MOLECULAR REPRODUCTION AND DEVELOPMENT 32:324-330 (1992)

Expression of Interleukin-6 in Porcine, Ovine, and Bovine Preimplantation Conceptuses NAGAPPAN MATHIALAGAN, JAMES A. BIXBY, AND R. MICHAEL ROBERTS Departments of Animal Sciences and Biochemistry, University of Missouri, Columbia, Missouri

trypsin, and C1 inhibitor (Koj et al., 1984; Akiro et al., 1990b; Zuraw and Lotz, 1990). Cytokines and growth factors produced by preimplantation conceptuses are now considered to play potentially important roles in the adjustment of maternal endocrinological and immunological responses necessary for a successful pregnancy (Hodgen and Itskovitz, 1988; Loke and King, 1990; Rappolee et al., 1989; Roberts et al., 1990). For example, the ovine and bovine trophoblast proteins (oTP and bTP) produced by preimplantation conceptuses, are type I IFN, that appear to be necessary in order to prolong the lifespan of the corpus luteum during early pregnancy (Roberts, 1991). Porcine conceptuses have been shown to express IFN-y (Lefevre et al., 1990) as well as a n IFN resembling IFN-a (Cross and Roberts, 1989) prior to their firm attachment to the uterine wall. IL-6 is produced by human trophoblast (Kameda et al., 1990; Nishino et al., 1990) and also by cultured mouse blastocysts (Murray et al., 1990).Together these observations suggest a role for various cytokines, including IL-6, during pregnancy. We conducted the present study to determine whether preimplantation conceptuses of farm animals Key Words: Embryo, Implantation, Interferon, Interleuproduce IL-6 mRNA for the following reasons. First, kin-6, Pig, Reverse transcription-polymerase chain reacsheep, cattle, and pig blastocysts undergo rapid elongation, Trophoblast tion from spheres to longer filamentous forms between days 12-20 of gestation (day 0 = day of estrus). It is only during this morphological transformation that the conceptuses begin to attach to the uterine endometrial surface. Because these early stages of trophoblast atINTRODUCTION tachment cause what appears to be a local inflammaInterleukin-6 (IL-6) is a cytokine with multiple bio- tory process (Weitlauf, 1988), we reasoned that the conlogical activities (Akiro et al., 1990a). It is secreted by T ceptuses could be releasing inflammatory cytokines. cells to induce the maturation and production of anti- Second, the production of IFN by cells such as leukobodies by B cells (Hirano et al., 1986). However, it is cytes is usually accompanied by a simultaneous secrealso produced by macrophages, fibroblasts, and cells of tion of a range of other cytokines (De Maeyer and De epithelial and endothelial origin (Jirik et al., 1989; Maeyer-Guignard, 1988; Akiro et al., 1990a).Since conAkiro et al., 1990a; Ruef et al., 1990). Along with the ceptuses produce IFN during the elongation phase of other cytokines interleukin-1 (IL-11, interferon-a development (Roberts et al., 19901, we reasoned that (IFN-a) and tumor necrosis factor-a (TNF-a), IL-6 are IL-6 might also be secreted. In this paper we report the implicated as causatory agents in inflammatory re- cloning of porcine IL-6 and provide evidence for its exsponses. While IL-1, IFN-a and TNF-a regulate major acute phase reactions, e.g., prostaglandin production, cytocidal activity, and fever, IL-6 induces a variety of acute phase proteins in the liver (Dinarello,1987; GaulOctober 15,1991; accepted January 28,1992. die et al., 1987; Gitlin and Colten, 1987). Some of the Received Address reprint requests to Dr. N. Mathialagan, Department of AniIL-6 responsive, acute-phase genes are in the serpin mal Sciences, 158 ASRC, University of Missouri, Columbia, MO super gene family, e.g., a-1-acid glycoprotein, a,-anti- 65211.

ABSTRACT A porcine interleukin-6 (plL-6) cDNA has been cloned from pig spleen cDNA library to provide information that would allow us to study IL-6 mRNA expression during pregnancy of several domestic Artiodactyla. The cDNA is 1058 bp long and with a single open reading frame that encodes a 212 amino acid polypeptide with 28-residue signal sequence. It shares 61%and 43%amino acid sequence identity with human and mouse IL-6, respectively. PCR procedures with primers designed from regions of sequence conserved between human and pig have been used to identify IL-6 cDNA in hgtll libraries constructed from day 15-16 (sheep),day 17 (cattle),and day 13-17 (pig) conceptus mRNA. The presence of IL-6 mRNA in elongating preimplantation ovine (days 13-25), porcine (days 13-21), and bovine (days 1 6 2 0 ) conceptuses was also demonstrated by PCR after reverse transcription of total ribonucleic acid with reverse transcriptase and by solution hybridization with a plL-6 cRNA probe. These observations suggest that IL-6 is a product of these early conceptuses and may be involved in early maternal responses to the presence of an embryo within the uterus. o 1992 Wiley-Liss, Inc.

0 1992 WILEY-LISS, INC.

IL-6 mRNA EXPRESSION IN PREIMPLANTATION CONCEPTUSES pression in porcine, bovine and ovine conceptuses during the peri-implantation period.

MATERIALS AND METHODS EcoRl and HindIII-digested A DNA markers, pGEM standards, T4 DNA ligase, T4 polynucleotide kinase, and other restriction enzymes were purchased from Promega Biotech (Madison, WI). AmpliTaq DNA polymerase was obtained from Perkin-Elmer Cetus Corp (Norwalk, CT). [32Pl-a-dATP (3,000 Ci/mmol) was a product of ICN Biochemicals, Inc. (Irvine, CAI; L3,S1-adATP and [35S]-a-CTP(1,072 Ci/mmol) were obtained from New England Nuclear, Inc. (Wilmington, DE). Avian Myleoblatosis Virus (AMV) reverse transcriptase was from Saikagaku America, Inc. (Rockville, MD). An in vitro transcription kit and pBS vector were purchased from Stratagene (La Jolla, CAI.

325

ble-stranded plasmid DNA obtained from the recombinant clone was sequenced by the dideoxy chain termination method (Sanger et al., 1977).

PCR of IL-6 From Conceptus cDNA Libraries The pig conceptus cDNA library (Uni-Zap, Stratagene, La Jolla, CAI was constructed from polyadenylated RNA obtained from days 13-17 (day 0 = day of estrus) pig conceptuses and was kindly provided by Dr. G.A. Baumbach (University of Tennessee, Knoxville, TN). The construction of ovine (days 15-16) and bovine (days 17-18) conceptus cDNA libraries ( h g t l l ) was described in Imakawa et al. (1989). Diluted phage stocks of about 105-106 pfu in 2 - 4 pl of 10 mM MgC1, of cDNA libraries were used as templates in PCR by using IL-6 specific primers. PCR was performed as described in section 1.Sterile distilled water was used as a negative control. The specificity of the PCR amplification was Cloning of Pig IL-6 verified by using the pig IL-6 cDNA that had been Cloning of pig IL-6 was achieved by two approaches. inserted into a plasmid vector (positive control). PCR The first approach was by polymerase chain reaction products were subjected to electrophoresis in a 1% (w/v) (PCR) from the pig spleen cDNA library ( h g t l l , Clon- agarose gel in presence of 1 pg/ml ethidium bromide. tech Labs., Palo Alto, CA) with IL-6 specific primers. After electrophoresis, agarose gels were photographed The primers were synthesized based on the human IL-6 under ultra violet illumination. PCR products were sequence (Hirano e t al., 1986). The 5' sense oligonucle- then blotted onto nylon membranes by capillary transotide primer (5'GATGGATGCTTCCAATCTG3', from fer according to standard procedures (Sambrook et al., base position 358-376 of hIL-6) and 3' antisense oligo- 1989) and hybridized with the pig IL-6 cDNA probe nucleotide primer (5'TCCAAGAAATGATCTGGC 3', that had been labeled by random priming. Hybridizacorresponding to base position 990-1007 of hIL-6) were tion was carried out in formamide-hybridization buffer made a t the University of Missouri DNA core facility (50%( d v ) formamide, 5 x SSC where 1x SSC is 0.15 M by Dr. J. Forrester. A diluted phage stock (about lo5- NaC1, 0.015 M Na citrate, 5 x Denhardt's solution lo6 pfdreaction) in 10 mM MgC1, was used a s a tem- (Sambrook et al., 1989), 0.1 M sodium phosphate (pH plate for PCR amplification. PCR was performed (94"C, 6.5),0.1% (w/v) sodium dodecyl sulfate (SDS), and 5 pg 1 min; 45°C 1 min; 72"C, 1 min) for 40 cycles. The of herring sperm DNA) (Sambrook et al., 19891, at 42°C expected product size was 650 base pairs. The PCR for 12 h. The membranes were washed with 0.1 x SSC/ products were resolved by electrophoresis in a 1% (w/v) 0.1% SDS at 42°C for 30 min and exposed to XAR-film agarose gel (Sambrook et al., 1989) and the appropriate (Kodak) for 4-6 h to visualize radioactive bands. size bands were cut out. DNA was isolated by Gene Reverse Transcription-Polymerase Chain Clean (Bio 101, San Diego, CA) procedure, phosphoryReaction (RT-PCR)of mRNA From Conceptuses lated by means of T4 polynucleotide kinase (8 U/pl) and Filamentous conceptuses were obtained by flushing then cloned into a Smal-cut pBS vector. The plasmids were introduced into E. coli JMlOl by calcium chloride the uteri of pregnant pig, sheep and cattle at various method (Sambrook et al., 1989). Plasmid DNA isolated days of pregnancy during the elongation and attachfrom four different recombinants were sequenced in ment stage of development (Farin et al., 1991). Concepboth directions by dideoxy chain termination method tuses were processed individually except in the case of sheep where conceptuses of the same age were pooled (Sanger et al., 1977). The second approach was by screening the cDNA li- and the total RNA was extracted by standard procebrary. A pig spleen cDNA library in g t l l (Clontech dures (Chomczynski and Sacchi, 1987). RNA (5 pg) was Labs, Palo Alto, CA) was screened with a human IL-6 reverse transcribed at 42°C for 1 h by using AMV rel volume that incDNA probe (0.9 kb) (May e t al., 1986; Sehgal e t al., verse transcriptase in 20 t ~ reaction 1987) (a gift of Dr. P. Sehgal, Rockefeller University, cluded 50 mM Tris . HC1 (pH 8.31, 25 mM KCl, 3 mM NY). About 80,000 plaques were screened and 20 MgCl,, 5 mM dithiothreitol, 5 units of RNasin plaques were purified. The approximate lengths of (Promega Corp., Madison, WI), 1mM spermidine, 1mM their inserts were determined by PCR amplification each of dATP, dTTP, dCTP, dGTP, and 200 ng of oligo with oligonucleotide primers identical to the 5' and 3' dT,, primer. Reactions were stopped by addition of 80 phage sequences flanking the insert. Five of the puri- pl of 10 mM Tris . HC1 (pH 7.5) containing 1mM disofied recombinant clones had insert sizes of about 1 kb. dium EDTA. Negative controls for the reaction (no reThe largest one (clone 6) was ligated into plasmid vec- verse transcriptase) were run in parallel with a n equal tor pBS. The plasmids were introduced into Escherichia concentration of total RNA. The products of each reaccoli JM 101 by the calcium chloride method, and dou- tion (4-p1 aliquots) were used as templates for PCR

326

N. MATHIALAGAN ET AL.

with IL-6 specific primers as described under Cloning of Pig IL-6 and Southern blotted for subsequent hybridization to a 32P-labeledpIL-6 a s described under PCR of IL-6 from Conceptus cDNA Libraries.

(Asn7'). By contrast, mouse IL-6 lacks any potential site for N-glycosylation.

PCR of IL-6 From Conceptus cDNA Libraries PCR experiments with the cDNA libraries constructed from preimplantation filamentous concepRibonuclease Protection Assay of IL-6 tuses of pig, sheep, and cattle produced a n ethidium RNase protection assay was performed according to bromide-stained band of approximately 650 bp in the procedure reported by Zinn et al. (1983) with few length. That this amplified DNA did indeed correspond modifications. A single-stranded cRNA probe was pre- to IL-6 was confirmed by transferring the PCR products pared by using a n in vitro transcription kit (Strata- to nylon membrane and hybridizing with 32P-labeled gene, La Jolla, CA). Linearized PBS containing pIL-6 porcine IL-6 probe under stringent conditions (Fig. 2). cDNA was used as template. Dried RNA samples (5 pg) RT-PCR, Southern Blotting of mRNA From were dissolved in 30 p1 of hybridization buffer (60% Preimplantation Conceptuses formamide, 40 mM PIPES (pH 6.5), 400 mM NaC1, 1 mM EDTA) containing 1-2 x lo5 cpm of [35Sl-cRNA To attempt to confirm the presence of mRNA for IL-6, probe, heated at 85°C for 10 min, and incubated at 55°C Northern blotting was employed on total cellular RNA for 14-16 h. All samples were run in duplicate. Buffer extracted from conceptuses. The result was a barely (0.3 ml, 10 mM Tris . HC1, pH 7.5, 5 mM EDTA, 300 detectable hybridization signal in all three species sugmM NaC1) containing 40 pg/ml of RNase A and 2 pg/ml gesting that the mRNA was of relatively low abunof RNase T1 were added and the reactions incubated for dance (data not shown). Therefore, a more sensitive 60-90 min at 37°C. Proteinase K ( 5 pI, 10 mg/ml) and procedure was used to demonstrate conclusively the 10% (w/v) SDS (20 pl) were then added, followed by presence of IL-6. In these experiments cDNA was prefurther incubation for 15 min a t 37°C. The solution was pared by reverse transcription and subjected to PCR. then extracted with phenol, and the RNA was precipi- RNA samples from ovine (days 13-25), porcine (days tated with ethanol after the addition of carrier yeast 11-21) and bovine (days 16-20) conceptuses all gave a n tRNA (10 pg). The dried pellets were resuspended in 10 ethidium bromide stained band approximately 650 bp JL~ of 97% formamide (v/v) and 10 mM Tris . HC1 (pH in size whose identity with a n IL-6 cDNA was con7.5), and aliquots ( 5 pl) were added to 3 ml of scintilla- firmed by Southern blotting (Fig. 3 ) . tion cocktail, to determine the content of 35S by liquid The relative abundance of mRNA for IL-6 was deterscintillation counting. In each assay, additional Sam- mined by RNase protection assay in total RNA exples were included for determination of RNase-resis- tracted from conceptuses of different stages of developtant background radioactivity and nonspecific RNA ment. Again, IL-6 mRNA was detectable in all samples background counts. RNase-resistant background was (Fig. 4),but the variability of the signal was too high to determined by substituting buffer for nucleic acid Sam- reach any conclusions about the onset of progression of ple and by adding the normal amount of RNase A and expression during development. T1. The nonspecific RNA background was determined DISCUSSION by substituting 5 pg of yeast tRNA instead of sample. In this paper, we report the cloning and sequencing of a porcine IL-6 cDNA and show that IL-6 mRNA is RESULTS present in preimplantation porcine, bovine and ovine Cloning and Sequencing of Porcine IL-6 conceptuses. The sequence for the porcine spleen cDNA The nucleotide sequence and the predicted amino is almost identical to one reported recently (after our acid sequence of porcine IL-6 are shown in Figure 1. work was completed) from IL-la-stimulated porcine fiThe cloned cDNA is 1058 bp in length and contains a n broblasts (Richards and Saklatvala, 1991).The latter is open reading frame of 636 bp. It has a 360-bp 3' un- 18 bases shorter in the region corresponding to the 5'translated region similar in length to those observed in untranslated end of the mRNA and 65 bases longer in the transcripts of human and mouse IL-6. Overall, it the 3'-end. In Figure 1,for example, the poly(A) tail is shares 82% and 66% nucleotide sequence identity to initiated 17 bases after a polyadenylation signal human and mouse IL-6 cDNA, respectively. The pre- AATAAA. In the sequence reported by Richards and dicted molecular weight of the unprocessed polypeptide Saklatvala (1991), a second AATAAA motif occurs 65 is 24,041. Based on its similarities to the human and bases farther downstream from the first and appears to mouse proteins it possesses a 28-amino acid signal se- be the one responsible for polyadenylation of the quence. Porcine IL-6 shares 61% and 43% amino acid mRNA. Whether these differences have any physiologsequence identity with human and mouse IL-6, respec- ical significance or have any tissue specificity is untively. In addition, there is a conserved alignment of clear. Both mRNA would contain many AU-rich sefour cysteine residues (Cys47,53,76,86) between human, quences, including several AUUUA motifs (four in the mouse and pig IL-6. One putative N-glycosylation site spleen mRNA and six in the fibroblast mRNA) consida t Asn6' is evident in porcine IL-6. A potential glycosy- ered to be associated with mRNA stability (Caput et al., lation site close to this region is present in human IL-6 1986) and that have been noted in the transcripts for

IL-6 mRNA EXPRESSION IN PREIMPLANTATION CONCEPTUSES 62

1

AGTCTGCCCTCGAGCCCACCAGGAACGAAAGAGAGCTCCATCTGCCCTCCAGGAACCCAGCT

63 122 ATGAACTCCCTCTCCACAAGCGCCTTCAGTCCAGTCGCCTTCTCCCTGGGGCTGCTTCTG MetAsnSerLeuSerThrSerAl aPheSerProVa1 A1 aPheSerLeuG1y LeuLeuLeu

123

182

GTGATGGCTACTGCCTTCCCTACCCCGGAACGCCTGGAAGGGTGATGCC Val M e t A l aThrAl aPheProThrProG1 uArgLeuGl uG1uAspAl aLysGlyAspAl a

183 242 ACCTCAGACAAAATGCTCTTCACCTCTCCGGACAAAACTGAAGAACTCATTAAGTACATC ThrSerAspLysMetLeuPheThrSerProAspLysThrGl uG1uLeuIl e L y s T y r I l e 243 302 C TC G G C AAAATCTC TGCAATGAGAAAGGAGATGTGTGAGAAGTATGAGAAGTGTGAAAAC LeuGlyLysIl eSerAl aMetArgLysG1 uMet&GluLysTyrGluLysmGl

303

uAsn

362

AGC A A G G A G G T A C T G G C A G A A A A C A A C C T G A A C C T T C C A A G A C G G A SerLysGl uVal LeuAl aG1 uAsnAsnLeuAsnLeuProLysMetA1 aG1uLysAspGly

363

422

TGCTTCCAATCTGGGTTCAATCAGGAGACCTGCTTGATGAG~TCACCACCGGTCTTGTG WPheG1 nSerGl yPheAsnGl nG1nThrmLeuMetArgI1 eThrThrGlyLeuVa1

423

482

GAGTTTCAGATATACCTGGACTACCTCCAGAAAGAGTATGAGAGCAATAAGGGAAATGTC G1 uPheGl n I 1eTyrLeuAspTyrLeuG1 nLysGl uTyrGl uSerAsnLysGlyAsnVa1

483

542

GAGGCTGTGCAGATTAGTACCAAAGCACTGATCCAGACCCTGAGGC~AGGGAAAGAAT G1 uAl aVal G1 nIleSerThrLysAlaLeuIleGlnThrLeuArgGlnLysGlyLysAsn 543

602

CCAGACAAAGC CACCACCCCTAACCCCACCACATGCCGGCCTGCTGGATAAGCTGCAG ProAspLysAl aThrThrProAsnProThrThrAsnA1 aGlyLeuLeuAspLysLeuG1 n

*

603

662

TCACAGAACGAGTGGATGAAGAACACAAAGATCATTCTCATCCTGCGCAGCCTTGAGGAT SerGl nAsnGl uTrpMetLysAsnThrLysIleIleLeuIleLeuArgSerLeuG1 uAsp

663

122

TTCCTGCAGTTCAGCCTGAGGGCCATTCGGATAATGTAGCTGGGGCACCTGAGATTGATG PheLeuGl nPheSerLeuArgA1 a11eArg I 1eMet

123

182

CCGTCCACGGGCATTCCCTCCTCTGGTCAGAAACCTGTCCACTGGGCACATAACTTATGT

783

842

TGTTCTCTATGAAGAACTAAAAGTATGAGCGTTAGGACACTATTTTAATTATTTTAATTT

843

902

ATTGATATTTAAATATGTGATGTCGAGTTAATTTATATAAGTGATAGATATTTATATTTT

903

962

TATTAAGTGCCACTTGAAATATTTTATGTATTTGTTTTGAAAAAGTAACGTAAAATGGCT

963

1022

ACACGGCTTGAAGATCCTTGTTGTTTCAGAGCCAGGTTGTTTCTTGGAGTGTGTAGGCTT

1023

1058

ACCTC A A A T A A A T T G C T A A C T T A T A C G T W Fig. 1. cDNA sequence of porcine interleukin-6 (pIL-6). The poly adenylation signal is underlined. Conserved cysteine residues are underlined and the putative N-glycosylation site is indicated by a n asterisk (*I.

327

328

N. MATHIALAGAN ET AL.

A

c

Q,

Y

L

la

940 bp

L

830 bp

-

560 bp

/-

+650

bp

B r

b

c

d

o f

Fig. 2. PCR of IL-6 cDNAfrom conceptus cDNA libraries constructed from day 13-17 (pig), day 15 and 16 (sheep) and day 17 and 18 (cattle)conceptuses. Phage stocks ofabout 105-106 pfu were used in PCR. A Ethidium bromide stained agarose gel. B: Southern blot analysis. Lanes a and b, pig cDNA library, 2 p1 and 1 &I; lanes c and d, sheep cDNA library, 2 p1 and 1 p1; lanes e and f, bovine cDNA library, 2 J L ~and 1 k1. Water as negative control and cloned pIL-6 plasrnid as positive control were used in PCR.

many other cytokines, oncogene products and growth factors, including human and mouse IL-6 (Snick e t al., 1988)and the structurally related cytokine granulocyte colony-stimulating factor (Vakalopoulou et al., 1991; Bohjanen et al., 1991). A rapid turnover of the mRNA would clearly contribute to the apparent low abundance of transcripts in the conceptuses. Although we have not reported any direct evidence for the production of IL-6 by any of the conceptuses (because of lack of a validated bioassay for IL-6 in the various species), selective screening of day 15-17 ovine Xgtll cDNA expression library with antiserum raised against conceptus secretory proteins (Kramer et al.,

1991) has yielded a n IL-6 cDNA (S. Klemann, K.K. Kramer and R.M. Roberts, unpublished results). Therefore, sheep conceptuses a t around day 15 certainly do secrete IL-6. By analogy, it is assumed that cattle and pig conceptuses act similarly. Such a production of IL-6 was not unexpected in view of the tendency of IFNproducing cells to secrete several other cytokines more or less simultaneously, possibly as a result of a cascade of inductive events (De Maeyer and De Maeyer-Guignard, 1988). In this regard, interferon regulatory factor-1, a transcriptional activator of interferon-a, -p, and -w and possibly the trophoblast IFN (see Hansen et al., 19911,is inducible by IL-6 (Abdollahi et al., 1991).

IL-6 mRNA EXPRESSION IN PREIMPLANTATION CONCEPTUSES

329

Fig. 3. Southern blot analysis of PCR products obtained following reverse transcription of mRNA from the preimplantation conceptuses of pig, sheep, and cattle on various days of gestation.

A

B -

- 4

4-

0.0

10

12

14 2 0

22

10

15

25

30

DAY OF PREGNANCY

Fig. 4. RNase protection analysis of pig (A) and sheep (B) conceptus RNA. Number of samples assayed for IL-6 at various stages of gestation is indicated in parentheses. Each sample (5 pg of total RNA) was assayed in duplicate and the mean cpm is presented.

However, because IL-6 is presumably secreted, it seems likely that this cytokine would have effects on the underlying maternal tissue. The local edema, increased vascularity and other changes noted a t sites of trophoblasGuterine epithelium contact could well be the result of action of inflammatory cytokines. Interestingly, proteins in the serpin superfamily of proteins are major secretory products of the uterus at this stage of development in pigs (Malathy et al., 1990), sheep and cattle (Ing e t al., 1989a,b). Although it is unclear whether these uterine serpins have any proteinase-inhibitory activities, their synthesis is responsive to steroids, particularly progesterone. It will be of interest to determine if their expression is also modulated by IL-6, since that cytokine is capable of enhancing production of several serpins such as a,-antitrypsin and C1 inhibitor in liver as part of the acute response reaction (Gauldie et al., 1987). Additional studies are clearly needed to elucidate the role of IL-6 during early pregnancy of

these farm animal species and the effects of the cytokine on uterine endometrium.

ACKNOWLEDGMENTS The authors gratefully acknowledge James C . Cross, William E. Trout and Kyle K. Kramer for the collection of conceptus RNA samples and Dr. Previn Kumar Sehgal for the gift of the human and mouse IL-6 cDNA. This work was supported by NIH Grant HD21896. This is publication 11,518 of the University of Missouri Agricultural Experiment Station. The nucleotide sequence reported in this paper has been submitted to GenBank with a n Accession Number M80258.

REFERENCES Abdollahi A, Lord KA, Hoffmanliebermann B, Liebermann DA (1991): Interferon regulatory factor-1 is a myeloid differentiation primary response gene induced by interleukin-6 and leukemia inhibitory factor-role in growth inhibition. Cell Growth Diff 2:401407.

330

N. MATHIALAGAN ET AL.

Akira S, Hirano T, Taga T, Kishimoto T (1990a):Biology of multifunctional cytokines: IL-6 and related molecules (IL-1and TNF). FASEB J 4:2860-2867. Akiro S, Isshiki H, Sugita T, Tanabe 0, Kinoshita S, Nishio Y, Nakajima T, Hirano T, Kishimoto T (1990b): A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J 9:1897-1906. Bohjanen PR, Petryniak B, June CH, Thompson CB, Lindsten T (1991): An inducible cytoplasmic factor (AU-B) binds selectively to AUUUA multimers in the 3’ untranslated region of lymphokine mRNA. Mol Cell Biol 11:3288-3295. Caput D,Beutler B, Hartog K, Thayer R, Brown-Shimer S, Cerami A (1986): Identification of a common nucleotide sequence in the 3’untranslated region of mRNA molecules specifying inflammatory mediators. Proc Natl Acad Sci USA 83:1670-1674. Chomczynski P, Sacchi N (1987): Single-step method of RNA isolation by guanidinium thiocyanate-phenokhloroform extraction. Anal Biochem 162:15&159. Cross JC, Roberts RM (1989): Porcine conceptuses secrete an interferon during the pre-attachment period of early pregnancy. Biol Reprod 40:1109-1118. Cross JC, Roberts RM (1991): Constitutive and trophoblast-specific expression of a class of bovine interferon genes. Proc Natl Acad Sci USA 88:38173821. DeMaeyer E, DeMaeyer-Guignard J (1988): “Interferons and Other Regulatory Cytokines.” New York: John Wiley & Sons, pp 288-333. Dinarello CA (1987):Interleukins, tumor necrosis factors (cachectin), and interferons as endogenous pyrogens and mediators of fever. In E Pick, M Landy (eds): “Lymphokines.” Vol. 14. San Diego, CA: Aca. . demic Press, pp 1-31. Farin CE. Cross JC. Tindle NA, Muruhv _ ” CN, . Farin PW. Roberts RM (1991): ’Induction’of trophoblastic interferon expression in ovine blastocysts after treatment with double-stranded RNA. J Interferon Res 11:151-157. Gauldie J , Richards C, Harnish D, Lansdorp P, Baumann H (1987): Interferon p,/B-cell stimulatory factor type 2 shares identity with monocyte-derived hepatocyte-stimulating factor and regulates the major acute phase protein response in liver cells. Proc Natl Acad Sci USA 84:7251-7254. Gitlin JD, Colten HR (1987): Molecular biology of the acute phase plasma proteins. In E Pick, M Landy (eds): “Lymphokines.”Vol. 14. San Diego, CA: Academic Press, pp 123-153. Hansen TR, Leaman DW, Cross JC, Mathialagan N, Bixby JA, Roberts RM (1991): The genes for the trophoblast interferons and the related interferon-a,, possess distinct 5’-promoter and 3’-flanking sequences. J Biol Chem 266:3060-3067. Hirano T, Yasukawa K, Harada H, Taga T, Watanabe Y, Matsuda T, Kashiwamura S, Nakajima K, Koyama K, Iwamatsu A, Tsunasawa S, Sakiyama F, Matsui H, Takahara Y, Taniguchi T, Kishimoto T (1986): Complementary DNA for a novel human interleukin (BSF-2) that induces B lymphocytes to produce immunoglobulin. Nature 32473-76. Hodgen GD, Itskovitz J (1988):Recognition and maintenance of pregnancy. In E Knobil, J Neill (eds):“The Physiology of Reproduction.” Vol. 2. New York: Raven Press, pp 1995-2021. Imakawa K, Hansen TR, Malathy P-V, Anthony RV, Polites HG, Marotti KR, Roberts RM (1989): Molecular cloning and characterization of complementary deoxyribonucleic acids corresponding to bovine trophoblast protein-1: A comparison with ovine trophoblast protein-1 and bovine interferon-a,,. Mol Endocrinol3:127-139. Ing N, Francis H, McDonnell J J , Amann JF, Roberts RM (1989a): Progesterone induction of the uterine milk proteins: Major secretory proteins of sheep endometrium. Biol Reprod 41:643-654. Ing N, Roberts RM (198913): The major progesterone-modulated proteins secreted into the sheep uterus are members of the serpin superfamily of serine protease inhibitors. J Biol Chem 264:3372-3379. Jirik FR, Podor TJ, Hirano T, Kishimoto T, Loskotoff DJ, Carson DA, Lotz M (1989): Bacterial lipopolysaccharide and inflammatory mediators augment IL-6 secretion by human endothelial cells. J Immuno1 142:144-147.

Kameda T, Matsuzaki N, Sawai K, Okada T, Saji F, Matsuda T, Hirano T, Kishimoto T, Tanizawa 0 (1990):Production of Interleukin-6 by normal human trophoblast. Placenta 11:205-213. Koj A, Gauldie J , Regoeczi E, Sauder D, Sweeney GD (1984): The acute-phase response of cultured rat hepatocytes. Biochem J 224:505-514. Kramer KK, Trout WT, Roberts RM (1991):A novel approach to identification and molecular cloning of proteins secreted by the ovine conceptus near implantation. Biol Reprod 44(suppl1):89. Lefevre F, Martinat-Botte F, Guillomot M, Zouari K, Charley B, LaBonnardiere C (1990):Interferon-gamma gene and protein are spontaneously expressed by the porcine trophectoderm early in gestation. Eur J Immunol20:2485-2490. Loke YW, King A (1990): Interferon and human placental development. Placenta 11:291-299. Malathy PV, Imakawa K, Simmen RCM, Roberts RM (1990): Molecular cloning of the uteroferrin-associated protein, a major progesterone induced serpin secreted by the porcine uterus, and the expression of its mRNA during pregnancy. Mol Endocrinol4:428-440. May LT, Helfgott DC, Sehgal PB (1986):Anti-@-interferonantibodies inhibit the increased expression of HLA-B7 mRNA in tumor necrosis factor-treated human fibroblasts: Structural studies of the p2 interferon involved. Proc Natl Acad Sci USA 833957-8961. Murray R, Lee F, Chiu CP (1990): The genes for leukemia inhibitory factor and interleukin-6 are expressed in mouse blastocysts prior to the onset of hemopoiesis. Mol Cell Biol 10:4953-4956. Nishino E, Matsuzaki N, Masuhiro K, Kameda T, Taniguchi T, Saji F, Tanizawa 0 (1990): Trophoblast-derived interleukin-6 (IL-6) regulates human chorionic gonadotropin release through IL-6 receptor on human trophoblasts. J Clin Endocrinol Metab 71:436441. Rappolee DA, Wang A, Mark D, Werb Z (1989): Novel method for studying mRNA phenotypes in single or small numbers of cells. J Cell Biochem 39:l-11. Richards CD, Saklatvala J (1991): Molecular cloning and sequence of porcine interleukin-6 cDNA and expression of mRNA in synovial fibroblasts in vitro. Cytokine 3:269-276. Roberts RM, Farin CE, Cross J C (1990): Trophoblast proteins and maternal recognition of pregnancy. In SR Milligan (ed): “Oxford Reviews of Reproductive Biology.” Vol. 12. Oxford: Oxford University Press, pp 147-180. Roberts RM (1991): A role for interferons in early pregnancy. BioEssays 13:121-126. Ruef C, Budde K, Lacy J, Northmann W, Baumann M, Sterzel RB, Coleman DL (1990): Interleukin-6 is a n autocrine growth factor for mesangial cells. Kidney Int 38249-257, Sambrook J , Fritsch EF, Maniatis T (1989): “Molecular Cloning: A Laboratory Manual.” 2nd Ed. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory. Sanger F, Nicklen S, Coulson AR (1977): DNA sequencing with chainterminating inhibitors. Proc Natl Acad Sci USA 745463-5467, Sehgal PB, May LT, Tamm I, Vilcek J (1987): Human P2-interferon and B cell differentiation factor BSF-2 are identical. Science 235731-732. Snick JV, Cayphas S, Szikora J P , Renauld JC, Roost EV, Boon T, Simpson RJ (1988): cDNA cloning of murine interleukin-HP1: Homology with human interleukin 6. Eur J Immunol 18:193-197. Vakalopoulou E, Schaak J , Shenk T (1991): A 32-kilodalton protein binds to AU-rich domains in the 3’ untranslated regions of rapidly degraded mRNAs. Mol Cell Biol11:3355-3364. Weitlauf HM (1988): Biology of implantation. In E Knobil, J Neill (eds): “The Physiology of Reproduction.” Vol. 1. New York: Raven Press, pp 231-262. Zinn K, DiMaio D, Maniatis T (1983): Identification of two distinct regulatory regions adjacent to the human p-interferon gene. Cell 34:865-879. Zuraw EL, Lotz M (1990): Regulation of the hepatic synthesis of C1 inhibitor by the hepatocyte stimulating factors Interleukin 6 and Interferon gamma. J Biol Chem 26512664-12670.