ADR 1 is overexpressed, the chromosomal ADH2 locus is constitutively expressed and derepression to a much higher level occurs. 7,17 The overproduction of ADR 1 and its effect on transcription from the ADH2 promoter carried on a plasmid were therefore of interest. The expression of ADRI from its own promoter is relatively weak, based on analyses of ADRI mRNA and fl-galactosidase activity of an ADRl-fl-galactosidase fusion protein. 17 One means of increasing ADR 1 levels in yeast would be to express the gene from a very strong promoter. However, overexpression of ADR 1 on glucose-containing medium allows the ADH2 promoter to partially escape glucose repression. Hence, we sought a regulated promoter in order to maintain a low level of ADR 1 during glucose repression. It was thought that the ADH2 promoter itself could achieve this and, additionally, place the overexpression of ADR1 under glucose control. Placing the expression of ADR1 under control of the ADH2 promoter also might create a form of runaway "autoregulation" of ADR1 synthesis: the more ADR1 protein made, the more positive activation of the promoter, thus more ADRI made, etc. In order to initiate the cycle, the chromosomal copy of ADR1 is retained under the control of its own promoter, which allows a level of ADR1 to be present on glucose that can be posttranslationally modified to initiate the cycle. An integrating plasmid was constructed using the yeast integrating vector YIp512 and inserting the 1.2-kb ADH2 promoter fragment (from the BamHI site to the HindIII site from plasmid pADH2-2) followed by the ADR1 gene and the transcription termination sequences derived from the a-factor gene. Figure 2B illustrates two vectors that were made. pBC36 contains a 3.3-kb DNA fragment of the ADR1 gene from the Ncfl site, which includes 120 bp 5' to the initiation ATG codon, and DNA encoding the N-terminal 1068 amino acids (out of 1323 total amino acids) to the BamHI site. This portion of the ADR l protein is functional in activating the ADH2 promoter. 17 A second vector, pBC72, is identical to pBC36 except it includes the entire ADR1 coding region on a 6-kb NctI fragment. Plasmid pBC36 was integrated into the yeast chromosome at the ADR1 locus by first linearizing the plasmid with BglII, which cleaves at nucleotide- 1922 in the ADR1 gene (relative to the ATG). Transformation of yeast strain XV617 (MATa, ste5, his6, leu2, trpl, ura3) was done, selecting for Ura + transformants. Total DNA from four transformants was isolated and subjected to Southern blot analysis, which confirmed the integration of pBC36 at the ADR1 locus in all four cases (data not shown). This yeast strain was designated XV36. pBC72, on the other hand, was integrated ,7 H. Blumberg, T. Hartshorne, and E. T. Young, 34ol. Cell. Biol. 8, 1868 (1988).
[25]
EXPRESSION USINGADH2 PROMOTER
317
876 bp upstream of the ADH2 coding region by targeting to the MstII site. Again, four Ura + transformants were subjected to Southern blot analysis and the site of integration at the ADH2 locus was verified. This strain was designated XV72. The glucose regulation of ADRI mRNA synthesis was demonstrated for strain XV36 by SI and Northern blot analysis (data not shown). The A D R I mRNA derived from the gene fusion was undetectable during repressed growth, and was derepressed to a very high level when glucose was absent, consistent with the ADR1 gene being under the control of the ADH2 promoter. Comparison of the ADRI mRNA levels in the parent strain, XV617, and in strain XV36 also showed that ADR1 mRNA is greatly overproduced in strain XV36. To assess the effects of excess ADR1 protein on expression from the ADH2 promoter, the endogenous ADHII levels in strains XV617, XV36, and XV72 were compared. Strains XV36 and XV72 showed a 4-fold and a 5.5-fold increase in ADHII levels, respectively, over the parent strain, XV617 (not shown). The effect of excess ADR1 on heterologous gene expression from the ADH2 promoter was determined in a strain containing an integrated copy of the ADH2 promoter fused to the lacZ gene. Plasmid pADH2-lacZ (Fig. 4) is a YIp5-derived integrating plasmid containing the ADH2 promoter and DNA sequences corresponding to the N-terminal 23 amino acids of ADH2 (to the EcoRV site) fused to the lacZ gene from plasmid pMCI871.18 This plasmid was integrated at the ADH2 locus in strain XV36, which overexpresses ADRI mRNA, and in strain XV617 to serve as a control. Comparison of the regulated expression of fl-galactosidase in the two strains showed a 4- to 10-fold increase in fl-galactosidase levels in strain XV36 on derepression (Fig. 4). Under repressed conditions (growth on glucose), fl-galactosidase activity was very low, and similar to the activity of the parent strain, XV617, containing the A D H 2 - lacZ gene fusion. These results indicate that an excess of ADR 1 protein can enhance expression of foreign proteins from the ADH2 promoter and that the excess of positive activator can be regulated by glucose repression of the ADH2 promoter. The level of activity obtained from a single copy of the ADH2 promoter and excess ADRI provided by the same promoter is similar to the level of activation provided by a single-copy of the normal ADR1 gene and the ADH2 promoter on a high-copy plasmid. The advantages of the former system are 2-fold: All genes are stably integrated into a chromosome and the ADH2 promoter remains tightly repressed.
18 M. Casadaban, A. Martinez-Arias, S. Shapira, and J. Chou, this series, Vol. 100, p. 293.
318
[25]
EXPRESSION IN YEAST
900
~"
8oo
7OO
_>" 6oo .>_
"G 500 "-6 400 (D c~ 300
/
200
../
.o---~~ o
100 .
0
2
4
6
.
8
.
.
10
,
20
Hours FIG. 4. Regulated overproduction of ADR 1 stimulates ADH2-promoted expression of an ADH2-fl-galactosidase fusion protein. Strains XVtl7 and XV36 contain an ADH2-1acZ gene fusion integrated at the ADH2 locus. Strain XV36 contains an ADHR1 plasmid integrated at the ADR1 locus. Strains were grown in YPD and derepressedby shiftingto complete medium containing ethanol (2%)and glycerol(3%)as carbon sources. Sampleswere taken for fl-galactosidase (flGal)assays at the times indicated, p-Galactosidase activity is shown as the change in A420per minute per unit absorbance at A ~ multiplied by 1000. It was hoped that the A D R 1 runaway system would lead to even higher levels o f expression from a high-copy-number plasmid containing the A D H 2 p r o m o t e r driving a heterologous gene. We tested this idea using the .4DH2 gene itself on a high-copy plasmid. The A D H 2 activities in strain XV36 or XV72 containing Y E p A D H 2 were no higher than the activity in strain XV617 with the plasmid (30,000 U / m g after depression). This level is so high already that other factors may become limiting when both A D R 1 and the A D H 2 p r o m o t e r are present in large quantifies. Moreover, high levels o f A D R 1 seem to lead to toxicity during derepression, which m a y limit the ultimate level o f expression. Acknowledgments This work was supported by Immunex Corporation, Merck, Sharpe and Dohme Research Laboratories, and The National Institutes of Health.
