Expression of mRNA and protein-protein interaction of the antiviral endoribonuclease RNase L in mouse spleen.

G Model

ARTICLE IN PRESS

BIOMAC 4309 1–12

International Journal of Biological Macromolecules xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac

Expression of mRNA and protein–protein interaction of the antiviral endoribonuclease RNase L in mouse spleen

1

2

3 4

Q1

Ankush Gupta, Pramod C. Rath ∗ Molecular Biology Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi 110067, India

5

6 21

a r t i c l e

i n f o

a b s t r a c t

7 8 9 10 11 12

Article history: Received 28 January 2014 Received in revised form 18 April 2014 Accepted 21 April 2014 Available online xxx

13

20

Keywords: RNase L 2-5A mRNA-expression Mouse tissues Protein–protein interaction Spleen

22

1. Introduction

14 15 16 17 18 19

23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39

The interferon-inducible, 2 ,5 -oligoadenylate (2-5A)-dependent endoribonuclease, RNase L is a unique antiviral RNA-degrading enzyme involved in RNA-metabolism, translational regulation, stress-response besides its anticancer/tumor-suppressor and antibacterial functions. RNase L represents complex cellular RNA-regulations in mammalian cells but diverse functions of RNase L are not completely explained by its 2-5A-regulated endoribonuclease activity. We hypothesized that RNase L has housekeeping function(s) through interaction with cellular proteins. We investigated RNase L mRNA expression in mouse tissues by RT-PCR and its protein–protein interaction in spleen by GST-pulldown and immunoprecipitation assays followed by proteomic analysis. RNase L mRNA is constitutively and differentially expressed in nine different mouse tissues, its level is maximum in immunological tissues (spleen, thymus and lungs), moderate in reproductive tissues (testis and prostate) and low in metabolic tissues (kidney, brain, liver and heart). Cellular proteins from mouse spleen [fibronectin precursor, ␤-actin, troponin I, myosin heavy chain 9 (non-muscle), growth-arrest specific protein 11, clathrin light chain B, a putative uncharacterized protein (Ricken cDNA 8030451F13) isoform (CRA d) and alanyl tRNA synthetase] were identified as cellular RNase L-interacting proteins. Thus our results suggest for more general cellular functions of RNase L through protein–protein interactions in the spleen for immune response in mammals. © 2014 Published by Elsevier B.V.

The interferon-inducible 2 ,5 -oligoadenylate-dependent ribonuclease L (RNase L) is a uniquely regulated endoribonuclease, a key player in the innate antiviral immune defense mechanisms of mammalian cells induced by interferons (IFNs) [1]. RNase L has been associated with a number of pathological conditions. Identification of RNase L gene (RNASEL) as a human prostate cancer (HPC1) susceptibility locus qualified it as a tumor suppressor against prostate cancer by virtue of its property to cause apoptosis of cells through RNA degradation [2]. Point mutations in RNase L (e.g., R462Q) decrease its RNase activity and possibly increase susceptibility to prostate cancer [3]. It has been reported that RNase L is not only a marker for hereditary prostate cancer but a single nucleotide polymorphism (SNP) in the 5 -untranslated region (5 -UTR) of the RNASEL gene predicts an increased risk of head and neck, uterine, cervix and breast cancer, thereby, suggesting its importance in maintaining homeostasis in normal cells against cancer [4]. Recently, the association of elevated 2-5A-dependent

∗ Corresponding author. Tel.: +91 11 26704525; fax: +91 11 26742558. E-mail addresses: [email protected], [email protected] (P.C. Rath).

RNase L with lung cancer has been correlated with its deficient enzymatic activity and dimerization [5]. A deregulation in the 2-5A pathway has been reported in the immune cells from Chronic Fatigue Syndrome (CFS) patients, characterized by upregulated 2-5A synthetase and RNase L activities, as well as by the presence of a low molecular weight 2-5A-binding protein of 37-kDa related to RNase L [6]. Recent literature shows a wide variety of new and emerging functions of RNase L, e.g., antineoplastic [7], antibacterial [8], cell growth inhibition [9], stress response [10], small RNA-mediated immune regulation [11], RNA as well as translational regulations [12–14], senescence and longevity [15], apart from its established role in antiviral, antiproliferative, immunomodulatory and apoptotic functions [1]. However, it is not clear how RNase L is biochemically responsible for all these cellular functions. RNase L is possibly the only known ankyrin repeat containing protein, which also has an enzymatic (ribonuclease) activity. Also, ankyrin repeat containing proteins such as NF-␬B/I␬B, yeast Swi6p, Cdc10p and Notch are mostly part of cellular multi-protein complexes with several interacting partners [16]. Till date, only three RNase L-interacting proteins are known from studies involving cell lines. These interacting proteins are ribonuclease L inhibitor (RLI) [17], eukaryotic release factor 3 (eRF 3) [12,13] and androgen

http://dx.doi.org/10.1016/j.ijbiomac.2014.04.042 0141-8130/© 2014 Published by Elsevier B.V.

Please cite this article in press as: A. Gupta, P.C. Rath, Int. J. Biol. Macromol. (2014), http://dx.doi.org/10.1016/j.ijbiomac.2014.04.042

40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62

G Model BIOMAC 4309 1–12

A. Gupta, P.C. Rath / International Journal of Biological Macromolecules xxx (2014) xxx–xxx

2 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81

82

83

84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105

106

107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122

ARTICLE IN PRESS

receptor (AR) [18]. Interestingly, RNase L with a higher number of ankyrin repeats (nine in human RNase L and eight in mouse RNase L), in comparison to I␬B-␣ and Notch, has rather limited interacting partners reported so far. Also, the multiple and emerging functions of RNase L cannot be fully explained only on the basis of its 2-5A-regulated endoribonuclease activity [19]. Involvement of RNase L in several pathological situations such as CFS, colorectal carcinogenesis [20], glutamate toxicity [21] indicates its importance in normal physiological functions. RNase L is highly expressed in mouse spleen [22] and RNase L-knock-out (−/− ) mice showed enlarged spleen and thymus indicating its physiological role in these two tissues [23]. We hypothesized that RNase L may be expressed in mammalian tissues under normal physiological conditions for housekeeping function(s) and it may interact with cellular proteins possibly through its ankyrin repeats. We have studied RNase L mRNA expression in mouse tissues and its protein–protein interaction in the mouse spleen. We report tissue-specific expression of RNase L mRNA in mouse and a number of cellular RNase L-interacting proteins in the mouse spleen. 2. Materials and methods 2.1. Animals, reagents, plasmids, oligonucleotides, E. coli strains Swiss albino male mice and male rabbits were obtained from the Animal House of Jawaharlal Nehru University and the study was carried out as per the guidelines of the Institutional Animal Ethics Committee (IAEC). Escherichia coli DH5-␣ and E. coli BL21 strains were used as host cells for cloning and expression of the recombinant glutathione-S-transferase (GST) fusion dominant negative (DN) mouse RNase L, respectively. The LB-medium and LB-agar plates were supplemented with 100 ␮g/ml of ampicillin. The pGEX 2TK vector (Amersham, U.S.A.) was used for the protein expression. Oligonucleotides were commercially synthesized (Microsynth, Switzerland) and Pfu DNA polymerase (Biotools) was used for PCR-amplification of the RNase L cDNA. Glutathioneagarose beads, isopropyl thiogalactoside (IPTG), TRI reagent, anti-rabbit IgG (whole molecule)-HRP conjugated (Cat No. A9169) were purchased from Sigma–Aldrich (U.S.A.). Other biochemicals and molecular biology reagents were from Sigma–Aldrich (U.S.A.), Merck (Germany), Qualigens (India) and Spectrochem (India). The partial mouse RNase L cDNA plasmid (pZB1) [24] was a generous gift from Prof. R. H. Silverman, Cleveland Clinic Foundation, OH, U.S.A. Most of the common molecular biology methods were adopted from the protocol book, Molecular Cloning: a laboratory manual [25] with certain modifications. 2.2. Recombinant DN-mouse RNase L protein and bead-binding Since Bam HI site is present in the mouse RNase L cDNA, in order to subclone it in pGEX2TK expression vector (at Bam HI site), a Bam HI site was constructed by addition of the last ‘C’ to GGATC on either ends of the DN-mouse RNase L (DN-mRNase L) cDNA by PCR and by end-filling of Bam HI-digested pGEX2TK by Klenow polymerase. The fragment encoding DN-mRNase L (corresponding to 1–646 amino acids of mouse RNase L) was PCR-amplified by pfu DNA polymerase from pZB1 plasmid. The blunt-ended PCR-product was 5 -phosphorylated by T4 polynucleotide kinase followed by ligation into blunt-ended pGEX2TK vector by T4 DNA ligase. This generated the pGEX-DNmRNL expression plasmid, which was transformed into E. coli DH5-␣ cells to prepare the plasmid DNA and E. coli BL-21 cells to express the GST-DNmRNase L recombinant protein. Recently, we have described the expression, purification and characterization of the interferon-inducible, antiviral and tumor suppressor protein, human RNase L [26]. For expression of the

recombinant dominant negative mouse RNase L protein, a different method was optimized and followed. Briefly, a freshly-transformed colony of pGEX-DNmRNL/BL-21 cells was grown overnight on LBagarAmp plate at 37 ◦ C and inoculated into a primary culture of 10 ml LBAmp and again grown overnight at 37 ◦ C, 220 rpm. Then a secondary culture of 100 ml LBAmp was inoculated with 1% (v/v) inoculum from the primary culture. The secondary culture was incubated at 37 ◦ C, 220 rpm until the O.D. at 600 nm reached ∼0.6–0.8. The culture was then incubated at 18 ◦ C, 220 rpm for 30–40 min until the culture temperature reached ∼18 ◦ C. Then GSTDNmRNase L protein was induced by adding IPTG up to 25 ␮M and continuing the culture for 5 h at 200 rpm. Then the cells were collected by low speed centrifugation and washed once with 10 ml Buffer A [Phosphate buffered saline (PBS), 10% (v/v) glycerol, 1 mM EDTA, 0.1 mM ATP, 5 mM MgCl2 , 14 mM 2-mercaptoethanol, 2 ␮g/ml leupeptin and 2 mM PMSF]. The cell pellet was resuspended in 10 ml Buffer A supplemented with lysozyme (100 ␮g/ml) and incubated at 4 ◦ C for 30 min on a rocking platform. The cell suspension was lysed on ice by sonication at 18 micron for 15 s for five times. Triton X-100 was added to a final concentration of 1% (v/v), and the cell lysate was again incubated on a rocking platform at 4 ◦ C for 30 min. The supernatant was collected after centrifugation at 20,000 × g for 15 min at 4 ◦ C. Purification of the fusion protein was performed by batch-affinity by using Glutathione-agarose beads. Glutathione-agarose [500 ␮l of a 50% (v/v) slurry was pre-equilibrated with buffer A] and added to the clarified cell lysate and incubated on ice on a rocking platform at 4 ◦ C for 1 h. After washing the bead-bound-protein mixture with 10 ml of Buffer A for three times, it was used for the GST-pulldown assay. The GST-DNmRNase L recombinant protein was also characterized by MALDI-TOF analysis.

2.3. RNase L mRNA expression by RT-PCR analysis Healthy male Swiss albino mice of 8–10 weeks of age were sacrificed by euthanization using chloroform and total RNA was isolated from the nine tissues (liver, kidney, brain, heart, prostate, testis, spleen, thymus and lungs) by using the TRIreagent (Sigma–Aldrich) method. For the synthesis of first strand cDNAs, 2 ␮g RNA (1 ␮g/␮l) from each tissue was mixed with 500 ng of oligo-dT primer (100 ng/␮l) in a total volume of 15 ␮l containing deionized DEPC-treated water and then subjected to heat-denaturation at 70 ◦ C for 5 min in a thermal cycler followed by quick-chill on ice for 5 min. A 10 ␮l RT-mix (1× RT buffer, 0.5 mM dNTPs, 20 U RNasin RNase-inhibitor and 200 U MMLV-RT (Promega) was added to the denatured RNA + oligodT mix and the 25 ␮l reaction mixture was incubated at 42 ◦ C for 1 h in a thermal cycler. The first strand cDNAs was used for subsequent PCR with multi-exonic RNase L gene-specific primers (forward primer = 5 CTGCAACCACAAAACATCTTAATA3 and reverse primer = 5 AGATCTGGAAATGTCTTCTGAAAATA3 ) in a 35 cycle (95 ◦ C × 45 s, 60 ◦ C × 1 min and 72 ◦ C × 1 min) reaction, which generated an amplified product of 644 bp from the mouse RNase L mRNA. Similarly, RT-PCR reactions were performed for GAPDH for the nine tissues using the following primers (forward primer = 5 ACCACAGTCCATGCCATCAC3 and reverse primer = 5 TCCACCACCCTGTTGCTGTA3 ) in a 35 cycle (95 ◦ C × 45 s, 60 ◦ C × 45 s and 72 ◦ C × 1 min) reaction, which generated an amplified product of 452 bp. RT-PCR products for RNase L and GAPDH from the nine tissues were resolved by electrophoresis on 1.5% (w/v) agarose-TBE gel at 30–50 mA. Quantitation of the RT-PCR products by densitometry was carried out by AlphaEase FCTM software and Alpha imager 3400 (Alphainnotech corporation).


123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154

155

156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184


ARTICLE IN PRESS A. Gupta, P.C. Rath / International Journal of Biological Macromolecules xxx (2014) xxx–xxx

185

2.4. Polyclonal antibody against DN-mRNase L protein

205

A healthy male rabbit of about 9 months of age and 2.4 kg body weight was used for the preparation of polyclonal antiserum. Approximately, 2–3 ml of preimmune serum was collected from the rabbit before the primary injection as a negative control. Primary immunization containing 300–350 ␮g of the affinity-purified GST-DN mRNase L protein was resolved in a 10% SDS-PAGE, re-suspended in equal vol. of Freud’s complete adjuvant (Sigma–Aldrich) and subcutaneously injected into the rabbit. Subsequently, three booster immunizations, containing 250–300 ␮g of the mixture, were administered intramuscularly. Approximately, 15–16 ml of the polyclonal antiserum was collected from the rabbit and stored at −20 ◦ C after adding 0.02% (w/v) sodium azide. To remove antibody developed against GST fused to the N-terminus of DN-mRNase L, it was pre-cleared. Approximately, 20–50 ␮g of the purified recombinant GST was blotted onto 1 cm2 of nitrocellulose strip and washed twice with 1× PBST for 5 min. The blot was placed in a 2 ml Eppendorf tube and 200–500 ␮l of the antiserum was incubated with the blot at 4 ◦ C on a rocking platform for 1 h. The pre-cleared antiserum was centrifuged in a new Eppendorf tube at 18,000 × g for 10 min at 4 ◦ C and the supernatant was collected.

206

2.5. Preparation of mouse spleen extract and RNase L western blot

186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204

207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240

241 242

243 244 245

Healthy male Swiss albino mice of 8–10 weeks of age was sacrificed by euthanization using chloroform and the spleen was removed and washed in cold normal saline, blotted dry, weighed and immediately frozen in liquid nitrogen. The spleen tissue was crushed and powdered finely using a mortar and pestle in liquid nitrogen. A 5% (w/v) homogenate was prepared in modified 1× RIPA Buffer B [50 mM Tris–HCl (pH 7.5), 150 mM NaCl, 5 mM EDTA (pH 8.0), 2.5 mM EGTA (pH 7.5), 1 mM sodium orthovanadate, 2 mM sodium fluoride, 2 mM DTT, 1% (v/v) Triton-X-100, 0.5% sodium deoxycholate, 0.1% (w/v) SDS, 2 mM PMSF, 5 ␮g/ml leupeptin, 5 ␮g/ml aprotinin, 500 ␮g/ml benzamidine-HCl] and incubated with rocking at 4 ◦ C for 30 min. The homogenate was sonicated at 15 micron for 15 s thrice with 1 min gap in between. The sonicated homogenate was centrifuged at 15,000 × g for 30 min, 20% (v/v) sterile glycerol was added to the cleared supernatant, mixed and aliquots of 200–400 ␮l were prepared and stored at −80 ◦ C. For immunoblotting, 9% SDS-PAGE gels containing mouse GST-DNmRNase L clone induced by IPTG (C.I.), affinity-purified GST-DNmRNase L protein (P) and 100 ␮g mouse whole spleen extract were electrophoresed in 1× Tris–Glycine–SDS Buffer at 90 V and then transferred onto nitrocellulose membrane at 40 V in tris–glycine–methanol transfer buffer overnight at 4 ◦ C. Blots were blocked in 5% (w/v) non-fat milk for 2 h at RT and then probed with either pre-immune serum (1:1000 dilution in 1× PBST) or 3rd booster antiserum (1:5000 dilution in 1× PBST for the purified protein and 1:1000 dilution in 2.5% (w/v) milk in 1× PBST for the spleen extract) for 2 h (4 h for the spleen extract) at RT. The blots were washed thrice in 1× PBST for 5 min each time with gentle shaking. The membrane was then incubated with secondary antibody (anti-rabbit-HRP-conjugated raised in goat) at a dilution of 1:10,000 in 2.5% (w/v) milk in 1× PBST for 2 h at RT. The blots were washed thrice in 1× PBST for 10 min each with gentle shaking. The blots were probed and developed by using ECL reagent (Pierce) and X-ray film (Kodak). 2.6. Immunoprecipitation of cellular RNase L from mouse spleen extract 15 ␮l of either pre-immune serum or anti-DN-mRNase L antiserum was bound to 20 ␮l of 50% (v/v) slurry of the protein-A-sepharose beads in a total volume of 300 ␮l in Buffer

3

B [without 0.1% (w/v) SDS and with 0.5 mM DTT] by incubation at 4 ◦ C for 1 h with rocking in a 500 ␮l Eppendorf tube. After binding and removing the supernatant, the beads were washed twice with 200 ␮l wash buffer [50 mM Tris–HCl (pH 7.5), 150 mM NaCl, 5 mM EDTA (pH 8.0), 2.5 mM EGTA (pH 7.5), 1 mM sodium orthovanadate, 2 mM sodium fluoride, 1% (v/v) Triton-X-100, 0.5% (w/v) sodium deoxycholate, 2 mM PMSF, 5 ␮g/ml leupeptin, 5 ␮g/ml aprotinin, 500 ␮g/ml benzamidine-HCl] by incubation at 4 ◦ C for 1 h with rocking. The protein-A-sepharose beads bound to the pre-immune serum were then incubated with 4 mg of the mouse spleen whole tissue extract for pre-clearing in a total volume of 1 ml in a 1.5 ml Eppendorf tube with rocking at 4 ◦ C for 2 h. The beads were given two quick washes by incubating with 200 ␮l of wash buffer by inverting the tube several times. Finally, three washes with 200 ␮l of wash buffer were given by incubation at 4 ◦ C for 5 min with rocking. The protein-A-sepharose beads bound to the anti-DN-mRNase L antibody were then incubated with the pre-cleared 4 mg mouse spleen whole tissue extract in a total volume of 1 ml in a 1.5 ml Eppendorf tube with rocking at 4 ◦ C for overnight (10–12 h). The beads were then given 2 quick washes and three 5 min washes with rocking at 4 ◦ C. The beads used for pre-clearing and for immunoprecipitation of cellular RNase L were mixed separately with 50 ␮l of 1× SDS loading dye (+DTT) by vortexing and the mixture was boiled for 5–10 min. The cooled supernatants from pre-cleared and immunoprecipiated samples were loaded on to 9% SDS-PAGE and electrophoresed at 90 V. Five independent experiments were performed to validate the results. 2.7. GST-pulldown of recombinant RNase L mixed with mouse spleen extract Equimolar quantities of GST and GST-DN-mRNase L recombinant proteins were bound to equal volumes of Glutathione-agarose beads [40 ␮l of a 50% (v/v) slurry] and incubated with approximately 3.5–4.0 mg of the mouse spleen whole tissue extract in a total volume of 1000 ␮l in Buffer B with rocking at 4 ◦ C for overnight (8–10 h). The beads were collected by centrifugation at 1000 × g for 1 min at 4 ◦ C. The beads were given two quick washes by incubating with 200 ␮l of wash buffer [1× PBS + 0.1% (v/v) Triton X-100] by inverting the tube several times and centrifugation at 1000 × g for 1 min at 4 ◦ C. Finally, three washes with 200 ␮l of wash buffer were given by incubation at 4 ◦ C with rocking for 5 min. The washed beads were mixed in 50 ␮l of the 1× SDS loading dye (+DTT) by vortexing and boiled for 5–10 min. The cooled supernatant from the GST and GST-DN-mRNase L pulldown samples were loaded, along with the same amount of the respective proteins as the input material for comparison, on 9% SDS-PAGE and electrophoresed at 90 V. Five independent experiments were performed for validating the results. 2.8. Sample preparation for mass spectrometry analysis The identification and characterization of proteins (either a complex cluster of bands or a single band) as obtained by immunoprecipitation and GST-pulldown techniques (after being compared to proper controls) were processed for LC/MS–MS or MALDI/TOF analysis. The excised Coomassie-stained protein bands were sliced into minute pieces and destained by sequential washing with 40% (v/v) 100 mM ammonium bicarbonate (ABC) and 60% (v/v) acetonitrile (ACN). Cysteine residues were reduced by soaking the gel pieces in 20 mM DTT and incubating at 60 ◦ C for 1 h and derivatized by treatment with 100 mM iodoacetamide at RT in dark for 20 min. After further washing with ABC buffer, the gel pieces were again dehydrated with acetonitrile and dried at 37 ◦ C in a speedvac, prior to addition of trypsin (Sigma; 30 ␮l of a 10 ng/␮l solution in 25 mM ABC). The digestion proceeded for 16 h at 37 ◦ C in a moist


246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272

273 274

275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292

293

294 295 296 297 298 299 300 301 302 303 304 305 306 307

G Model

ARTICLE IN PRESS

BIOMAC 4309 1–12


4

315

chamber, and the digested peptide ions were recovered by sequential extractions with 25 mM ABC, 1% (v/v) triflouroacetic acid (TFA) (for samples processed for MALDI/TOF) and 1% (v/v) formic acid (FA) (for samples processed for LC/MS–MS) and different percentages of acetonitrile. The pooled extracts were dried in a speed-vac and redissolved in 0.1% (v/v) TFA for MALDI/TOF analysis and 0.5% (v/v) FA in 30% (v/v) acetonitrile (for offline analysis) for LC/MS–MS analysis.

316

2.9. MALDI/TOF and LC-MS/MS analyses

308 309 310 311 312 313 314

341

The samples were either loaded onto the sample plate and subjected to laser desorption and ionization (MALDI/TOF) (Brüker Daltonics Autoflex II TOF/TOF system) or resolved through C-18 reverse phase column (0.75 A˚ internal diameter and a flow rate of 1 ␮l/min) (Agilent 1200 NanoLC system) in line with the mass spectrometer. The analysis of the resolved peptide ions was carried out using a nano-spray LC/MS with a linear ion-trap (Applied Biosystems 4000 Q TRAP LC-MS/MS system). The mobile phases consisted of 0.1% (v/v) formic acid containing 3% (v/v) acetonitrile (A) and 0.1% (v/v) formic acid in 95% (v/v) acetonitrile (B), respectively. Peptides were resolved using a 120–150 min linear gradient. The ions eluted from the column were electrosprayed at a very high voltage of 1.75 kV. Known trypsin autolysis products and keratin-derived precursor-ions were automatically excluded. The MS/MS data were searched by correlation of the mass spectra to entries in MSDB or NCBI nr using MASCOT search engine. One missed cleavage per peptide was allowed, and an initial mass tolerance of 50 p.p.m. was used in all searches. Cysteines were assumed to be carbamidomethylated, but other potential modifications were not considered in the first-pass search. All matching spectra were reviewed manually, but in cases, where the score reported was less than 50, additional searches were performed against the MSDB and the NCBI nr database using MASCOT (http://www.matrixscience.com/cgi/search form.pl?FORMVER= 2&SEARCH=SQ).

342

2.10. Data analysis

317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340

359

The proteins identified by the mass spectrometry techniques were analyzed by using the following criteria: (1) unique proteins that appeared only in the immunoprecipitated or the pulled-down lanes in order to exclude false positives, (2) the protrins that appeared in all the five independent experiments and (3) had a higher spectral count above a threshold unique to the protein of interest. A value of P < 0.05 was considered statistically significant. The gene ontology (GO) annotations for the identified proteins were carried out using UniProtKB/Swiss-Prot release and UniProtKB/TrEMBL release software along with inputs from the PubMed. A web based server called ScanMoment (www.scanmoment.org) was used to analyze the primary RNase L sequence, which utilizes combinatorial analysis of basic residues in nucleic acid binding sites thereby, predicting the binding sites of nucleic acids in proteins. The parameter called basic moment measures the periodicity of basic residues in the proteins and detects the presence of basic faced alpha helices (BFAHs) in nucleic acid binding sites of proteins [27].

360

3. Results and discussion

343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358

361 362

363 364 365 366

3.1. Expression of RNase L mRNA in mouse tissues and RNase L protein in mouse spleen RNase L has been mostly described as an inducible and activated protein by various agents such as virus, interferon, double stranded RNA and stressors in mammalian cells for the purpose of viral/cellular RNA degradation and apoptosis of the cells as

well as under certain pathological conditions. The present study investigated the possibility of constitutive expression of RNase L mRNA in mouse tissues and protein–protein interaction of RNase L in mouse spleen under normal physiological conditions. Fig. 1(a) shows the mRNA expression profile of RNase L from nine different mouse tissues, e.g., liver, kidney, brain, heart, prostate, testis, spleen, thymus and lungs. The RT-PCR profile demonstrates a 644 bp amplicon for the mouse RNase L mRNA and a 452 bp amplicon for the GAPDH mRNA as an internal control. Fig. 1(b) shows the semi-quantitative measurement of the RT-PCR products as relative ratio of mRNase L to GAPDH mRNA expression after normalization. This shows a tissue-specific and differential expression pattern of RNase L mRNA in mouse under normal physiological conditions. Three types of RNase L mRNA expression patterns are observed in the tissues, i.e., high, intermediate and low levels of expression. High level of RNase L mRNA expression is observed in tissues of the immune system (in the order of higher to lower): spleen followed by thymus and then lungs (relative values of 1.36 ± 0.014 > 1.23 ± 0.07 > 1.01 ± 0.09, respectively). The intermediate level of expression is observed in tissues of the male reproductive system, almost comparable levels in prostate and testis (relative values of 0.79 ± 0.03 and 0.82 ± 0.016, respectively). The low level of expression is observed in the metabolic tissues (in the order of higher to lower): kidney followed by brain, liver and then heart, the last three being more or less comparable (relative values of 0.39 ± 0.08 > 0.23 ± 0.05 > 0.2 ± 0.02 > 0.18 ± 0.01, respectively). Here, we observe that RNase L mRNA is constitutively expressed at basal levels in almost all the tissues of mouse under normal conditions. Highest expression of RNase L mRNA in the immunological tissues (spleen, thymus and lungs) suggests its physiological significance in these tissues for immune functions. This is in agreement with the earlier reports that RNase L−/− mice showed defects in interferon action, apoptosis and resulted into enlargement of spleen and thymus of the mice, thus elucidating its role in antiviral and immunomodulatory activities of these tissues [23]. RNase L is a crucial mediator of the innate immunity [28] and the self-RNA cleavage by RNase L amplifies antiviral innate immunity [11,29]. Moreover, dysregulated RNase L has been linked to pathologic effects related to immunity and proliferative control [30]. Recently, RNase L has been reported to trigger autophagy in response to viral infections [31]. Radiolabelled 2-5A binding/crosslinking and immunoblotting studies have already reported the highest expression of RNase L protein in mouse spleen tissue [22,32]. Thus, spleen was an obvious choice as the source of interacting proteins of RNase L. Fig. 1(c) and (d) demonstrates that the precleared rabbit polyclonal antibody raised against DN mouse RNase L is specific against the purified recombinant DN-mouse RNase L (loaded as 75, 150 and 300 ng) as well as the native RNase L protein from mouse spleen. The recombinant protein produced a clear band of 100 kDa (corresponding to 945 amino acids) of the DN-GST-mRNase L fusion-protein while the endogenous and native mouse RNase L from spleen produced a clear band at ∼83 kDa (corresponding to 735 amino acids). No signal was detected in the preimmune serum treated blot indicating that the polyclonal antibody raised in rabbit was specific to mouse RNase L. Interestingly, we experienced that the extraction of native RNase L is difficult and it requires a particular combination of ionic and non-ionic detergents supplemented with high reducing agents like 2–3 mM DTT (data not shown). This also indicates that the nature of RNase L as a highly interacting protein, which is probably a part of a cellular multi-protein complex and the role of the cysteine-rich residues within the protein kinase homology domain may be involved in the formation of disulphide linkages. It would be interesting to analyze such cellular RNase L complexes in the mouse spleen.


367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430



5

Fig. 1. RNase L mRNA expression in mouse tissues by RT-PCR and protein expression in mouse spleen by ␣-mRNase L immunoblotting. (a) Agarose gel showing 644 bp amplicon for RNase L mRNA and 452 bp amplicon for GAPDH. (b) Semi-quantitative expression as normalized ratio of RNase L/GAPDH mRNA expressions shown in (a). The quantitation represents RNase L/GAPDH IDV ratio expressed as mean ± S.D. of three independent experiments. (c) Western blots analysis of purified recombinant DN-GSTmRNase L protein using rabbit polyclonal anti-DN-mouse RNase L primary antibody as the antiserum. Left panel shows the blot probed with preimmune serum. C.I. – Clone Induced by IPTG; P – Affinity purified DN-GST-mRNase L recombinant protein. Lanes 1, 2 and 3 in the right panel show purified DN-GST-mRNase L protein in 75, 150 and 300 ng quantities. Arrow shows DN-GST-mRNase L protein. (d) Western blots analysis of native RNase L protein from mouse spleen extract (100 ␮g total protein). Using rabbit polyclonal anti-DN-mouse RNase L primary antibody. Left panel shows the blot probed with preimmune serum and right panel shows the expression of ∼83 kDa native RNase L in mouse spleen.

431 432

433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457

3.2. Immunoprecipitation and GST-pulldown for RNase L-interacting proteins We then performed GST-pulldown of GST-mRNase L mixed with mouse spleen extract and immunoprecipitation of mouse spleen extract by the RNase L antibody. Fig. 2(a) demonstrates the immunoprecipitation profile obtained by using precleared anti-DN mouse RNase L antibody against normal mouse spleen total protein extract. MSE1, MSE2, MSE4 and MSE5 are uniquely appearing bands only in the immunoprecipitated sample as compared to the preimmune serum negative control. MSE3 was taken as an internal control and also processed for identification. Since, MSE1 and MSE2 were closely spaced bands, they were processed for LCMS/MS identification. Similarly, MSE3, MSE4 and MSE5 bands were processed for MALDI-TOF identification. A particular combination of nonionic and ionic detergent (1% (v/v) Triton X-100 and 0.5% (w/v) sodium deoxycholate) along with 0.5 mM DTT was essential for proper extraction of the complex proteins otherwise a higher band, probably representing a high molecular weight protein complex, always appeared in the stacking gel that could not enter into the resolving gel (data not shown). This again indicated that cellular RNase L exists as a part of a multi-protein complex that could not be totally extracted without any reducing agent, this confirmed to the results of earlier western blot experiment. The presence of extensive inter- and intra-molecular disulphide linkages between the cysteine residues of proteins may prevent them from complete reduction and denaturation by DTT/␤-ME and SDS respectively. Hence, the protein complexes are possibly able to survive the 9%

SDS-PAGE. Also, the cysteine-rich region is present within the protein kinase homology domain of RNase L, which may make the proposed disulphide linkages. Fig. 2(b) demonstrates the GST-pulldown profile obtained by using equimolar quantities of either GST alone or DN-GST-mouse RNase L against normal mouse spleen total protein extract. The success of the pulldown experiments depends upon several factors like the solubility and the binding activity of the recombinant protein, the native environment of the protein where it would be functionally stable and the quality, quantity and source of the proteins present in the cellular extract, which were empirically optimized for these experiments. The IPTG-induced expression of DN-GST-mouse RNase L protein was accompanied by proteolytic degradation of the recombinant protein in the bacterial cells but it was optimized to a considerably reduced level by using minimal IPTG concentration (25 ␮M) and lower temp. (18 ◦ C) for the induction in such a way that more than 85% of the intact protein was obtained as the soluble protein. To pulldown larger quantities of the interacting proteins for identification by mass spectrometry techniques, higher quantities of the recombinant DN-GST-mouse RNase L (40 ␮g) and spleen total protein extract (3.5–4.0 mg) were used. Pulldown with DN-GST-mRNAse L clearly demonstrates the unique appearance of three clusters of bands in the size range of ∼250 kDa designated as LMP1, LMP2 and LMP3, respectively. LMP1 contained a minimum of 5–7 protein bands; LMP2 contained 2–3 bands while LMP3 contained 1–2 bands. This observation is in agreement with the immunoprecipitation data where there is appearance of specific interacting bands above 250 kDa indicating a large multi-protein


458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485

G Model BIOMAC 4309 1–12 6


Fig. 2. Immunoprecipitation and GST-pulldown against RNase L from mouse spleen extract. (a) Immunoprecipitation with the antibody specific to mouse RNase L protein bound to protein-A sepharose beads. Buffer containing 1% Triton X-100 + 0.5% Sodium Deoxycholate + 0.5 mM DTT showed maximun yield of the immunoprecipitated proteins. The immunoprecipitated bands are marked as MSE (mouse spleen extract) 1, MSE2, MSE3, MSE4 and MSE5, respectively. M1 and M2- molecular size markers; I.E. – input extract of mouse spleen tissue; P.E. – precleared extract of the spleen tissue; F.T. – flowthrough after immunoprecipitation; I.A. – Input antibody (antiserum ␣-mRNase L 3rd




486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512

513 514

515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542

complex being formed by the recombinant RNase L protein in the mouse spleen extract in vitro. The large number of protein bands present below the full length DN-GST-mRNase L (100 kDa) band are proteolytic degradation products of the recombinant protein as determined by MALDI/TOF analysis (data not shown). The three clusters of bands from the pulldown with DN-GST-mRNase L protein were processed for identification by LC/MS–MS. Different interacting proteins were obtained by the two different methods. There are certain limitations in immunoprecipitation as compared to GST-pulldown experiments to study protein–protein interactions. They are as follows: (i) very low level of reducing agents is used in immunoprecipitation as it can affect the integrity of the antibodies used for immunoprecipitation, (ii) proteins with high cysteine content like RNase L with extensive disulphide linkages are generally difficult to extract, (iii) the native complex, formed by the protein under investigation, is always low in stoichiometric concentration to be immunoprecipitated. On the contrary, GST-pulldown provides opportunity to use (i) large amounts of the bait-protein for in vitro complex formation and (ii) higher amounts of reducing agents can always be used for complete extraction of the complex. Therefore, we observed greater representation of the interactors from the GST-pulldown experiment as compared to the immunoprecipitation experiment. The immunoprecipitation results represent the endogenous RNase L protein–protein complexes in the spleen, whereas the GSTpulldown results represent RNase L protein–protein complexes formed by the recombinant protein in vitro in the spleen extract. 3.3. Identification of RNase L interacting proteins by MALDI/TOF and LC-MS/MS Table 1 shows a list of eight interacting proteins of RNase L along with their brief functions with spectral count (score values) above the significant threshold identified by either MALDITOF or LC/MS–MS techniques. The details of molecular weight, method used for interaction study, their unique mass spectrometry database (MSDB) identifiers, amino acid sequences of the peptide-ions matched with the database entries and references to the appropriate figures are mentioned in Table 2. Using GO classification, we report that 2 ,5 -oligoadenylate dependent RNase L interacts with broadly two types of proteins based on their function in the cell extracts/cellular conditions of mouse spleen; 62.5% of these are cytoskeletal and motor protein network [Fig. 3(a)], which help in cytoskeleton integrity, cellular scaffolding and vesicular trafficking while 12.5% of the proteins are members of the translational proof-reading and editing assembly. The cytoskeletal and motor assembly RNase L-interacting proteins are, ␤-actin, troponin I, myosin heavy chain 9, fibronectin precursor and a putative uncharacterized protein named as RIKEN cDNA 8030451F13, isoform CRA d, which on blast analysis showed significant homology to myosin binding protein C, slow type isoform CRA j (Table 1). The RNase L-interacting protein of the translational proof-reading and editing assembly is alanyl-tRNA synthetase. Identification of the growth-arrest specific protein 11, which is not yet very well characterized and the clathrin light chain B (Table 1) may explain role of RNase L in cell death/apoptosis and in vesicular trafficking respectively. One common factor found in the clusters of higher bands, LMP1, LMP2 and LMP3 is the presence of recombinant DNmouse RNase L protein along with the peptide ions from other

7

proteins thus, exhibiting strong interacting nature of the recombinant DN-GST-mRNase L protein in such a way that it shifts from its monomeric size of ∼100 kDa into the complex clusters (Table 2). The initial biochemical purification and gel filtration experiments of RNase L from mouse Ehrlich ascites tumor cells had reported that it as a protein of approximately 185–200 kDa as determined by the Sephacryl S-200 chromatography [33]. Our data shows that the high molecular mass RNase L observed by earlier reports may not be a dimeric or multimeric form of RNase L, rather it is a large multiprotein complex consisting mostly of the cytoskeletal network and translational-assembly proteins bound to RNase L. A less appreciated function of cytoskeletal proteins is their role as a physical anchor and transport substrate for key mediators of gene expression, i.e., the mRNAs may be transported in the cytoplasm from one compartment to another for their spatial and temporal regulation for translation. Cellular mRNAs are not freely diffusible in the cytoplasm rather they are bound to the cytoskeleton through ribonucleoprotein complex containing certain proteins, which bind to both the mRNA and the cytoskeletal proteins like the microtubule associated protein (MAP1) [34] for the purpose of localized protein synthesis [35,36]. It is possible that the N-terminal ankyrin repeat region of RNase L can interact with cytoskeletal and translational proteins while the Cterminal half with a regulated ribonuclease domain can interact with RNA under cellular conditions, i.e., mRNA, tRNA and other small RNAs. Fig. 3(b) demonstrates a graphical representation of the basic moment data of the full length RNase L. The basic moment defines a parameter that measures the periodicity of basic residues in a protein and designed to detect the presence of basic faced alpha helices (BFAHs) in nucleic acid binding sites of the protein [27], [www.scanmoment.org]. Highest basic moment is particularly concentrated in the C-terminal region of RNase L between 600 and 670 amino acid residues, which interestingly is a part of the ribonuclease domain associated with RNA binding and ribonuclease activity reported recently [37]. In this recent report, existence of a third 2-5A binding site in the (pseudo)kinase homology (KH) domain and RNA-cleavage by the histidine-672 (H-672) in the ␣-helix/loop element (HLE) present in the kinase extension nuclease (KEN) domain of RNase L as well as the RNA-cleavage site ˆ have been proposed [37]. Thus, RNase L can simulbeing UNN taneously bind to cellular RNAs as well as the cytoskeletal and translational assembly proteins. This may be linked to the intracellular transport and translational regulation of the RNA. It would be interesting to investigate if such RNase L complexes are part of the P-bodies. Actin is one of the two major microfilaments, the other one being tubulin, which acts as a scaffold on which several motor and other proteins bind and move. The previous report of the cleavage of G-actin along with the 2-5A-dependent RNase L cleavage in the peripheral blood mononuclear cells (PBMCs) [38] and our data that actin interacts with RNase L, together support RNase L possibly being linked to cytoskeletal assembly and the 2-5A pathway. Interaction of RNase L with the motor protein, myosin heavy chain 9 and the microfilaments directly correlates with its role in movement of vesicles as shown by its interaction with the clathrin light chain B and the translational-assembly protein, alanyl-tRNA synthetase. An earlier report showed RNase L to be localized in the cytoskeleton of the cells as a detergent insoluble fraction with

booster); P.I. – Preimmune serum immunoprecipitated sample. (b) GST-pulldown of the total mouse spleen extract (3.5–4.0 mg) with equimolar quantities of GST (∼10 ␮g) and DN-GST-mRNase L (∼40 ␮g) bound to Glutathione-agarose beads. Buffer containing 1% Triton X-100 + 0.5% Sodium Deoxycholate + 3 mM DTT were used. Uniquely appearing protein bands in the pull-down lanes of DN-GST-mRNase L are indicated as LMP (low molecular protein) 1, LMP2, and LMP3. GST input and GST P.D. (pulled-down); and mRNase L input and mRNase L P.D. are loaded as 50% of the amount used for the actual pull-down experiment. MSE input is the mouse spleen extract used for the pull-down experiment (∼0.6% of the total amount used is loaded). MSE – mouse spleen extract; M – molecular size marker; kDa – kiloDalton; P.D. – pull-down; input – the material used for the reaction.


543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601

G Model

ARTICLE IN PRESS

BIOMAC 4309 1–12


8

Table 1 List of RNase L-interacting proteins from mouse spleen identified by MALDI/TOF and LC-MS/MS with MSDB accession no., molecular weight, spectral counts and brief function. Protein name

Spectral count

Protein function

Immunoprecipitation by anti-dominant negative mouse RNase L antibody Q3U5R4 MOUSE 42.024 Beta-Actin [MSE4, Fig. 2(a)]

(MSDB acc. no.)

Mol. wt. (kDa)

81

Troponin I [MSE5, Fig. 2(a)]

TNNI3 MOUSE

24.358

61

Fibronectin precursor [MSE1 and 2, Fig. 2(a)]

S14428

275.990

113

Highly conserved cytoskeletal protein involved in various types of cell motility and are ubiquitously expressed in all eukaryotic cells Inhibitory subunit of troponin, the thin cytoskeletal filament regulatory complex, which confers calcium-sensitivity to striated muscle actomyosin ATPase activity Binds cell surface proteins and various compounds including collagen, fibrin, heparin, DNA, and actin, involved in cell adhesion, cell motility, opsonization, wound healing and maintenance of cell shape

GST-pulldown of recombinant dominant negative mouse RNase L Myosin heavy chain 9, (non Q3UHU4 MOUSE 226.232 muscle)-Mouse [LMP2, Fig. 2(b)] Q6P6L5 MOUSE Putative uncharacterized 126.195 protein RIKEN cDNA 8030451F13, isoform CRA d (Myosin binding protein C) [LMP2, Fig. 2(b)] Q3TZ32 MOUSE 106.793 Alanyl-tRNA synthetase [LMP3, Fig. 2(b)]

Growth-arrest specific protein 11-Mus musculus [LMP2, Fig. 2(b)] Clathrin light chain B [LMP2, Fig. 2(b)]

602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638

71

Cellular myosin is a cytoskeletal protein, plays a role in cytokinesis, cell shape, and specialized functions such as secretion and capping

50

Homolog of myosin binding protein C, a cytoskeletal protein involved in muscle contraction

44

Translational assembly protein involved in alanyl-tRNA aminoacylation, endoplasmic reticulum unfolded protein response (UPR), protein folding, tRNA modification and response to amino acid stimulus Involved in apoptosis and sperm motility

Q49MD7 MOUSE

56.229

50

(Q3TJ95 MOUSE)

23.116

50

its 2-5A binding site inaccessible but no interacting cytoskeletal protein was shown. The cytoskeletal RNase L was released from the cytoskeleton after treatment of the cells with 12-0tetradecanoylphorbol-13-acetate (TPA) and the mechanism for this was suggested to be phosphorylation of RNase L by protein kinase C (PKC), however, it was not proved [39]. The cytoplasmic localization of RNase L by immunofluorescence revealing fibrous-like structures indicating its possible association to the polyribosomes and also with cytoskeletal structures was shown in the NIH3T3 cells by a polyclonal antibody raised against mouse RNase L [22]. Our results clearly demonstrate that RNase L is a strong interactor of the cytoskeletal proteins. Fibronectin, an extracellular matrix (ECM) protein promotes hepatocyte attachment and spreading correlated with certain loss in polyA + mRNA and specific loss of CYP2C11 (Cytochrome p450) and CuZnSOD (copper and zinc-dependent superoxide dismutase) mRNAs. A specific regulated RNase was speculated to be involved in the degradation of these mRNAs but its identity was not known [40]. The CYP2C11 and CuZnSOD are enzymes involved in the cellular oxidative stress pathways. Here, we can correlate that the ECM proteins like fibronectin interacts with RNase L and this complex may act as sensors of stress response from the external environment, which upon receiving the stress signals, transmit it to the cells and lead to loss of certain mRNAs and rearrangement of cytoskeletal proteins leading to change in the cell shape. The interaction of RNase L with the ECM, cytoskeletal and contractile proteins of the muscles may be hypothesized to correlate its importance in the etiology of chronic fatigue syndrome (CFS), a disorder characterized with debilitating fatigue in patients with a deregulation of the 2-5A/RNase L pathway involving the presence of a catalytically active truncated form of RNase L (∼37 kDa) and related to extreme muscle fatigue, membrane channelopathy, initiating intracellular hypomagnesaemia in skeletal muscles and also transient hypoglycemia [41,42]. Here, it may be noted that RNase L has been reported to play a role in the regulation of half life of mRNAs during muscle cell differentiation [43]. Similarly, RNase L has also been reported to control terminal adipocyte

Involved in intracellular protein transport and vesicle mediated transport

differentiation, lipids storage and insulin sensitivity via CHOP10 (C/EBP homologous protein 10, a dominant negative member of the CCAAT/enhancer-binding protein family) mRNA as a specific target [44]. RNase L mRNA itself is also post-transcriptionally regulated for its half-life through its long 3 -untranslated (3 -UTR) sequences [15]. The AU-rich element in RNase L mRNA has been linked to cell cycle regulation by p21/CIP1/WAF-1 and tristetraprolin [45]. RNase L is also involved in destabilization of interferon-induced mRNAs suggesting a role for the 2-5A system in attenuation of the interferon response [46]. The genetic code is faithfully maintained by the fidelity with which mRNA is decoded into proteins and it is dependent on the specific coupling of the amino acids to their specific cognate tRNAs, catalyzed by the aminoacyl-tRNA synthetases and their delivery to the ribosomes by elongation factors (EF-1␣ in eukaryotes). The eukaryotic translation elongation factor 1 alpha (eEF-1␣) has been shown to shuttle aminoacyl-tRNA (aa-tRNA) to the ribosomes as well as bind and bundle actin filaments of cells [47,48]. Our results also indicate the coelution of actin, alanyl-tRNA synthetase and RNase L together thereby, strengthening the fact that RNase L is also an intrinsic component of the cytoskeletal-translational apparatus. Ribosomal protein mRNAs have been reported to be primary targets of regulation in RNase L-induced senescence [49]. Le Roy et al. (2005) [13] have also demonstrated that RNase L-eRF3 (eukaryotic releasing factor 3) interaction can modulate translational termination by promoting ribosomal read-through of a termination codon and regulating the +1 frameshifting of the antizyme +1 mRNA in the interferon (IFN)-treated cells, which strongly supports our finding that RNase L is a part of the translational assembly. It has been reported that eEF-1␣ interacts with the 3 stem-loop region of the West Nile virus genomic RNA and also to the HIV-1 gag polyprotein probably through the RNA because the RNase disrupts the association [50] and translation in vitro and leads to release of the viral RNA from the polysomes. Thus, it will be interesting to study the role of antiviral protein, RNase L in the regulation of viral infection and takeover of the translational machinery by the virus in association with the complex of aminoacyl tRNA synthetases.


639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675

G Model

ARTICLE IN PRESS

BIOMAC 4309 1–12


9

Table 2 Details of RNase L-interacting proteins from mouse spleen identified by MALDI-TOF and LC/MS–MS with significant score, molecular weight, unique MSDB-identifiers, amino acid sequences of peptide ions matched with the database and references to corresponding figures. Protein (figure)

Technique (sample type-complex/single band)

Identification method: LC/MS–MS or MALDI/TOF

Protein identified and molecular weight (kDa)

MSDB identifier

Amino acid sequence of the peptide ions

MSE1 and MSE2 Fig. 2(a)

Immunoprecipitation (complex band (>5)

LC/MS–MS

Fibronectin precursor (275.990)

S14428

K.DLQFVEVTDVK.V K.IAWESPQGQVSR.Y R.SYTITGLQPGTDYK.I

MSE3 Fig. 2(a)

Immunoprecipitation (single band)

LC/MS–MS

Serum albumin-Oryctolagus cuniculus (70.861)

AAB58347

K.ADFTDISK.I K.ICALPSLR.D K.FLYEYSR.R K.QTALVELVK.H K.TVVGEFTALLDK.C R.RHPDYSVVLLLR.L K.AFFGHYLYEVAR.R K.VLDEFQPLVDEPK.N K.KVPQVSTPTLVEISR.S R.RPCFSALGPDETYVPK.E

MSE4 Fig. 2(a)


MALDI/TOF

Beta-Actin (42.024)

Q3U5R4 MOUSE

R.AVFPSIVGRPR.H K.IWHHTFYNELR.V R.VAPEEHPVLLTEAPLNPK.A K.SYELPDGQVITIGNER.F K.DLYANTVLSGGTTMYPGIADR.M

MSE5 Fig. 2(a)


MALDI/TOF

Troponin I (24.358)

TNN13 MOUSE

M.ADESSDAAGEPQPAPAPVR.R R.SSANYRAYATEPHAK.K K.TLMLQIAKQEMER.E R.ISADAMMQALLGTR.A R.ISADAMMQALLGTRAK.E

LMP1 Fig. 2(b)

GST-pulldown (Mouse RNase L) (complex band (5–7)

LC/MS–MS

2-5A dependent Ribonucleas-e L-Mouse (73.867)

Q8BIY0 MOUSE

R.SFDQWTSK.V R.LADFDQSIR.W R.GKTPLIAAVER.K

LMP2 Fig. 2(b)

GST-pulldown (Mouse RNase L) (Complex Band (5–7)

LC/MS–MS

2-5A dependent Ribonucleas-e L-Mouse (73.011)

Q8BIY0 MOUSE

Myosin heavy chain 9, (non-muscle) Mouse (226.232)

Q3UHU4 MOUSE

Growth-arrest specific protein 11-Mus musculus (56.229) Clathrin light chain B (23.116) Putative uncharacterized protein RIKEN cDNA 8030451F13, isoform CRA d (126.195)

Q49MD7 MOUSE

R.FLFAK.G R.VQQLIEK.G K.TALLIAVDK.G K.AVQKGDVVR.V R.NVGNESDIK.V R.LADFDQSIR.W K.HTGLVQMLLSR.E K.NGATPFIIAGIQGDVK.L R.DCGDHSNLVAFYGR.E K.IAGTSEGAVYLGIYDNR.E K.LHLHGYSHQDLQPQNILIDSK.K K.GADANACEDTWGWTPLHNAVQAGR.V K.LLLPYVANPDTDPPAGDWSPHAAR.W R.TLLNWDCENVEEITSILIQHGADVNVR.G R.TLLNWDCENVEEITSILIQHGADVNVRGER.G K.TQNDEVLLTMSPDEETKDLIHCLFSPGENVK.N R.NTNPNFVR.C K.ALELDSNLYR.I R.VISGVLQLGNIAFK.K K.ITDVITGFQACCR.G R.NTDQASMPDNTAAQK.V R.QLLQANPILEAFGNAK.T K.IAQLEEQLDNETKER.Q R.IIGLDQVAGMSETALPGAFK.T K.DFSALESQLQDTQELLQEENRQK.L R.DELDLR.R K.QAEEITKMR.N K.NKINNR.A K.NQINIR.N

2-5A-dependent ribonucleas-e-Mouse (83.223) Alanyl-tRNA synthetase (106.793)

AAG3708

LMP3 Fig. 2(b)

GST-pulldown (Mouse RNase L) (Complex Band (2–3)

LC/MS–MS

Q3TJ95 MOUSE Q6P6L5 MOUSE

Q3TZ32 MOUSE

K.GADANACEDTWGWTPLHNAVQAGR.V R.VDIVNLLLSHGADPHR.R R.VDIVNLLLSHGADPHRR.K K.NGATPFIIAGIQGDVK.L R.KHTGLVQMLLSR.E K.HTGLVQMLLSREGINIDAR.D K.EIVQLLLEK.G K.LLLPYVANPDTDPPAGDWSPHSSR.W R.LSVPEAVGPGGIQS.K.SIDTGMGLER.L

List of interacting proteins of RNase L with significant scores (above threshold) as identified by MALDI-TOF and LC/MS–MS techniques with their molecular weights, methods used for interaction studies, their unique MSDB identifiers, amino acid sequences of the peptide ions matched with the database and references to the corresponding figures.


G Model BIOMAC 4309 1–12 10


Fig. 3. (a) Gene ontology of the RNase L-interacting proteins on the basis of their molecular function and biological processes in mammalian cells. (b) Graph depicting the basic moment data of the human RNase L. The basic moment defines a parameter that measures the periodicity of basic residues in a protein and designed to detect the presence of basic faced alpha helices (BFAHs) in nucleic acid binding sites of the protein [27], www.scanmoment.org). Highest basic moment is particularly concentrated in the C-terminal region of the molecule between approximately 600 and 670 amino acid residues, which is a part of the ribonuclease domain. Length of the protein (Mouse RNase L) is 735 residues long, periodicity used is alpha helix and the window size is 18 residues. (c) A hypothetical model to explain possible roles of RNase L under normal physiological conditions and in situations of virus-infection, stress-response, carcinogens-, glutamate-toxicity and immune-dysfunction like Chronic Fatigue Syndrome (CFS). Myh-9 – Myosin heavy chain 9, a-tRNA syn – Alanyl tRNA synthetase, kmd – Kinesin motor domain containing protein, T-I – Troponin I.

676 677 678 679 680 681 682 683 684 685 686 687 688 689 690

The prokaryotic tmRNA system performs translational survelliance and ribosome-rescue in all eubacteria and some eukaryotic organelles. This survelliance mechanism does not intervene in the normal translation of the mRNA, but they come into the scene when the target ribosomes are stalled on the 3 end of a very short mRNA-extension or pause at internal codons with subsequent mRNA cleavage [51]. Does RNase L play a role in the translational surveillance mechanism owing to their property of being an inactive and regulated RNase, which can interact with cellular RNAs [as depicted by scanmoment plot in Fig. 3(b)] as well as interacting partner of alanyl-tRNA synthetase, is an important question that needs to be answered after careful analysis of the role of RNase L in the translational complex. Here, on the basis of our results and facts known from the literature, a hypothetical model for RNase L function in normal

mammalian cells as well as infected/pathological cells is proposed [Fig. 3(c)]. RNase L is a part of translational assembly as well as cytoskeletal assembly protein complexes. It may be involved in the movement of mRNAs of the translational apparatus to different spatial locations of the cells for localized protein synthesis. It may also be involved in the elongation mechanism of the nascent polypeptide chain as a sensor of translational fidelity supervising the translational proof-reading and surveillance mechanism by interacting with alanyl-tRNA synthetase. RNase L may also regulate the mRNA turnover of the cells through partially induced regulated RNase-activity. Recently, the importance of cotranslational mRNA–protein–protein complexes has been reported [52]. However, in virus-infected, neoplastic or compromised cells, the activity of RNase L may get altered. In virus-infected cells,


691 692 693 694 695 696 697 698 699 700 701 702 703 704 705



706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752

753

the unique 2-5A molecules are generated, which bind and switch the monomeric conformation of RNase L [37,53] still bound to the several proteins of translational-cytoskeletal assembly thereby, releasing it to form the dimeric conformation, then RNase L gets enzymatically activated and cleaves [37,54] both the cellular mRNA, rRNAs as well as the viral RNAs leading to cell death and apoptosis. Similarly, whenever the cells are exposed to various stressors, carcinogens and glutamate, etc., the level of RNase L is enhanced but the mechanism of action of RNase L in such a compromised situation is unknown. Probably, its RNase-activity is partially induced leading to generation of small-RNA mediating various other functions. In situations like CFS also, the 2-5OAS and RNase L activity is enhanced leading to extreme muscular fatigue, stress and preferential generation of 2-5A dimers. However, the cause of such a deregulation of RNase L function is still unknown. Thus Gene ontology analysis showed that RNase L may interact with broadly two types of cellular proteins: cytoskeletal/motor network proteins involved in cytoskeleton-integrity, cellular-scaffolding, vesicular-trafficking, intracellular protein/vesicle transport, cell death/apoptosis and translational proof-reading/editing assembly proteins. RNase L may exist in large multi-protein complexes possibly linked by disulfide-bridges with its cysteine-rich domain. In conclusion, RNase L mRNA is constitutively and differentially expressed in mouse tissues suggesting its diverse physiological functions in different tissues under normal cellular conditions as well as differential regulation of the expression. High expression of RNase L mRNA in the spleen, thymus and lungs suggests its primary function in the immune system. Protein–protein interactions of RNase L shows that RNase L is an integral part of large cellular multiprotein complexes possibly linked by disulphide bridges, which partly unfold function of its cysteine-rich domain. Eight RNase Linteracting proteins from mouse spleen are broadly of two types, based on their functions, the proteins of the cytoskeletal and motor network, which help in maintaining the cytoskeleton integrity, cellular scaffolding and vesicular trafficking as well as the proteins of the translational proof-reading and editing assembly involved in translational surveillance. Our results suggest that RNase L is a unique and chimeric protein, which can bind to mRNA/tRNA/rRNA on one hand with the help of its RNA binding domain and to proteins of the cytoskeletal and translational machinery as well as the 2-5A cofactor on the other hand by its ankyrin repeats and the cysteine-rich domain. The cellular functions of RNase L may be at the interface of mRNA/tRNA/rRNA as well as the interacting proteins of the cytoskeletal assembly and translational control. RNase L may be involved in physiological or housekeeping functions in normal mammalian cells and tissues. Acknowledgements

764

We thank Prof. R. H. Silverman, Cleveland Clinic Foundation, OH, U.S.A. for generously providing the pZC-5 human RNase L and pZB-1 partial mouse RNase L cDNA plasmids [24]. Research grant/facility to P.C.R. and S.L.S. under the University of Potential for Excellence (UPOE), Capacity Buildup, UGC-RNRC, DST-FIST/PURSE programs of the Govt. of India are gratefully acknowledged. A.G. received a Junior/Senior Research Fellowship from the Council of Scientific and Industrial Research (C.S.I.R.), Govt. of India. Dr. Jugendra Singh of the Proteomic Facility of the School of Life Sciences, Jawaharlal Nehru University is acknowledged for the help in the mass spectrometric analysis.

765

References

754 755 756 757 758 759 760 761 762 763

766 767

[1] C. Bisbal, R.H. Silverman, Biochimie 89 (2007) 789–798. [2] R.H. Silverman, Biochemistry 42 (2003) 1805–1812.

11

[3] Y. Xiang, Z. Wang, J. Murakami, S. Plummer, E.A. Klein, J.D. Carpten, J.M. Trent, W.B. Isaacs, G. Casey, R.H. Silverman, Cancer Res. 63 (2003) 6795–6801. [4] B.E. Madsen, E.M. Ramos, M. Boulard, K. Duda, J. Overgaard, M. Nordsmark, C. Wiuf, L.L. Hansen, PLoS One 3 (2008) e2492. [5] H. Yin, A. Zhou, Y. Dai, Lung Cancer 78 (2012) 30–38. [6] M. Frémont, K. El Bakkouri, F. Vaeyens, C.V. Herst, K. De Meirleir, P. Englebienne, Exp. Mol. Pathol. 78 (2005) 239–246. [7] W. Liu, S.L. Liang, H. Liu, R. Silverman, A. Zhou, Eur. J. Cancer 43 (2007) 202–209. [8] X.L. Li, H.J. Ezelle, T.J. Kang, L. Zhang, K.A. Shirey, J. Harro, J.D. Hasday, S.K. Mohapatra, O.R. Crasta, S.N. Vogel, A.S. Cross, B.A. Hassel, Proc. Natl. Acad. Sci. U.S.A. 105 (2008) 20816–20821. [9] M. Pandey, P.C. Rath, Biochem. Biophys. Res. Commun. 317 (2004) 586–597. [10] M. Pandey, G.D. Bajaj, P.C. Rath, RNA Biol. 1 (2004) 21–27. [11] K. Malathi, B. Dong, M. Gale Jr., R.H. Silverman, Nature 448 (2007) 816–819. [12] F. Le Roy, A. Laskowska, M. Silhol, T. Salehzada, C. Bisbal, J. Interferon Cytokine Res. 20 (2000) 635–644. [13] F. Le Roy, T. Salehzada, C. Bisbal, J.P. Dougherty, S.W. Peltz, Nat. Struct. Mol. Biol. 12 (2005) 505–512. [14] F. Le Roy, M. Silhol, T. Salehzada, C. Bisbal, Cell Death Differ. 14 (2007) 1406–1413. [15] J.B. Andersen, X.L. Li, C.S. Judge, A. Zhou, B.K. Jha, S. Shelby, L. Zhou, R.H. Silverman, B.A. Hassel, Oncogene 26 (2007) 3081–3088. [16] L.K. Mosavi, T.J. Cammett, D.C. Desrosiers, Z.Y. Peng, Protein Sci. 13 (2004) 1435–1448. [17] C. Bisbal, C. Martinand, M. Silhol, B. Lebleu, T. Salehzada, J. Biol. Chem. 270 (1995) 13308–13317. [18] D.J. Bettoun, A. Scafonas, S.J. Rutledge, P. Hodor, O. Chen, C. Gambone, R. Vogel, S. McElwee-Witmer, C. Bai, L. Freedman, A. Schmidt, J. Biol. Chem. 280 (2005) 38898–38901. [19] N. Tanaka, M. Nakanishi, Y. Kusakabe, Y. Goto, Y. Kitade, K.T. Nakamura, EMBO J. 23 (2004) 3929–3938. [20] L. Wang, A. Zhou, S. Vasavada, B. Dong, H. Nie, J.M. Church, B.R. Williams, S. Banerjee, R.H. Silverman, Clin. Cancer Res. 1 (1995) 1421–1428. [21] C. Sugiyama, N. Kuramoto, R. Nagashima, M. Yoneyama, K. Ogita, Neurochem. Intl. 53 (2008) 71–78. [22] T. Salehzada, M. Silhol, B. Lebleu, C. Bisbal, J. Biol. Chem. 266 (1991) 5808–5813. [23] A. Zhou, J. Paranjape, T.L. Brown, H. Nie, S. Naik, B. Dong, A. Chang, B. Trapp, R. Fairchild, C. Colmenares, R.H. Silverman, EMBO J. 16 (1997) 6355–6363. [24] A. Zhou, B.A. Hassel, R.H. Silverman, Cell 72 (1993) 753–765. [25] J. Sambrook, D.W. Russell, Molecular, Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001. [26] A. Gupta, P.C. Rath, J. Biosci. 37 (2012) 103–113. [27] S.E. Massey, Bioinformation 3 (2009) 293–295. [28] C. Bisbal, T. Salehzada, Med. Sci. (Paris) 24 (2008) 859–864 (Article in French). [29] C. Bisbal, Med. Sci. (Paris) 24 (2008) 23–25 (Article in French). [30] H.J. Ezella, B.A. Hassel, Front Biosci. (Schol Ed) 4 (2012) 767–786. [31] A. Chakrabarty, P.K. Ghosh, S. Banerjee, C. Gaughan, R.H. Silverman, J. Virol. 86 (2012) 11311–11321. [32] G. Floyd-Smith, J.S. Denton, Proc. Soc. Exp. Biol. Med. 189 (1988) 329–337. [33] E. Slattery, N. Ghosh, H. Samanta, P. Lengyel, Proc. Natl. Acad. Sci. U.S.A. 76 (1979) 4778–4782. [34] C. DeFranco, M.E. Chicurel, H. Potter, Mol. Biol. Cell. 9 (1998) 1695–1708. [35] B. Alberts, A. Johnson, J. Lewis, M. Raff, K. Roberts, P. Walter, Molecular Biology of the Cell, 5th ed, Garland Science, Taylor and Francis group, LCC, Q2 2008. [36] F. Marks, U. Klingmüller, K. Müller-Decker, Cellular Signal Processing, Garland science, Taylor and Francis group, LLC, 2009. [37] Y. Han, J. Donovan, S. Rath, G. Whitney, A. Chitrakar, A. Korennykh, Science 343 (2014) 1244–1248. [38] S. Roelens, C. Vincent Herst, A. D‘Haese, K. De Smet, M. Fremont, K. De Meirleir, P. Englebienne, J. Chronic Fatigue Syndr. 8 (2001) 63–82. [39] M. Tnani, S. Aliau, B. Bayard, J. Interferon Cytokine Res. 18 (1998) 361–368. [40] N.K. Conrad, S.M. Wilson, E.J. Steinmetz, M. Patturajan, D.A. Brow, M.S. Swanson, J.L. Corden, Genetics 154 (2000) 557–571. [41] P. Englebienne, J. Chronic Fatigue Syndr. 11 (2003) 97–109. [42] J. Nijs, K. De Meirleir, M. Meeus, N.R. McGregor, P. Englebienne, Med. Hypotheses 62 (2004) 759–765. [43] T. Salehzada, L. Cambier, N. Vu Thi, L. Manchon, L. Regnier, C. Bisbal, L. Endoribonuclease, PLoS One 4 (2009) e7563. [44] O. Fabre, T. Salehzada, K. Lambert, Y. Boo Seok, A. Zhao, J. Mercier, C. Bisbal, Cell Death Differ. 19 (2012) 1470–1481. [45] L. Al-Haj, P.J. Blackshear, K.S. Khabar, Nucleic Acids Res. 40 (2012) 7739–7752. [46] X.L. Li, J.A. Blackford, C.S. Judge, M. Liu, W. Xiao, D.V. Kalvakolanu, B.A. Hassel, J. Biol. Chem. 275 (2000) 8880–8888. [47] G. Liu, J. Tang, B.T. Edmonds, J. Murray, S. Levin, J. Condeelis, J. Cell Biol. 135 (1996) 953–963.


768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853

G Model BIOMAC 4309 1–12 12 854 855 856 857 858


[48] Y.R. Pittman, K. Kandl, M. Lewis, L. Valente, T.G. Linzy, J. Biol. Chem. 284 (2009) 4739–4747. [49] J.B. Andersen, K. Mazan-Mamczarz, M. Zhan, M. Gorospe, B.A. Hassel, RNA Biol. 6 (2009) 305–315. [50] A. Cimarelli, J. Luban, J. Virol. 73 (1999) 5388–5401. [51] S.D. Moore, R.T. Sauer, Annu. Rev. Biochem. 76 (2007) 101–124.

[52] C.D.S. Duncan, J. Mata, Wide spread cotranslational formation of protein complexes, PLoS Genet. 7 (12) (2011) e1002398, http://dx.doi.org/10.1371/ journal.pgen.1002398. [53] M. Nakanishi, Y. Goto, Y. Kitade, Proteins 60 (2005) 131–138. [54] M. Nakanishi, A. Yoshimura, N. Ishida, Y. Ueno, Y. Kitade, Eur. J. Biochem. 271 (2004) 2737–2744.


859 860 861 862 863 864

Characterization of Echinostoma cinetorchis endoribonuclease, RNase H.

Differential expression of the mouse mitochondrial genes and the mitochondrial RNA-processing endoribonuclease RNA by androgens.

Interaction of Bacillus subtilis Polynucleotide Phosphorylase and RNase Y: STRUCTURAL MAPPING AND EFFECT ON mRNA TURNOVER.

RNase I*, a form of RNase I, and mRNA degradation in Escherichia coli.

Unequal accumulation of alpha- and beta-globin mRNA in erythropoietic mouse spleen.

Transition State Charge Stabilization and Acid-Base Catalysis of mRNA Cleavage by the Endoribonuclease RelE.

Gamma-Tocotrienol Modulates Radiation-Induced MicroRNA Expression in Mouse Spleen.

Correlated miR-mRNA expression signatures of mouse hematopoietic stem and progenitor cell subsets predict "Stemness" and "Myeloid" interaction networks.

Swine Dialyzable Spleen Extract as Antiviral Prophylaxis.

RNase E-dependent cleavages in the 5' and 3' regions of the Escherichia coli unc mRNA.

Human RNase L tunes gene expression by selectively destabilizing the microRNA-regulated transcriptome.

The Staphylococcus aureus protein-coding gene gdpS modulates sarS expression via mRNA-mRNA interaction.

Sex differences in spatiotemporal expression of AR, ERα, and ERβ mRNA in the perinatal mouse brain.

Targeted cleavage of mRNA by human RNase P.

RNase III controls mltD mRNA degradation in Escherichia coli.

Regulation of beta-endorphin receptor expression in mouse spleen cells with Con A and rIL-2.

mRNA quantitation by a simple and sensitive RNAse protection assay.

RNase III cleavages in non-coding leaders of Escherichia coli transcripts control mRNA stability and genetic expression.

Activation of RNase L is dependent on OAS3 expression during infection with diverse human viruses.

Aging alters hepatic expression of insulin receptor and c-jun mRNA in the mouse.

Response of pituitary and spleen pro-opiomelanocortin mRNA, and spleen and thymus interleukin-1 beta mRNA to adjuvant arthritis in the rat.

Expression of the mRNA for the ligand of c-kit in mouse Sertoli cells.

Regression of solid tumors by induction of MazF, a bacterial mRNA endoribonuclease.

Innate cytotoxicity of CBA mouse spleen cells to Sendai virus-infected L cells.