PROTEIN

EXPRESSION

AND PURIFICATION

3, 256-262

(19%)

Expression of Human NAD-Dependent Methylenetetrahydrofolate DehydrogenaseMethenyltetrahydrofolate Cyclohydrolase in Escherichia co/i= Purification and Partial Characterization’ Xiao-Ming Department

Received

Yang and Robert

of Biochemistry,

January

13, 1992,

McGill

and in revised

E. MacKenzie2 University,

form

April

3655 Drummond

Quebec, Canada

H3G 1 Y6

17, 1992

NAD-dependent methylenetetrahydrofolate dehydrogenase-methenyltetrahydrofolate cyclohydrolase is a bifunctional enzyme synthesized as a 37-kDa precursor that is imported into the mitochondria of embryonic and transformed mammalian cells. The cDNA encoding the human bifunctional enzyme was modified to remove nucleotides corresponding to the mitochondrial targeting sequence and was subcloned into a procaryotic expression vector under the control of the T7 RNA polymerase promoter. The soluble dehydrogenase-cyclohydrolase was expressed in Escherichia coli at levels up to 150-fold higher than those found in transformed mammalian cells. Forms of the recombinant enzyme with one, three, or seven additional amino-terminal residues were purified to homogeneity and shown to have similar kinetic properties. Investigation of the absolute requirement of the enzyme for M8+ using fluorescence quenching indicates that this ion binds in the absence of substrates. 0 1992 Academic Press, Inc.

Methylenetetrahydrofolate dehydrogenases are known to exist as monofunctional, bifunctional, or trifunctional enzymes (1). In mammals and yeast, the NADPdependent methylenetetrahydrofolate dehydrogenase is associated with methenyltetrahydrofolate cyclohydrolase and formyltetrahydrofolate synthetase in a single lOO-kDa polypeptide that forms a homodimeric enzyme (l-6). This trifunctional enzyme accounts for the majority of the dehydrogenase activity in mammalian cells. However, an M$+- and NAD-dependent methy’ Supported by a grant to R.E.M. from the Medical Research cil of Canada. X-M.Y. is a recipient of a Canadian International opment Agency Scholarship. ’ To whom correspondence should be addressed. 256

Street, Montreal,

CounDevel-

lenetetrahydrofolate dehydrogenase activity, originally reported in extracts of Ehrlich ascites tumor cells (7), was later demonstrated to be present in transformed mammalian cells, as well as in embryonic, but not differentiated, tissues (8). The NAD-dependent enzyme is located in the mitochondria of transformed cells, while the NADP-dependent enzyme could be detected only in the cytosol of the same cells (9). When purified 6000-fold to homogeneity from Ehrlich ascites tumor cells, the NAD-dependent murine enzyme was found to be a bifunctional dehydrogenase-cyclohydrolase of 34 kDa, similar in size and function to the amino-terminal domain of the NADP-dependent trifunctional enzyme (10). The bifunctional domains of these two enzymes have distinctly different properties: for example, the dehydrogenase and cyclohydrolase activities are kinetically independent in the NAD- but not in the NADP-dependent enzyme (11). Purification of the bifunctional enzyme requires transformed cells as a source, and because it is expressed at rather low levels in these cells, it has been difficult to obtain sufficient quantities for study. The human enzyme has not been purified because of the lack of a good source. To overcome this limitation we expressed the cDNA (12) encoding the human protein in Escherichia coli and describe the first purification to homogeneity and some basic properties of the enzyme from this source. MATERIALS

AND

METHODS

Restriction endonucleases, T4 DNA ligase, the large fragment of Escherichia coli DNA polymerase I, and mung bean nuclease were obtained from Pharmacia LKB Biotechnology, Inc. All reagents and enzymes for DNA sequencing were from United States Biochemical Corp. The oligonucleotides used were synthesized by 104%5928/92 55.00 Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

HUMAN

BIFUNCTIONAL

DEHYDROGENASE-CYCLOHYDROLASE

the Regional DNA Synthesis Laboratory, University of Calgary, or the Sheldon Centre for Biotechnology of McGill University. Matrex Gel Blue A and Matrex Gel Orange A were from Amicon and heparin-Sepharose CLGB was a product of Pharmacia. NAD, folic acid, and benzamidine were from Sigma Chemical Co. Acrylamide was ultrapure grade from Bio-Rad Laboratories, and common chemicals were the highest grade commercially available. Bacterial

Strains and Plasmids

The plasmids pBluescript SK+ and pBluescript KS and E. coli XLl-Blue, used for transformation and selection of expression constructs, were obtained from Stratagene Cloning Systems. The K38 strain of E. coli, which contains the pGPl-2 vector, was a generous gift from Dr. Charles C. Richardson (13). cDNA constructs were introduced into E. coli RZ 1032 (dut-, ung-) to produce double-stranded, uracil-containing DNA templates for oligonucleotide-directed mutagenesis (14). Plasmid Constructs Unless specified, all recombinant DNA laboratory techniques were performed according to Sambrook et al. (15). Constructs were verified first by restriction analysis and then by DNA sequencing using the dideoxy chain termination method (16). pBluescript plasmids were converted to expression vectors by the insertion of a ribosome binding site (RBS) downstream of the T7 promoter (Fig. 1). Vector pBSKR was obtained by replacing the HindIII-EcoRI fragment of pBluescript SK+ with a synthetic double-stranded DNA segment produced by annealing two complementary oligonucleotides, B-AGCTTAGGAGGAAAAAACCATGG-3’ and 5’-AATTCCATGGTTTTTTCCTCCTA-3’. To generate pBKSR, pBluescript KS was restricted with NotI, and the ends were filled by E. coli DNA polymerase large fragment and ligated with the similarly blunt-ended, double-stranded synthetic fragment. Both vectors thus allow direct expression of cDNA inserts under control of the T7 RNA polymerase promoter, which is located at different distances from the RBS sequence. pBSKR and pBKSR were restricted with NcoI, filled in with Klenow fragment, and then digested with XbaI. A fragment of cDNA from the clone 30EB34 (12) was obtained by restricting with CspI and blunt ending with mung bean nuclease and, after digestion with XbaI, was ligated with the cleaved vectors to yield PBS-HB3 and pBK-HB3 as outlined in Fig. 1. The insert in these constructs contains, following the initiator methionine provided by the vector, the codons for the last two amino acids (Arg-Asn) of the signal sequence, the entire sequence of the mature enzyme beginning with Glu, and a large 3’-untranslated region. To generate a protein that does not have these extra amino acids, an XhoI site was

257

incorporated by oligonucleotide-directed mutagenesis into the 30EB34 cDNA, just 5’ of the amino-terminal Glu residue of the mature sequence to yield LHD-R. XhoI digestion, filling in with Klenow, and subsequent digestion with EcoRI allowed similar construction of PBS-HBl and pBK-HBl. Deletion of most of the 3’untranslated region of PBS-HB3 and pBK-HBl was achieved by removal of a 0.8kb Hind111 fragment and religation to yield PBS-HB3m and pBK-HBlm, respectively. With the intention of producing an accurate mature protein with an amino-terminal Glu residue, a cleavage site for factor Xa (Ile-Glu-Gly-Arg) was introduced into PBS-HB3 between the codons for Asn and Glu by oligonucleotide-directed mutagenesis to yield PBS-HB7. DNA sequencing of all constructs was performed by the dideoxy chain termination method (16) using double-stranded DNA. Expression

of the Constructs

Transformed E. coli K38 cells were incubated at 30°C in 300 ml TB (15) containing 100 pg/ml ampicillin and 50 pg/ml kanamycin in a 2-liter flask in a New Brunswick Scientific Co. Series 25 incubator shaker operating at 200 rpm. At OD,, = 1.2 to 1.4, hot TB (approximately 200 ml at 70°C) was added to quickly raise the temperature to 42°C which was maintained a further 10 min. Rifampicin was added to a final concentration of 15 pg/ ml. The flasks were incubated at 37°C for an additional 3 h. After cooling on ice for 10 min the cells were harvested by centrifugation at 10,OOOg for 10 min and the pellets were stored at -80°C. Frozen cell pellets were thawed on ice and lysed in 3 vol of sonication buffer (0.1 M potassium phosphate, pH 7.3,30 mM 2-mercaptoethanol, 1 mM benzamidine, and 1 mM phenylmethylsulfonyl fluoride). Sonication was applied in 3~ 20-s intervals separated by 20 s cooling in ice using a Blackstone Ultrasonic Model SS2 sonicator. After centrifugation for 15 min at 25,OOOg, the pellets were resuspended in an additional 3 vol of sonication buffer, sonicated, and centrifuged as before. Pooled supernatant solutions were made 20% in glycerol and assayed for methylenetetrahydrofolate dehydrogenase activity as described previously (10). A unit of dehydrogenase activity is defined as the amount of enzyme required to produce 1 pmol of methenyltetrahydrofolate in 1 min at 30°C. Proteins were precipitated by the method of Bensadoun and Weinstein (17) and protein concentration was determined by the method of Lowry et al. (18). The dehydrogenase activity, expressed as specific activity of total soluble protein, was used to indicate the efficiency of expression of the various constructs. Enzyme Purification The procedure used was a simplified method based on that of Mejia et al. (10) and employed two buffers: buffer

258

YANG

AND

A, which was 20 mM triethanolamine-HCl, pH 7.3, 5 mM potassium phosphate, pH 7.3, 35 mM 2-mercaptoethanol, 1 mM benzamidine, 1 mM PMSF, and 20% glycerol, and buffer B, which was identical except that it contained 30% glycerol. Frozen cells, 15 g wet weight, were thawed on ice, disrupted as described above, and centrifuged at 20,OOOg for 20 min. To the pooled soluble extracts (90 ml) was added 0.1 vol(9 ml) of protamine sulfate (10 mg/ml, pH 7.3), and the suspension was stirred and then centrifuged at 20,OOOg for 20 min. The supernatant solution was applied to a 4 X 6-cm column of Matrex Gel Blue A pre-equilibrated with buffer A. The column was washed (60 ml/h) with approximately 3 column volumes each of buffer A, buffer A + 0.1 M KCl, buffer A + 0.6 M KCl, and the activity was eluted with buffer A containing 1.0 M KCI. Pooled fractions were dialyzed overnight against 4 liters of buffer B with one change. The dialyzed sample (240 ml) was applied to a 4 X 4-cm column of Matrex Gel Orange A, washed at 40 ml/h with 3 column volumes each of buffer A, buffer A + 0.1 M KCl, and eluted with the same volume of buffer containing 0.3 M KCl. After dialysis against 4 liters of buffer B, the sample was applied to a 1.5 X 8-cm column of heparin-Sepharose CLGB pre-equilibrated with buffer B. The column was washed with 100 ml of buffer B and eluted with 150 ml of buffer B containing 0.25 M KCl. Pooled fractions were dialyzed against 2 liters of buffer B overnight. The purified enzyme was stored at -20°C. Purity of the preparations was assessed by SDS-PAGE (19) using 9% gels.

MACKENZIE BLUESCRIPT

W

BLUESCRIPT

GwvvuuAC~~ AGCT~~~c~~~~~~~~~~~c*~~

KS+

(E)

Amd

AmfLYJJ t67

AmfllJ ffi-GAAAAAACCATGGAAGCA MEA

AFGAAAAAACCATGCGAAATGAAGCA MRNE A

Characterization Kinetic constants for each variant of the enzyme were determined as previously described for the mouse protein (10). Values of K,,, were obtained by fitting data to the Michaelis-Menten equation using the program Enzfitter (R. J. Leatherbarrow, Biosoft, Cambridge, UK) and are reported as the average t SD of three to seven separate experiments, assayed in triplicate. Fluorescence spectra were obtained with a SPEX 1681 fluorescence spectrophotometer fitted with 1.25mm slits. Excitation was at 297 nm and emission scanned from 330 to 400 nm. Duplicate scans were averaged, and the background was subtracted. Samples were prepared in 20 mM triethanolamine-HCl, pH 7.3,5 mM potassium phosphate, pH 7.3, 35 mM 2-mercaptoethanol, and 30% glycerol. Quencher concentrations were adjusted by addition of aliquots of 4 M KI or acrylamide solution to the sample in the cuvette. Corrections for dilution were made with the addition of buffer or 4 M KC1 solution in control experiments. Effects of M$+ on intrinsic tryptophan fluorescence were titrated by addition of aliquots of 0.01 M MgCl to the sample and rescanning the spectrum. Again, corrections for dilution were made in control scans using aliquots of buffer.

SK+

M

R

N

I

E

G

R

52

FIG. 1. Construction of expression plasmids. The synthetic DNA fragment used to insert the ribosome binding site (RBS) and the oligonucleotide used to insert the factor Xa cleavage site are shown; the RBS is overbared and the initiator ATG is overbared in hold. The bacteriophage T7 RNA polymerase promoter is indicated by w and the inserted RBS by l . The position of the ATG codon, numbered from the transcriptional start point, is indicated in each construct. Abbreviations for restriction endonuclease sites are as follows: E, EcoRI; H, HindHI; N, NcoI; P, Pstl; X, XhoI; Xb, XbaI.

RESULTS

Expression The bifunctional enzyme is synthesized in vivo with a targeting sequence that is removed on import into mitochondria, resulting in a mature protein with an aminoterminal glutamate residue. The presence of this sequence had to be considered in the design of constructs to express mature enzyme. An expression system designed to take advantage of the T7 RNA polymerase promoter of the Bluescript SK+ and KS’ vectors was constructed by the insertion of a ribosome binding site to produce pBSKR and pBKSR (Fig. 1). The coding

HUMAN TABLE Expression

in

Escherichia coli Dehydrogenase specific activity (units/mg)

Enzyme

0.001 0.001

pBSKR pBKSR PBS-HBl PBS-HB3 PBS-HB3m pBSHB7

HBl HB3 HB3 HB7

0.10 1.10 1.00 0.60

pBK-HBl pBK-HBlm pBK-HB3 pBK-HB3m

HBl HBl HB3 HB3

0.50 0.47 0.70 0.60

sequence was subcloned into pBSKR in two ways, to yield PBS-HB3, in which three extra codons encoding Met-Arg-Asn precede the amino-terminal glutamate, and PBS-HBl where the only additional amino acid is the required initiator methionine residue. In E. coli K38, both constructs expressed soluble enzyme but, under all conditions used, PBS-HB3 expressed lo-fold higher levels of methylenetetrahydrofolate dehydrogenase. This difference was much less apparent when the proteins were expressed from pBK-HBl and pBK-HB3, where the constructs were derived from pBKSR. The construct PBS-HB7 was designed to express a protein susceptible to cleavage by factor Xa to obtain an accurate mature enzyme with no additional amino-terminal residues. The expression of the constructs is summarized in Table 1. Purification

and Properties of the Recombinant

Enzymes

The constructs PBS-HB3, PBS-HB7, and pBK-HBl were selected to express the three variants of the enzyme for purification. A summary of a typical purification protocol is presented in Table 2, and SDS-PAGE analysis of the various fractions is shown in Fig. 2. The TABLE Purification

Fraction Supernatant Protamine SO, Matrex Blue A Matrex Orange A Heparin Sepharose Note.

Purification

of Methylenetetrahydrofolate

Volume (ml) 540 540 80 100 90 of HBl

from

45 g of Escherichia

259

DEHYDROGENASE-CYCLOHYDROLASE

1

of Constructs

Construct

BIFUNCTIONAL

Total

overall yields of activity from purification of HBl, HB3, and HB7 were 40, 50, and 28%, respectively, with specific activities of 43-45 unitslmg of protein. All the proteins had methenyltetrahydrofolate cyclohydrolase activity (data not shown). The three proteins were subjected to SDS-PAGE and immunoblotting, and, as shown in Fig. 3, have apparent molecular weights in agreement with the values calculated from the predicted amino acid sequences (34.9, 34.5, and 34.2 kDa). The purified recombinant enzymes were subjected to five cycles of amino-terminal sequencing analysis and the residues identified were identical to those predicted from the DNA sequence determined from the expression constructs (Fig. 3). Unfortunately the engineered factor Xa site in HB7 was not susceptible to cleavage, which denied us access to a “true” mature enzyme. The different amino-terminal sequences had little if any detectable effect on the properties of the enzyme; a summary of kinetic properties is shown in Table 3. Although there were no differences in kinetic properties, we checked the effect of the additional residues on the stability of the enzyme. In the presence of 0.3 mg/ml BSA, the three proteins (0.05 mg/ml) remained 80% active after 48 h at 14°C (data not shown). At 37°C they also showed the same decrease in activity during a 6-h incubation (Fig. 4A). However, HB7, which has seven extra amino acid residues at its amino terminus, has reduced stability in low concentrations of urea compared with HBl and HB3 as shown in Fig. 4B. The addition of magnesium ion had no effect on the stabilities observed in these experiments. The requirement of a dehydrogenase for M$+ is unusual, and we attempted to obtain evidence that would demonstrate binding of this ion in the absence of substrates using intrinsic fluorescence of the enzyme. HBl has four tyrosine and three tryptophan residues, and excitation at 280 nm elicits a fluorescence maximum at 320 nm. When excitation is at 297 nm, the emission spectrum has a maximum at 337 nm (data not shown). The presence of 1 mM Mg2+ had no effect on the fluorescence emission spectra. However, the effect of Mg2+ on 2 Dehydrogenase-Cyclohydrolase Dehydrogenase activity (units)

protein (md 545 545 17 3.6 2.4

cob K38

(HBl)

Specific activity (units/mg)

258 257 250 109 103 transformed

with

the construct

0.47 0.47 16.0 30.0 44.0 pBK-HBl

is shown.

Yield (%) 100 100 97 40 38

260

YANG I

234

AND

MACKENZIE TABLE

56

Effect

of’ Amino-Terminal Properties of the Methylenetetrahydrofolate

Y Residues on the NAD-Dependent Dehydrogenase &I

CH,H,

Enzyme

67

HB7 HB3 HBl

FIG. 2. SDS-PAGE analysis of fractions from various steps in the purification of HBl. Lane 1, crude extract, 50 pg; lane 2, protamine sulfate, 50 pg; lane 3, Matrex Gel Blue A, 40 pg; lane 4, Matrex Gel Orange A, 20 pg; lane 5, heparin-Sepharose, 5 @g; lane 6, low-molecular-weight standards (Pharmacia).

fluorescence could be demonstrated by using emission quenching techniques. Stern-Volmer plots of quenching of the enzyme fluorescence by KI and acrylamide are shown in Fig. 5. The quenching of tryptophan fluorescence induced by KI (Fig. 5A) indicates that at least one residue is available to solvent. Higher quenching is observed in the presence of Mg2+, which indicates that the protein has undergone a conformational change. Replacement of Mg2+ by Zn2+, which does not support enzyme activity, did not enhance quenching. Similar results were obtained with HB3 (data not shown). Quenching of intrinsic tryptophan fluorescence by acrylamide was more extensive, and no significant effect of M$+ was observed. The effect of Mg2+ was titrated in

folate

(PM) NAD

4.0 k 1.2 3.2 IL 1.3 4.6 zk 2.1

9Ok

17

187 1 40 182 k 59 169 f 26

the presence of 0.35 M KI, with excitation at 297 nm and emission at 336 nm, and gave half-maximal values of 360 and 250 PM Mg2+ in the absence and presence of NAD, respectively (Fig. 6). DISCUSSION

Use of the T7 RNA polymerase promotor for the expression of heterologous genes in Escherichia coli is well established (13,20,21). The vectors pBSKR and pBKSR described here utilize the high efficiency and specificity of the T7 promoter but also have the advantage that these Bluescript derivative vectors allow them to be rescued from F’-bearing bacteria as ssDNA and can be employed for site-directed mutagenesis with a saving of time and effort. In addition, the restriction endonuclease NcoI site, which is frequently present in eukaryotic translational start codons (22), provides an easy means to subclone a eukaryotic cDNA in frame into pBKSR or pBSKR either directly or indirectly. Significant differences in the level of expression from the two vectors

B

B

---t -t-

1234

HB3 HBl

Mg2+

83 i 20 63 k 20

A A

Kinetic

HE1

Ha3 HB7

M-R-N-U M-U

= 43

0

FIG. 3. Amino-terminal sequence analysis and purity of three forms of the human bifunctional dehydrogenase-cyclohydrolase. (A) Sequences of the purified proteins; the underlined residues represent the first two amino acids of the mature enzyme. (B) SDS-PAGE analysis of the enzymes. Lane 1, HB7 (2.5 pg); lane 2, HB3 (2.5 rg); lane 3, HBl (6 ,ug); lane 4, low-molecular-weight standards (Pharmacia).

2

4 TIME

6 (hr)

8

0

1

2 UREA (M)

3

4

FIG. 4. Effects of additional amino-terminal residues on the stability of the dehydrogenase activity. (A) Thermostability of the enzymes at 37°C in the presence of 200 pg/ml BSA. (B) Activity of the enzymes after incubation in increasing concentrations of urea at room temperature for 150 min.

HUMAN

BIFUNCTIONAL

k e

0.0

0.1

0.2

0.3

KI W

0.4

0.5

0.0

0.1 0.2 Acrylrmidr

261

DEHYDROGENASE-CYCLOHYDROLASE

0.3

0.4 (M)

0.5

FIG. 5. Fluorescence quenching of HBl by (A) KI and (B) acrylamide. F” and Fcorrespond to the fluorescence intensities in the absence and presence of quencher, respectively. Excitation was at 297 nm and emission was scanned from 330 to 400 nm.

were unexpected. Most of the constructs express enzyme at levels between 0.5 and 1 unit per milligram of soluble protein, except for PBS-HBl, which is 5- to lofold lower. The sequence from the transcriptional start point to the initiator ATG is identical in both PBS-HBl and PBS-HB3 and cannot account for the observed differences. Moreover, pBK-HBl and pBK-HB3, which share a different 5’ untranslated sequence, show similar levels of expression, which demonstrates that the two additional codons in the HB3 constructs do not affect expression. The reasons for the low expression of PBSHBl are not clear and might involve a difference in secondary structure of the mRNA that reduces its efficiency of translation. We achieved high levels of expression of the recombinant human enzyme NAD-dependent methylenetetrahydrofolate dehydrogenase-methenyltetrahydrofolate cyclohydrolase in E. coli. The specific activity of 1.0 pm01 min-’ mg-l .is lOO- to 150-fold higher than that observed in extracts of transformed mammalian cell lines (8). This level of expression allowed the purification to near homogeneity of the human enzyme for the first time, although in a form that contains at least one additional N-terminal residue. The purified enzymes with one, three, or seven extra residues have similar physical and kinetic properties. The vector PBS-HB7 successfully expressed a protein with seven extra amino-terminal residues that was resistant to cleavage with factor Xa under a variety of conditions. The inability to produce a true mature enzyme required that we assess the effects of amino-terminal additions to the enzyme to decide if our products represent accurately the properties of the mature enzyme. Additional amino acid residues at the N terminus do not affect the folding, dimerization, or activity of rabbit uteroglobin (23). The similarity of kinetic proper-

ties and thermal stabilities of all three enzymes suggests that the presence of extra residues is not particularly significant for the dehydrogenase-cyclohydrolase. Only in the case of denaturation in urea were any differences in stability detected, and then only with the enzyme containing seven extra residues. These results suggest that HBl and HB3 are suitable products to use to characterize the human enzyme. Previous studies with the mouse bifunctional enzyme suggested that MS+ binds to the enzyme and is required for NAD binding (11). Attempts to show an effect of Mg2+ on fluorescence emission spectra were unsuccessful, suggesting any changes were small or did not affect the environment of the tryptophan residues. Acrylamide is a very potent quencher of tryptophan fluorescence of the dehydrogenase-cyclohydrolase, but its effects were unaffected by Mg2+. However, the fluorescence emission maximum of 337 nm suggests that at least one of the three tryptophan residues is exposed to a polar environment (24). Fluorescence quenching studies with KI indicate that Mg2+ does indeed cause a conformational change in the enzyme in the absence of other substrates with a Kd of 360 PM. The conditions of high KI concentrations make the comparison of values of Kd difficult. Under assay conditions the value of 180 PM is somewhat lower than 250 PM found by fluorescence quenching also in the presence of NAD. Enzyme activity was not detectable in the presence of 0.35 M KI and precluded comparison under identical conditions. Qualitatively the results support the proposal based on kinetic evidence that Mg2+ binds to free enzyme, but additional approaches are required to confirm and explain its role.

0 -NAD

A +NAD 6.0

0.2

0,4 MgCl

0.5

0.0

(mm)

FIG. 6. The effect of Mga+ on the quenching of enzyme fluorescence by KI. Excitation was at 297 nm and emission at 336 nm. Successive aliquots of 10 mM MgCl in buffer B were added to the fluorescence cuvette containing 20 wglml HB3 in buffer B containing 0.4 M KI. Corrections for dilution were obtained in a parallel control experiment using identical aliquots of buffer B. The value F’ = [F’IIQ, F “IF, where F” and F are fluorescence intensities in the absence and presence of KI. Hyperbolic curves were fit to the Michaelis-Menten equation with the program Enzfitter.

262

YANG

AND

The ability to express and purify significant quantities of this unusual bifunctional enzyme as well as to carry out site-directed mutagenesis will enable us to pursue this and other questions concerning the relationship of the two catalytic activities in this enzyme. ACKNOWLEDGMENTS We thank Dr. Krishna Peri for construction of pBKSR and LHDR, Dr. A. Storer of the NRC Biotechnology Research Institute, Gisele de Souza for typing this manuscript, and Kathy Teng for photography.

REFERENCES 1. MacKenzie, Biochemistry Eds.), Vol.

R. E. (1984) of Folates” 1, pp. 255-306,

in “Folates and Pterins: (Blakley, R. L., and Wiley, Philadelphia.

2. Paukert, J. L., D’Ari-Straus, L., and Rabinowitz, Biol. Chem. 251, 5104-5111. 3. Paukert, J. L., Williams, G. R., and Rabinowitz, them.

Biophys.

Res. Commun.

77,

Chemistry Benkovic,

and S. J.,

J. C. (1976)

J.

J. C. (1977)

Bio-

147-154.

L. U. L., Drury, E. J., and MacKenzie, R. E. (1977) J. Biol. Chem. 252, 1117-1122. Caperelli, C. A., Chettur, G., Lin, L. Y., and Benkovic, S. J. (1978) Biochem. Biophys. Rex Commun. 82, 403-410. Schirch, L. (1978) Arch. Biochem. Biophys. 189, 283-290.

6. 7. Scrimgeour, Biophys.

8. Mejia, 9.

K. G., and Huennekens, Res. Commun. 2, 230-233.

N. R., and MacKenzie, 14,616-14,620. Mejia, N. R., and MacKenzie, Commun. 155, l-6.

F. M.

R. E. (1985)

10. Mejia, N. R., Rios-Orlandi, Biol. Chem. 261,9509-9513. 11. Rios-Orlandi,

(1960)

J. Biol. Biochem.

MacKenzie,

E. M., and MacKenzie,

R. E. (1986)

R. E. (1988)

J. Biol.

J.

Chem.

263,4662-4667. 12. Peri, K. G., Belanger, C., and AcidsRes. 17,8853-8853. 13. Tabor, S., and Richardson, USA 82, 1074-1078.

MacKenzie,

R. E. (1989)

C. C. (1985)

Proc.

N&l.

Nucleic Acad.

Sci.

14. Kunkel, T. A., Roberts, J. D., and Zakour, R. A. (1987) in “Methods in Enzymology” (Wu, R., and Grossman, L., Eds.), Vol. 154, pp. 367-382, Academic Press, San Diego, CA. 15. Sambrook, Cloning: Laboratory

J., Fritsch, E. F., and Maniatis, T. (1989) “Molecular A Laboratory Manual,” 2nd ed., Cold Spring Harbor Press, Cold Spring Harbor, NY.

16. Sanger, F., Nicklen, S., and Acad. Sci. USA 74,5463&5467. 17. Bensadoun, A., and Weinstein,

Biochem. Chem.

260,

18. Lowry, (1951)J.

Coulson,

A. R.

D. (1976)

Anal.

(1977)

Proc.

Biochem.

Natl.

70,241-

Biophys.

Res.

0. H., Rosebrough, N. J., Farr, Biol. Chem. 193,265-275.

R. J.

Laemmli, Studier, 130.

21.

Balbas, P., and Bolivar, F., (1990) in “Methods in Enzymology” (Goeddel, D. V., Ed.), Vol. 185, pp. 14-37, San Diego, CA.

22.

Kozak,

24.

F. W.,

M. (1984)

Nature

Randall,

20.

23. Miele,

U. K. (1970)

A. L., and

19.

Chem. R. E. (1988)

E., and

250.

4. Tan, 5.

MACKENZIE

and Moffatt,

Nucleic

L., Cordella-Miele, 265, 6427-6435.

Lakowicz, J. R. (1983) copy,” Chap. 11, Plenum,

227,680-685. B. A. (1986)

Acids

Res.

Biol.

189, 113-

12, 857-872.

E., and Mukherjee, “Principles New York.

J. Mol.

of

A. B. (1990) Fluorescence

J. Biol. Spectros-