Expression of the oxytocin and vasopressin genes in human and baboon gonadal tissues.

0013-7227/90/1276-2990$02.00/0 Endocrinology Copyright © 1990 by The Endocrine Society

Vol. 127, No. 6 Printed in U.S.A.

Expression of the Oxytocin and Vasopressin Genes in Human and Baboon Gonadal Tissues* RICHARD IVELL, KENICHI FURUYA, BEATE BRACKMANN, YUSOFF DAWOOD, AND FIRYAL KHAN-DAWOOD Institute for Hormone and Fertility Research (R.I., K.F., B.B.), Grandweg 64, 2000 Hamburg 54, Germany; the Department of Obstetrics and Gynecology, National Defense Medical University (K.F.), Saitama, Japan; and the Department of Obstetrics, Gynecology, and Reproductive Sciences, University of Texas Medical School (Y.D., F.K.-D.J, Houston, Texas 77030

ABSTRACT. A variety of molecular techniques were used to search human and baboon gonadal tissues for evidence of transcription of the genes for the peptide hormones oxytocin and vasopressin. Only a highly sensitive assay based on a modification of the polymerase chain reaction succeeded in detecting mRNA copies of the oxytocin gene in both human and baboon corpus luteum. Vasopressin gene transcription was not detected in human testis and corpus luteum and was found only once in four different experiments in baboon corpus luteum. Evidence

for oxytocin gene transcription in the human testis was found in three of five experiments. The method employed and subsequent sequence analysis of the polymerase products verified the presence of oxytocin mRNA with normal hypothalamic-type exonic structure in primate corpus luteum. Nevertheless, the very low levels of mRNA present are unlikely to support other than local functions for the encoded nonapeptide hormones. {Endocrinology 127: 2990-2996, 1990)

T

HE CLASSIC sites of synthesis for the neurohypophyseal peptide hormones vasopressin and oxytocin are the magnocellular nuclei of the hypothalamus. From here the newly synthesized precursor polyproteins are intraaxonally transported to the nerve endings of the posterior pituitary, where the processed hormones are stored until released into the bloodstream upon appropriate specific stimulation. This pituitary source is responsible for the antidiuretic and pressor endocrine activities of vasopressin or smooth muscle contraction in reproductive tissues for oxytocin. This classic endocrine system has had to be recently revised to take account of the finding of both hormones in peripheral tissues, particularly the gonads, in several mammalian species, including primates (1-8). However, to understand how such a complex system functions and is regulated, it is important to know whether the hormones are actually synthesized in these peripheral tissues; that is, whether the nonapeptides are functioning as local paracrine or autocrine regulators. Evidence for local synthesis of vasopressin or oxytocin in the gonads has only been convincingly demonstrated Received July 5, 1990. Address all correspondence and requests for reprints to: Dr. Richard Ivell, Institute for Hormone and Fertility Research, Grandweg 64, 2000 Hamburg 54, Germany. * This work was supported by the Deutsche Forschungsgemeinschaft (Ho-388/6-1-3).

for the ruminant corpus luteum, where oxytocin biosynthesis has been proven by in vitro radiolabeling of newly synthesized peptide and its precursor (9), by Northern hybridization and cDNA analysis (10), and by net synthesis of peptide from primary cell cultures (11, 12). In primates, particularly in the human, there are several reports of oxytocin in ovarian or luteal extracts or detectable in this tissue immunohistochemically (2, 3, 6, 8, 13, 14). Khan-Dawood and co-workers have provided strong evidence for local synthesis by demonstrating net influx of oxytocin into the ovarian vein draining a corpus luteum compared with that in femoral vein blood or blood from the contralateral ovarian vein (3, 15). Additionally, they have demonstrated immunohistochemically the presence not only of oxytocin but also of neurophysin in the luteal cells of the baboon ovary (13). Since neurophysin is a component of the same precursor polyprotein as that for oxytocin, this is good evidence for local luteal synthesis of the hormone. Recently, net synthesis of oxytocin in human granulosa cell cultures has been reported (16). Vasopressin has been found in ovarian extracts (6, 8), and both hormones have been identified in extracts of human testis (4). Nevertheless, studies have also been reported in which oxytocin cannot be identified either in luteal extracts (17) or as products of granulosa cell culture (18). Although oxytocin mRNA has been detected in a dot blot

2990

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 14 November 2015. at 02:49 For personal use only. No other uses without permission. . All rights reserved.

OT AND AVP RNA IN PRIMATE GONADS assay (19), it has not been possible to identify oxytocin mRNA in human luteal tissue by Northern hybridization (17) (Ivell, R., unpublished). For vasopressin in primate gonadal tissues, data are much scarcer, being limited to immunological identification of the peptide (4). In all cases the levels of oxytocin and vasopressin in primate gonadal tissues are very low, and in many instances might be accounted for by sequestration of the hormones from the circulation. Additionally, all data to date depend upon the use of specific antibodies, often combined with HPLC. In one study using an apparently specific oxytocin antibody it was shown that the peptide recognized was not the nonapeptide hormone (20). To avoid the problems of interpretation when using antibodies, the study reported here has applied several different molecular biological techniques to identify functional transcripts of the genes for oxytocin and vasopressin in human or baboon testes and corpora lutea of the menstrual cycle. Materials and Methods Tissues and RNA extraction Human luteal tissues were obtained from premenopausal patients (aged 24-35 yr) with a history of regular menstrual cycles undergoing surgery for nonendocrine gynecological indications, as previously described (21). Luteectomy was performed on female baboons with regular menstrual cycles at defined stages of the luteal phase, as described elsewhere (14). Human testicular tissue was obtained from elderly men with prostate carcinoma undergoing orchiectomy; histological analysis indicated normal spermatogenesis in all testes. For human tissues, the ethical requirements of the Helsinki declaration were observed in all cases. The baboon study was approved by the Institutional Review Board for Animal Experimentation. Total RNA was extracted from individual tissues in a guanidinium isothiocyanate buffer and isolated by ultracentrifugation through a cesium chloride cushion, as previously described (21). Total RNA from grouped tissues was pooled before enrichment for poly(A)-containing transcripts by oligo(dT)-cellulose chromatography. Human corpora lutea were pooled as follows: pool A, early corpora lutea from days 15-20 (five samples); pool B, midphase corpora lutea from days 21-25 (three samples); pool C, late corpora lutea from days 26-30 (four samples); and pool D, five corpora lutea all from day 20. All baboon corpora lutea, collected at equally spaced intervals throughout the cycle, were combined in one pool. Human testes were processed individually.

2991

duplicate replica plaque lifts on nitrocellulose membranes. As probes, the gene-specific 3' portions of the cDNA molecules coding for vasopressin and oxytocin were used (23); these are equivalent to the third exons of the respective genes (23). For hybridization, the probes were labeled by nick-translation with [32P]dCTP at a specific activity of more than 108 cpm/Vg and a concentration of about 106 cpm/ml in the final hybridization solution. Prehybridization and hybridization were performed in 4 x SSPE (1 X SSPE is 180 mM NaCl, 10 mM sodium phosphate, and 1 mM EDTA, pH 7.0)-0.1% sodium dodecyl sulfate (SDS)- 1 X Denhardt's-50 Mg/ml denatured herring sperm DNA-50 fig/m\ polyadenylate for 4 and 16 h, respectively, both at 65 C. The filters were afterward washed twice in 2 x SSC (1 x SSC is 150 mM NaCl and 15 mM sodium citrate, pH 7.0)-0.1% SDS and twice in 1 x SSC-0.1% SDS, all at 65 C, before air drying and exposure to x-ray film (Kodak X-Omat R, Eastman Kodak, Rochester, NY) film, with intensifying screens, for up to 3 days. As a positive control the same filters were subsequently rehybridized using oligonucleotide probes specific for human inhibin-a and inhibin-0 genes when specific clones were identified at a frequency consistent with previous estimates (24) and the complexity data provided by the supplier of the cDNA library (Brackman, B., and R. Ivell, unpublished). Northern hybridization Five micrograms of the respective poly (A)-enriched RNAs were glyoxylated after denaturation in dimethylsulfoxide (21) and electrophoresed on 1.2% horizontal agarose gels in 10 mM morpholinopropanesulfonic acid-2.5 mM sodium acetate-0.25 mM EDTA, pH 7.0. After electrophoresis, gels were vacuumblotted onto Hybond-N (Amersham-Buchler, Braunschweig, Germany) and prehybridized at 60 C overnight in the solution described above for the bacteriophage plaque screening. Hybridization was performed at 60 C for 40 h in the same solution containing, in a 10-ml volume, 107 cpm/ml 32P-labeled probes (SA, >5 x 108 cpm//ig). As probes, either the nick-translated 3' gene-specific fragments of the respective human cDNAs were used (19), as described above, or the equivalent exon 3encoding regions of the human vasopressin and oxytocin genes (courtesy of Dr. J. Battey, NIH, Bethesda, MD) (25), which were labeled by random primer extension (26). Nylon membranes were washed as for the bacteriophage screening describe above and exposed to film with an intensifying screen for up to 7 days. The same hybridization protocol, using equivalent probes specific for the rat vasopressin gene, yielded good specific signals in the rat adrenal gland and testis within 2 days of autoradiographic exposure (Ivell, R., unpublished). Polymerase chain reaction (PCR) assay for mRNA

Screening a human testicular cDNA library in \gtll A human testicular cDNA library in the bacteriophage Xgtll (Clontech, Davis, CA) with a complexity of 2 X 106 individual clones was plated out using E. coli Y1090 as host by standard procedures (22). Altogether 1 million bacteriophage were seeded on 150-mm diameter plates at a density of 50,000 plaqueforming units/plate and screened by in situ hybridization of

A two-step PCR assay was employed, first converting the RNA into single stranded cDNA (ss-cDNA) before performing the primer-specific amplification. Two micrograms of poly(A)enriched RNA were diluted with sterile water to a total volume of 8 fd, denatured by heating to 65 C for 5 min, and shockcooled on ice. The following components were then added in order to give a total reaction volume of 20 nh 2 /xl 10 X RT


2992

OT AND AVP RNA IN PRIMATE GONADS

buffer (500 mM Tris-HCl, pH 8.5-500 mM KC1-100 mM MgCl2100 Mg/ml BSA-10 mM EDTA-10 mM dithiothreitol), 1 nl 40mM sodium pyrophosphate, 2 /A oligo(dT) at 100 ng/jul, 3 ix\ RTdNTP mix (10 mM each of dATP, dTTP, dGTP, and dCTP), 1 /A placental RNase inhibitor (Amersham-Biichler; 25 U/jiil), 2 n\ AMV reverse transcriptase (Boehringer Mannheim, Mannheim, Germany; 10 U/^l). Incubation was carried out for 2 h at 42 C. The reaction mixture was supplemented with 30 /A TE (10 mM Tris-HCl, pH 8.0-0.1 mM EDTA) and 50 Ml 0.3 N NaOH-30 mM EDTA and heated for 5 min at 100 C to digest the RNA. The solution was then neutralized by the addition of 10 ^1 1 M Tris-HCl, pH 8.0, and extracted once with phenol, once with 1:1 phenol-chloroform, and once with chloroformisoamylalcohol (25:1). The DNA in the aqueous supernatant was supplemented with 5 ng E. coli tRNA and 110 /ul 5 M ammonium acetate and precipitated by the addition of 3 vol cold (-20 C) 96% ethanol, with immediate mixing and centrifugation in a microfuge (14,000 rpm; 20 min; 4 C). The resulting nucleic acid pellet was washed once with 70% ethanol, dried, and taken up in 100 /A TE. Yields of ss-cDNA were periodically checked by the addition of radioactive nucleotides to be 8001000 ng/reaction. PCR assays were performed in a total of 100 /d. To 20 /xl sscDNA, prepared as described above, were added 47 fA water, 10 id 10 x PCR buffer (100 mM Tris-HCl, pH 8.3-500 mM KC120 mM MgCla-0.1% gelatin), 16 fd PCR-dNTP mix (1.25 mM each of dATP, dTTP, dGTP, and dCTP), 2 fd 5' primer (100 ng/fd), and 2 ix\ 3' primer (100 ng/jiil). This mixture was heated to 96 C for 5 min, cooled to 72 C, and held at this temperature until the addition of 0.5 fil Taq polymerase (Beckman, Munich, Germany; 5 U//xl) and 50 ixl mineral oil to prevent evaporation during subsequent amplification cycles. These and all subsequent steps were performed using a programmable heating block (Hybaid, Teddington, England). After the addition of enzyme, the reaction mixure was cooled to 50 C for 2 min to anneal the primers, then heated to 72 C for 15 min for the first polymerase step. Subsequently, the reaction was incubated for 30 cycles of, successively, 96, 50, and 72 C each for 2 min, before a final elongation step of 15 min at 72 C, followed by cooling to room temperature. The high denaturation temperature of 96 C was determined by experimentation and is probably necessary due to the relatively high GC ratio (guanidine + cytidine : adenosine + thymidine) of the amplified fragments. The oligonucleotide primers used were synthesized using phosphoamidite chemistry on a Biosearch Cyclone (Milligen, Novato, CA) DNA synthesizer and had the following sequences: for oxytocin, (OT-5')-ACCTCCGCCTGCTACATCCAGAACT, (OT-3')-CTTCCGCGTCGCAGGCAGGGTCGACGTG; for vasopressin, (VP-5')-CACCTCCGCTTGCTACTTCCAGAACTGCCC, (VP-3')-CACTCGGGCTCGGTCACGCAGCTCTC. These are equivalent to nucleotides 466-490 (OT-5') and 1129-1156 (OT-3') of the human oxytocin gene, or 272301 (VP-3') and 2087-2111 plus nucleotide 1919 of the preceding exon (VP-3') of the human vasopressin gene (25). Primer OT-3' included a single base mutation at nucleotide 24 to introduce a restriction site. Primer VP-5' was derived from the rat vasopressin cDNA sequence and included two base differences compared with the published human cDNA and gene sequences. After removal of the mineral oil by extraction with chloro-

Endo • 1990 Vol 127 • No 6

form, 25-/il aliquots of the PCR reactions were electrophoresed on 1.5% agarose gels in 0.5 x TBE buffer (1 x TBE is 89 mM Tris-borate-2.5 mM EDTA, pH 8.0), and the synthesized DNA was transferred to nylon membranes by vacuum-blotting, as described above. To avoid possible carryover of DNA between gel slots and, hence, false positive results, blank slots were left between each sample loaded. The nylon membranes were then prehybridized, hybridized, and washed as described for the bacteriophage plaque screening (see above), using as probe a 57-basepair (bp) Ball-Aval restriction fragment from exon 2 of the rat oxytocin gene (nucleotides 744-800) (18a), which is highly conserved between species and completely homologous with the equivalent region of the vasopressin gene (19). This restriction fragment had been subcloned into plasmid pUC9 and, for hybridization purposes, excised as an approximately 400-bp fragment using the Pvull sites in the flanking regions of the plasmid (Fig. 1). This fragment was then labeled with 32 P by nick-translation. Control experiments showed no hybridization to PCR products when using a Pvull fragment of pUC9 lacking the 57-bp insert (not shown), although crosshybridization to the unlabeled Haelll digest of bacteriophage Phi-X 174 (Gibco-BRL, Eggenstein, Germany) used as markers proved convenient (Fig. 2). The hybridized nylon membranes were air dried and exposed to film for between 3-16 h. PCR analysis was performed on a minimum of three independent ss-cDNA preparations for each tissue. Since some results were not consistent in spite of adequate controls, which rule out occasional contamination, it must be concluded that template molecules in these cases were very rare, and a positive result depended on stochastic probability. Results from these analyses are presented also in tabular form to illustrate this effect. Subcloning and sequence analysis of PCR fragments Although hybridization of the PCR products to internal homologous sequences provides good evidence of product identity, to eliminate any possibility of artefact, the PCR fragments that resulted from baboon and human luteal samples and which were visible as ethidium bromide-stainable bands in the agarose electrophoresis, were excised from the gels, electroeluted, ligated into Smal-cut pBS (Bluescribe) plasmid (Stratagene, La Jolla, CA), and transformed into E. coli XLl-Blue (Stratagene), using standard protocols (27). The subcloned DNA was then sequenced by the enzymatic method, using T7 polymerase (Sequenase, U.S. Biochemical Corp., Cleveland, OH) and double stranded templates (28).

Results cDNA library screening and Northern hybridization analysis Both procedures failed to provide any positive signals. The use of the same human testicular cDNA library to identify clones positive for the a- and /?B-inhibin genes (30 and 7 clones/million screened, respectively) (Brackman, B., and R. Ivell, unpublished) indicated that it should have been possible to identify transcripts expressed with a frequency of 1:100,000 or higher. The


OT AND AVP RNA IN PRIMATE GONADS intron 1

SP

FIG. 1. Scheme to indicate the principal features of the PCR assay used to detect vasopressin and oxytocin mRNAs. Peptides encoded in the mRNA (ss-cDNA) molecules: SP, signal peptide; OT, oxytocin; VP, vasopressin; NP I, oxytocinassociated neurophysin; NP II, vasopressin-associated neurophysin; GP, C-terminal glycopeptide. 5' and 3' represent the oligonucleotides used as primers for the Taq polymerase reaction shown for the oxytocin ss-cDNA (upper structure) and vasopressin ss-cDNA [lower structure). For details, see text.

|OT|1

2993

intron 2 I poly (A)

NPI

•QD etc SP

|VP

NPII

GP

-poly (A)

etc

A. FIG. 2. Autoradiograms of the radioactively probed PCR products derived from human and baboon testis and corpus luteum, corresponding to oxytocin (A) and vasopressin (B) mRNAs. hCL-A to hCLD, Samples derived from pooled human luteal RNA; bCL, from pooled baboon luteal RNA; bHypoth, from RNA from a single baboon hypothalamus; hTestis, from RNA from a single human testis. M, DNA size markers, sizes in basepairs are indicated in B. The correctly sized PCR products are indicated by the size in basepairs given at the left of each panel. The very faint bands visible in lanes 1 and 3 of B have the incorrect size and are, therefore, unspecific, as are the secondary bands visible on longer exposure in A, lanes 9-11. A, lanes 1-8, and B were exposed to autoradiographic film for 3 h; A, lanes 9-11, were from a separate experiment and exposed to film overnight.

—310

310—

B.

-310 -271/281 -234 "194

300 —

rarer j8B-inhibin transcript was also detectable in Northern hybridization of human testicular RNA, as was vasopressin mRNA in rat testis samples (Ivell, R., unpublished); four cDNA clones for the latter were recently isolated from a rat testicular cDNA library of comparable size and complexity to that used here (Ivell, R., and D. Nollmeyer, unpublished). In control experiments using serial dilutions of in vitro transcribed oxytocin cRNA, the detection limit of Northern hybridization using the present protocol was approximately 1-10 pg specific

cRNA (not shown). Taken together these results indicate that mRNA for oxytocin and vasopressin in the human testis as well as in primate luteal tissues is below the level of detection for these methods, which represents a specific mRNA frequency of about 1:100,000 to 1:1,000,000. PCR analysis The PCR system adopted (Fig. 1) relies on a combination of four independent specificity tests: the sequence



2994

of the 5' primer, the sequence of the 3' primer, the size of the amplification product, and hybridization to an internal specific sequence. A specific autoradiographic signal of the correct size is only obtained when all four criteria are met. Figure 2A indicates positive signals for oxytocin transcripts in both baboon (lane 3) and human (lanes 1 and 7) luteal RNA as well as in baboon hypothalamus (lane 4), which was used as a positive control. On longer exposure to film, a weak positive signal is also detectable in the midphase (lane 10), but not the late phase (lane 9), human luteal RNA pools. Human testicular RNA was negative in the illustrated experiment (lane 2), even after long autoradiographic exposure. However, in independent assays human testicular RNA was weakly positive three of five times (Table 1). Figure 2B shows the results of using vasopressin genespecific primers. Only the baboon hypothalamus (lane 4), as expected, indicates a positive signal, even after prolonged exposure to film, although in an independent experiment a positive signal for a vasopressin transcript was observed once for baboon corpus luteum in a total of four separate experiments (Table 1). As a further control for the quality of the cDNA templates used, in particular of the testis sample, which was negative in both assay systems described above, a similar PCR reaction was performed with this ss-cDNA sample, using primers for the recently cloned LH receptor (29). A correctly sized and subsequently sequenced positive band was evident for the human testis sample only (Hunt, N., and R. Ivell, unpublished). Sequence analysis of the PCR products The oxytocin gene-specific PCR products derived from human and baboon corpora lutea were subcloned into plasmids and sequenced. The results (Fig. 3) confirm absolutely the specificity of the PCR system used. The human fragment is 100% homologous with the reported cDNA sequence (19), except for a nucleotide T/C substiTABLE 1. Frequency of positive PCR results for oxytocin and vasopressin gene transcripts in primate gonadal tissues

0

Tissue source

PCR probe

Total no. of experiments

No. positive

Early human CL Early human CL Late human CL° Late human CL° Baboon CL Baboon CL Human testis Human testis

Oxytocin Vasopressin Oxytocin Vasopressin Oxytocin Vasopressin Oxytocin Vasopressin

7 7 4 4 4 4 5 3

6 0 2 0 3 1 3 0

CL, Corpora lutea. This category includes human corpora lutea from mid- to late cycle (i.e. after day 20). The two positive signals were both from midphase corpora lutea.

Endo• 1990 Vol 127* No 6

tution at position 284, which may be due to a PCRdependent mutation. The extra codon reported for the hypothalamic cDNA sequence (19), compared with the published gene sequence (25), is also present. The baboon fragment indicates a very high degree of homology to the human sequence (~95%), with all but one substitution being conservative. A phenylalanine replaces a leucine at codon 254-257. Latest estimates put the mutation rate induced by the PCR method at 1:1000 or better (30). It cannot, therefore, be excluded that one or more base differences between the baboon and human sequences are attributable to artefactual mutation. Discussion The results indicate that of the neurohypophyseal peptides described from the testis and corpus luteum of primates, only oxytocin seems to be locally synthesized, and then consistently only in the corpus luteum of both baboons and women. The negative or inconsistent results for vasopressin in both male and female tissues as well as for oxytocin in the testis indicate, however, only that the gene transcripts are below the levels of reliable detection by both Northern hybridization and the PCR analysis system used here. It is also possible that the testicular samples from elderly men are not representative. Nevertheless, it is estimated that the PCR methodology is sufficiently sensitive to detect less than one mRNA molecule per cell, amplifying such transcripts up to 107 times. Therefore, if genes are transcribed at levels below the detection limit for PCR analysis, one is forced to question the biological relevance of such transcription even in the context of paracrine or autocrine function. Even if positive, DNA-RNA hybridization assays may be erroneous due to the presence in vivo of defective gene transcripts, which are unable to produce a functional hormone. For vasopressin transcripts in the bovine corpus luteum (31) and rat testis (Ivell, R., unpublished), RNA molecules of approximately normal size are detectable, but these lack the hormone-encoding exon 1 sequence. Instead, noncoding sequence is appended at the 5' end of exon 2. To assure detection of transcripts with functional exonic composition, the PCR assay employed a 5' primer derived from the hormone-encoding region of exon 1, together with a 3' primer from exon 3, finally using hybridization detection with a probe derived from exon 2. Thus, only when all three exons of the known oxytocin or vasopressin genes are represented in the transcripts is the PCR product amplified and detected. These results imply local synthesis of oxytocin in the primate corpus luteum and, therefore, support the finding of this nonapeptide in luteal extracts or in fluids derived from ovarian tissues or cells. In view of the quantitative variability of results obtained using differ-



2995

SEQUENCE ANALYSIS OF HUMAN AND BABOON LUTEAL PCR PRODUCTS Human C P L G G K R A A P ACCTCCGCCTGCTACATCCAGAACTSCCCCCTGGGhGGCKAGKGGGCCGCGCCG 54 ACCTCCGCCTGCTACATCCAGAACTGCCCCCTGGGkGGCAAGAGGGCCGCGCCG 5 4 Baboon C P L G G K R A A P

D L D V R K C L P C G P G G K G R C GACCTCGACGTGCGCAAGTGCCTCCCCTGCGGCCCCGGGGGCAAAGGCCGCTGC 108 GACCTCGACGTGCGCAAGTGCCTCCCCTGCGGCCCCGGGGGCAAAGGCCGTTGC 108 D L D V R K C L P C G P G G K G R C FIG. 3. Sequence analysis of the cloned PCR products derived from human (upper sequence) and baboon (lower sequence) luteal RNA. The 5' and 3' primer sequences used are indicated in italics. Homology in the nonprimer region is indicated by asterisks. The amino acid sequences for the encoded human and baboon neurophysins are indicated above and below the nucleotide sequences.

F G P N I C C A E E L G C F V G T A TTCGGGCCCAATATCTGCTGCGCGGAAGAGCTGGGCTGCTTCGTGGGCACCGCC 162 TTTGGGCCCAATATCTGCTGCGCGGAAGAGCTGGGCTGCTTCGTGGGCACGGCC 162 F G P N I C C A E E L G C F V G T A E A L R C Q E E N Y L P S P C Q S G GAAGCGCTGCGCTGCCAGGAGGAGAACTACCTGCCGTCGCCCTGCCAGTCCGGC 216 GAGGCGCTGCGCTGCCAGGAGGAGAACTACCTGCCGTCGCCCTGCCAGTCGGGC 216 E A L R C Q E E N Y L P S P C Q S G Q K A C G G G G R C A V L G L C C S CAGAAGGCGTGCGGGGGCGGGGGCCGCTGCGCGGTCTTGGGCCTCTGCTGCAGC 270 **************AA****C***********C * * * * * • ] • * * * * * * * * * * * T * * *

CAGAAGGCGTGCGGAAGCGGCGGCCGCTGCGCCGTCTTTGGCCTCTGCTGTAGC 270 Q K A C G S G G R C A V F G L C C S P D G C CCGGACGGCTGC CACGTCGACCCTGCCTGCGACGCGGAAG ************ CCGGACGGCTGC CACGTCGACCCTGCCTGCGACGCGGAAG P D G C

ent antibodies as well as the fact that vasopressin can be detected at the peptide level but not at the mRNA level, it is possible that a proportion of the immunologically identified nonapeptide may not be authentic hormone. Furthermore, the fact that oxytocin mRNA can only be detected by PCR analysis of poly (A)-enriched RNA suggests a very low level of the specific mRNA in the primate corpus luteum, sufficient only to supply a local intragonadal function. Although the PCR method is not quantitative, the findings are consistent with oxytocin gene transcription in the early to midluteal phase of the cycle, similar to the much more highly transcibed oxytocin gene in the ruminant corpus luteum (32). This would fit with reports of oxytocin peptide levels measured through the menstrual cycle in extracts (3, 14), in which the hormone increases to a maximum in the midluteal phase. If oxytocin is a local paracrine factor in the primate ovary, what may be its role? When oxytocin is applied to dispersed primate luteal cells, there appears to be a reduction in the hCG-stimulated production of progesterone (14, 33, 34), although in another study (35) and

310 310

in vivo this effect may be negligble (36), or oxytocin may even be stimulatory to progesterone production when infused into whole freshly excised human ovaries (37). It seems likely, therefore, that oxytocin may be playing a modulatory role on ovarian steroidogenesis, acting in concert with other local factors, although at the low level observed in vivo, the peptide may have no specific function under normal physiological conditions.

Acknowledgments Thanks are due to Prof. Freimut Leidenberger for his support and encouragement, to Drs. Craig A. McArdle and Nicholas Hunt for helpful advice, and to Ms. Doris Nollmeyer for excellent technical assistance.

References 1. Kasson BG, Meidan R, Hsueh AJW 1985 Identification and characterization of arginine vasopressin-like substances in the rat testis. J Biol Chem 260:5302-5307 2. Khan-Dawood FS, Dawood MY 1983 Human ovaries contain immunoreactive oxytocin. J Clin Endocrinol Metab 57:1129-1132 3. Khan-Dawood FS, Marut EL, Dawood MY 1984 Oxytocin in the corpus luteum of the cynomolgus monkey (Macaca fascicularis).


2996


Endocrinology 115:570-574 4. Nicholson HD, Swann RW, Burford GD, Wathes DC, Porter DG, Pickering BT 1984 Identification of oxytocin and vasopressin in the testis and in adrenal tissue. Regul Peptides 8:141-146 5. Nicholson HD, Worley RTS, Guldenaar SEF, Pickering BT 1987 Ethane-1,2-dimethanesulphonate reduces testicular oxytocin content and seminiferous tubule movements in the rat. J Endocrinol 112:311-316 6. Schaeffer JM, Liu J, Hsueh AJW, Yen SSC 1984 Presence of oxytocin and arginine vasopressin in human ovary, oviduct and follicular fluid. J Clin Endocrinol Metab 59:970-973 7. Wathes DC 1984 Possible actions of gonadal oxytocin and vasopressin. J Reprod Fertil 71:315-345 8. Wathes DC, Swann RW, Pickering BT, Porter DG, Hull MGR, Drife JO 1982 Neurohypophyseal hormones in the human ovary. Lancet 2:410-412 9. Swann RW, O'Shaughnessy PJ, Birkett SD, Wathes DC, Porter DG, Pickering BT 1984 Biosynthesis of oxytocin in the corpus luteum. FEBS Lett 174:262-266 10. Ivell R, Richter D 1984a The gene for the hypothalamic peptide hormone is highly expressed in the bovine corpus luteum: biosynthesis, structure and sequence analysis. EMBO J 3:2351-2354 11. McArdle CA, Holtorf AP 1989 Oxytocin and progesterone release from bovine corpus luteum cells in culture: effects of insulin-like growth factor I, insulin and prostaglandins. Endocrinology 124:1278-1286 12. Holtorf AP, Furuya K, Ivell R, McArdle CA 1989 Oxytocin production and oxytocin messenger ribonucleic acid levels in bovine granulosa cells are regulated by insulin and insulin-like growth factor-I: dependence on developmental status of the ovarian follicle. Endocrinology 125:2612-2620 13. Khan-Dawood F 1986 Localization of oxytocin and neurophysin in baboon (Papio anubis) corpus luteum by immunocytochemistry. Acta Endocrinol (Copenh) 113:570-575 14. Khan-Dawood F, Huang JC, Dawood MY 1988 Baboon corpus luteum oxytocin: an intragonadal peptide modulator of luteal function. Am J Obstet Gynecol 158:882-891 15. Dawood MY, Khan-Dawood F 1986 Human ovarian oxytocin: its source and relationship to steroid hormones. Am J Obstet Gynecol 154:756-763 16. Plevrakis I, Clamagirand C, Pontonnier G 1990 Oxytocin biosynthesis in serum-free cultures of human granulosa cells. J Endocrinol 124:R5-8 17. Auletta FJ, Jones DSC, Flint APF 1988 Does the human corpus luteum synthesize neurohypophysial hormones? J Endocrinol 116:163-165 18. Luck MR, Jungclas B, Praetorius C, Miinker M 1988 Is oxytocin a primate ovarian hormone? In: Eley RM (ed) Comparative Reproduction in Mammals and Man. Proceedings of a Conference of the National Centre for Research in Reproduction, Nairobi, November, 1987. Institute of Primate Research, Nairobi, pp 34-41 I8a.lvell R, Richter D 1984b Structure and composition of the oxytocin and vasopressin genes from rat. Proc Natl Acad Sci USA 81:20062010

Endo • 1990 Vol 127 • No 6

19. Rehbein M, Hillers M, Mohr E, Ivell R, Morley S, Schmale H, Richter D 1986 The neurohypophyseal hormones vasopressin and oxytocin. Precursor structure, synthesis and regulation. Biol Chem Hoppe Seyler 367:695-704 20. Flint APF, Auletta FJ, Barker PJ 1988 Isolation and sequence determination of a peptide detected by oxytocin radioimmunoassay in human corpus luteum. J Endocrinol [Suppl] 119:90 21. Ivell R, Hunt N, Khan-Dawood F, Dawood MY 1989 Expression of the human relaxin gene in the corpus luteum of the menstrual cycle and in the prostate. Mol Cell Endocrinol 66:251-255 22. Huynh TV, Young RA, Davis RW 1985 Constructing and screening cDNA libraries in lambda gtlO and lambda gtll. In: Glover DM (ed) DNA Cloning. IRL Press, Oxford, vol 1:49-78 23. Ivell R 1987 Vasopressinergic and oxytocinergic cells: models in neuropeptide gene expression. In: Turner AJ (ed) Neuropeptides and Their Peptidases. Ellis-Horwood, Chichester, pp 31-64 24. Feng ZM, Bardin CW, Chen CLC 1989 Characterization and regulation of testicular inhibin /3-subunit mRNA. Mol Endocrinol 3:939-948 25. Sausville E, Carney D, Battey J 1985 The human vasopressin gene is linked to the oxytocin gene and is selectively expressed in a cultured lung cancer cell line. J Biol Chem 260:10236-10241 26. Feinberg AP, Vogelstein B 1983 A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132:6-13 27. Maniatis T, Fritsch EF & Sambrook J 1982 Molecular Cloning-A Laboratory Manual. Coldspring Harbor Laboratory, New York 28. Chen EY, Seeburg PH 1985 Supercoil sequencing: a fast and simple method for sequencing plasmid DNA. DNA 4:165-170 29. McFarland KC, Sprengel R, Phillips HS, Kohler M, Rosemblit N, Nikolics K, Segaloff DL, Seeburg PH 1989 Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family. Science 245:494-499 30. Higuchi R 1989 Using PCR to engineer DNA. In: Erlich HA (ed) PCR Technology. Stockton Press, New York, pp 61-70 31. Morley S, Ivell R 1987 Vasopressin gene transcripts in the bovine corpus luteum are defective. Mol Cell Endocrinol 53:255-258 32. Ivell R, Brackett KH, Fields MJ, Richter D 1985 Ovulation triggers oxytocin gene expression in the bovine ovary. FEBS Lett 190:263267 33. Bennegard B, Hahlin M, Dennefors B 1987 Antigonadotropic effect of oxytocin on the isolated human corpus luteum. Fertil Steril 47:431-435 34. Tan GJS, Tweedale R, Biggs JSG 1982 Oxytocin may play a role in the control of the human corpus luteum. J Endocrinol 95:65-70 35. Richardson MC, Masson GM 1985 Lack of direct inhibitory action of oxytocin on progesterone production by dispersed cells from human corpus luteum. J Endocrinol 104:149-151 36. Wilks JW 1983 The effect of oxytocin on the corpus luteum of the monkey. Contraception 28:267-272 37. Maas S, Jarry H, Teichman A, Kuhn W, Wuttke W 1990 PGF2 alpha application into young human corpora lutea increases estradiol, oxytocin and progesterone release. Acta Endocrinol [Suppl] (Copenh) 122:120


Labelling of vasopressin and oxytocin receptors from the human uterus.

Vasopressin and oxytocin gene expression in rat testis.

Oxytocin and vasopressin binding sites in human and bovine ovaries.

Fluorometric assay of vasopressin and oxytocin: a general approach to the assay of peptides in tissues.

Immunoreactive vasopressin and oxytocin: concentration in individual human hypothalamic nuclei.

Studies of oxytocin in the baboon during pregnancy and delivery.

Gonadal steroids regulate oxytocin receptors but not vasopressin receptors in the brain of male and female rats. An autoradiographical study.

Intra- and extrahypothalamic vasopressin and oxytocin pathways in the rat.

Oxytocin receptor and vasopressin receptor 1a genes are respectively associated with emotional and cognitive empathy.

Selective localization of oxytocin receptors and vasopressin 1a receptors in the human brainstem.

Oxytocin and vasopressin modulate risk-taking.

Expression of the insulin-like and platelet-derived growth factor genes in human uterine tissues.

Oxytocin- and vasopressin-binding sites in the rat uterus: competition binding and inhibitory pA2 studies with oxytocin and oxytocin antagonists.

Methylation and expression of human pepsinogen genes in normal tissues and their alteration in stomach cancer.

Inhibition of oxytocin-induced uterine contractions by an oxytocin antagonist in the pregnant baboon.

Genes Related to Oxytocin and Arginine-Vasopressin Pathways: Associations with Autism Spectrum Disorders.

Oxytocin and vasopressin systems in genetic syndromes and neurodevelopmental disorders.

Single-step isolation and sequencing of vasopressin and oxytocin precursors.

Colocalization of immunoreactive oxytocin, vasopressin and interleukin-1 in human thymic epithelial neuroendocrine cells.

Disordered structural ensembles of vasopressin and oxytocin and their mutants.

Daily Rhythms of the Expression of Key Genes Involved in Steroidogenesis and Gonadal Function in Zebrafish.

vasopressin receptors in the uterus.

Signatures of positive selection in the cis-regulatory sequences of the human oxytocin receptor (OXTR) and arginine vasopressin receptor 1a (AVPR1A) genes.

Hydroxy analogues of oxytocin and of lysine-vasopressin.