Environment Health Techniques 1118
Pengpeng Xia et al.
Research Paper F4þ enterotoxigenic Escherichia coli (ETEC) adhesion mediated by the major fimbrial subunit FaeG Pengpeng Xia1,2, Yujie Song1,2, Yajie Zou1,2, Ying Yang1,2 and Guoqiang Zhu1,2 1 2
College of Veterinary Medicine, Yangzhou University, Yangzhou, China Jiangsu Co-Innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, China
The FaeG subunit is the major constituent of F4þ fimbriae, associated with glycoprotein and/or glycolipid receptor recognition and majorly contributes to the pathogen attachment to the host cells. To investigate the key factor involved in the fimbrial binding of F4þ Escherichia coli, both the recombinant E. coli SE5000 strains carrying the fae operon gene clusters that express the different types of fimbriae in vitro, named as rF4ab, rF4ac, and rF4ad, respectively, corresponding to the fimbrial types F4ab, F4ac, and F4ad, and the three isogenic in-frame faeG gene deletion mutants were constructed. The adhesion assays and adhesion inhibition assays showed that DfaeG mutants had a significant reduction in the binding to porcine brush border as well as the intestinal epithelial cell lines, while the complemented strain DfaeG/pfaeG restored the adhesion function. The recombinant bacterial strains rF4ab, rF4ac, and rF4ad have the same binding property as wild-type F4þ E. coli strains do and improvement in terms of binding to porcine brush border and the intestinal epithelial cells, and the adherence was blocked by the monoclonal antibody anti-F4 fimbriae. These data demonstrate that the fimbrial binding of F4þ E. coli is directly mediated by the major FaeG subunit. Keywords: Adherence / FaeG subunit / F4þ Enterotoxigenic Escherichia coli Received: November 25, 2014; accepted: March 13, 2015 DOI 10.1002/jobm.201400901
Neonatal and post-weaning diarrhea (PWD) are prevalent gastrointestinal diseases in swine and are associated with the colonization of F4þ (or K88þ) enterotoxigenic Escherichia coli (ETEC) in the intestinal tract of infected piglets [1]. Secretion of heat-labile and heat-stable enterotoxins from the pathogen induces electrolyte imbalance in the host, leading to severe diarrhea [2, 3]. Three antigenic variants of F4 fimbriae have been identified, namely F4ab, F4ac, and F4ad [4, 5]. They have different hemagglutination characteristics and porcine enterocyte binding activities, suggesting that the fimbrial binding is variant specific [6, 7]. All F4þ
fimbriae are composed of some minor subunits (FaeC, FaeF, FaeH, and probably FaeI and FaeJ) and a major subunit (FaeG) [8, 9]. Comparative analysis of these subunit genes revealed that only the faeG gene is significantly different among the three variants. Because of the different localization of a, b, c, and d epitopes of the FaeG subunit, the three variants exhibit different specificities in their attachments to the epithelial cells of the small intestine [8]. Oral administration of ETEC F4 fimbriae or its fimbrial adhesin to piglets expressing a F4-specific receptor (F4R) on their intestinal epithelial cells induces a protective mucosal immune response [8, 10–12]. These findings implicate the major FaeG subunit as the mediator of F4þ ETEC binding activities.
Correspondence: Guoqiang Zhu, College of Veterinary Medicine, Yangzhou University, 12 East Wenhui Road, Yangzhou 225009, China E-mail: [email protected] Phone: (0086)-514-87972590 Fax: (0086)-514-87311374
The present study constructed F4þ ETEC strains that expressed either F4ab, F4ac, or F4ad fimbriae and evaluated the impact of deleting faeG on ETEC adherence to porcine brush border cells and IPEC-J2 cells.
Introduction
ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 1118–1124
F4þ ETEC adhesion mediated by the FaeG subunit
Materials and methods Bacterial strains, monoclonal antibody, cell lines, and culture conditions The bacterial strains used are listed in Table 1. The parent F4þ E. coli strains and the isogenic DfaeG mutants were cultivated in Luria Bertani (LB) medium. The engineered F4þ E. coli were grown in LB medium supplemented with ampicillin (100 mg ml1). All cultures were grown with agitation (178 rpm) at 37 °C. The monoclonal antibody anti-F4 fimbriae was developed in our laboratory using the method as described by Van den Broeck et al. [1]. The porcine neonatal jejunal epithelial cell line IPECJ2 was grown in RPMI 1640-F12 (1:1) (Gibco), supplemented with 10% fetal bovine serum (FBS, Gibco) and maintained in 75 ml flasks (Corning, NY, USA) at 37 °C in a humidified incubator in an atmosphere of 6% CO2. Cloning of F4 (F4ab, F4ac, F4ad) fimbrial operon gene clusters from enterotoxigenic E. coli The F4 fimbrial operons (from faeC to faeJ) were amplified using long-PCR from the F4þ E. coli reference
1119
strains (C83901,C83092,C83903, respectively) [13, 14]. PCR products were digested with NheI and BamHI and cloned into plasmid pBR322. Recombinant plasmids were transformed into E. coli SE5000. Construction of the isogenic DfaeG mutants for rF4ab, rF4ac, and rF4ad E. coli Isogenic DfaeG mutants were constructed using l-red mutagenesis [15] using primers described in Table 2. Preparation of brush border cells This study was conducted in compliance with the guidelines of the Yangzhou University Institutional Animal Care and Use Committee. After slaughter, 20 cm segments of jejunum from 35-day-old Large White (LW) piglets found to be susceptible to F4 ETEC [16, 17] were collected on ice and cut longitudinally. Intestinal samples were cleaned with cold PBR solution (PBS with 1.7 mM CaCl2, pH 7.4) four times and with cold IPBR solution (PBR with 1 mg glucose and 5 mg trypsin inhibitor per milliliter) once. The brush border cells were obtained by scraping the mucosal surface of the tissue with a glass microscope slide, and then mixed with
Table 1. Bacteria and plasmids used in this study. Strains and plasmids
Characteristic
Source reference
Strains F4ab (C83901)
wild-type, O8:K87:F4ab
F4ac (C83902)
wild-type, O8:K87:F4ac
F4ad (C83903)
wild-type, O141:K85:F4ad
Institute of veterinary drugs control, China Institute of ceterinary drugs control, China Institute of veterinary drugs control, China in this study in this study in this study laboratory store Laboratory store laboratory store in this study in this study in this study Invitrogen, Carlsbad, USA
rF4ab rF4ac rF4ad F4ab4faeG F4ac4faeG F4ad4faeG rF4ab4faeG rF4ac4faeG rF4ad4faeG DH5a BL21(DE3) SE5000
SE5000 carrying PBR- faeG(F4ab), Ampr SE5000 carrying PBR- faeG(F4ac), Ampr SE5000 carrying PBR- faeG(F4ad), Ampr faeG deletion in C83901 faeG deletion in C83902 faeG deletion in C83903 faeG deletion in rF4ab faeG deletion in rF4ac faeG deletion in rF4ad F supE44DlacU169 (f80 lacZDM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 F-, ompT, hsdS(rBB-mB-), gal, dcm(DE3) F araD193D(argF lac)U169 rpsL150 relA1 flbB5301 deoC1 ptsF25 rbsR recA56
Plasmids pKD3
Cmr; Cm cassette template
pKD46
Ampr; l-red recombinase expression
pCP20
Ampr; Cmr; Flp recombinase expression
pBR322 pBR-faeG pET28a(þ)
Expression vector, ampr pBR322 carrying intact ORF of faeG expression vector, kanr
ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
www.jbm-journal.com
Novagen, Madison, USA laboratory store Datsenko and Wanner (2000) Datsenko and Wan- ner (2000) Datsenko and Wan- ner (2000) Takara Ltd. Japen in this study Novagen, Madison, USA
J. Basic Microbiol. 2015, 55, 1118–1124
1120
Pengpeng Xia et al.
Table 2. Primers used in this study. Primers M1 M2 P1 P2
Sequence (50 30 ) ATTTCAATGGTTCGGTCGATATCGGTGGTAGTATCACTGCAG ATGATTATTGTGTAGGCTGGAGCTGCTTCG AGTTACAGCCTGATTAAAAGTTGCCTCAATAGTCTGACCGTT TGCAATCATATGAATATCCTCCTTAG ATTCGGGATCCATGAAAAAGAC ACTTATTACTAAGTCGACGCTG
200 ml cold IPBR solution at 113 g for 10 min. After incubation for 1 min at 4 °C, the solution was centrifuged at 113 g for 10 min to pellet the brush border cells. The pellet was re-suspended in the same buffer and centrifuged again under the same conditions. The small intestine cells used for this study were dissolved in the same buffer and adjusted the concentration of cells from 106 to 107 cells ml1 [13]. Porcine brush border bacterial adherence assay 0.5 ml 1 109 CFU ml1 bacterial suspensions and 0.5 ml 106–107 cells ml1 brush border cells were combined and incubated at 37 °C for 30 min. After centrifugation at 2795 g for 5 min, the pellet was resuspended in 1 ml cold PBR solution. Thereafter, 50 ml of mixed suspensions were analyzed using oil-immersion light microscopy [18, 19]. In vitro adherence assays In vitro adherence assays were performed as previously described [20]. Briefly, 1 107 CFUs bacteria were added to a monolayer of about 1 105 IPEC-J2 cells in each well of a 96-well culture plate (Corning, NY, USA) for 1 h at 37 °C. Cell monolayers were gently washed three times with phosphate buffered saline (PBS, pH 7.0) and then 0.5% Triton X-100 was added for 20 min. Lysates were serially diluted and spread on LB agar to enumerate adherent bacteria. The experiments were repeated three times. In vitro inhibition assays Adherent inhibition assay was measured in the same way as measured before [21]. This monoclonal antisera at 1:1000 dilutions were co-incubated with a monolayer of about 1 105 IPEC-J2 cells in each well of a 96-well culture plate for 2 h at 37 °C, 6% CO2 before adding bacteria into the well. The experiments were repeated three times and the data were the average value of all experimental data from the three independent experiments.
Results Recombinant rF4ab, rF4ac, rF4ad strains adhere to brush borders To study the interaction of F4þ fimbriae with the brush border cells of the porcine small intestine, enterocytes were isolated from 12 piglets. After co-incubation with the parent F4þ strains and staining with methylene blue, more than 20 brush border cells from piglets bind well to two or more F4þ fimbriaed E. coli in each one of five different horizons. Contrast to the wild type, rF4ab, rF4ac, rF4ad with the big difference in binding activity observed in Fig. 1, showing that the rF4ab, rF4ac, rF4ad strain strongly adhere to the brush border cells compared with the parent strain. Likewise, the same result came out with IPEC-J2 cell lines, ratio of adherent rF4ab, rF4ac, and rF4ad with the IPEC-J2 cells are improved 15.85, 10.72, and 6.66%, respectively, while compared with the parent strain (p < 0.05) (Fig. 2a). In the inhibition assay, 90% reduction in adherence with the wild-type strain was observed by co-incubating cells with anti-F4þ monoclonal antiserum (1:1000 dilution) while the rF4ab and rF4ac strains were down over 97% (p < 0.05) (Fig. 2b). Deleting faeG reduces ETEC binding There was a significant reduction in adherence with the F4þDfaeG strain as compared with the parent strain, while the complemented strains behaved similarly to wild-type. Ratio of adherent F4abDfaeG and F4acDfaeG with the IPEC-J2 cells decreased 78.69 and 77.66%, respectively. But there was only 66.51% reduction on adherent F4adDfaeG with the IPEC-J2 cells (p < 0.05) (Fig. 2a). These results confirmed that F4þ fimbriae are sufficient for adherence and that the fimbrial subunit protein FaeG is an important component of the fimbriae.
Discussion Statistical analysis All analyses were performed on SPSS 16.0 software (SPSS Inc., USA) using t-tests. A p-value of less than 0.05 was considered statistically significant. ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
ETEC F4þ causes huge economic loss to the pig industry. Fimbriae are a major virulence factor of F4þ E. coli. The major subunit FaeG of F4þ fimbriae is not only associated
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 1118–1124
F4þ ETEC adhesion mediated by the FaeG subunit
1121
Figure 1. Comparison of the binding of porcine brush border cells with different type of F4þ E. coli, i e., (a) F4ab, (b) F4ac, and (c) F4ad. The strain used in this experiment include the parent strain, the isogenic DfaeG mutants and the recombinant strains pBR-F4þ, the picture was shown from left to right to correspond with the same order. All porcine intestine cells came from the same piglet and maintained in the same method. The binding activity was observed by oil-immersion light microscopy (10 100).
with the adhesive properties, but is also essential for F4 variant specific binding [4, 7]. In this study, the difference in the binding activities of rF4ab, rF4ac, rF4ad, the wild-type F4þ strain, or the DfaeG mutants with the porcine brush border cells as well as IPEC-J2 cells showed that the binding activity of F4þ fimbriae is meditated by the FaeG subunit. With regard to the development of F4þ infection, the first step in the pathogenesis of diarrhea due to this ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
pathogen is attached to the host cells [22]. In our study case, no significant difference in the attachment of F4þ fimbriae with the porcine intestinal brush border cells was observed, although there was a tendency to a reduced adherence for F4ad strain. In addition, an in vitro attachment study demonstrated that ratio of adherent F4ad, rF4ad, and F4ad DfaeG mutant with the IPEC-J2 cells were weakly changed. It seems likely that the number of F4ad bacteria that adhered to cells in the
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 1118–1124
1122
Pengpeng Xia et al.
Figure 2. Comparison of the adhesion ability of IPEC-J2 cells with different F4þ E. coli. The strain adherent index in the group using the parent strain was assumed as 100%. (a) This monoclonal antisera at 1:1000 dilutions were co-incubated with IPEC-J2 cells for 2 h at 37 °C, 6% CO2 before adding the parent or the recombinant bacteria into the well. (b) A number of other groups in the index used different strains, i.e., the recombinant pBR-F4þ, the isogenic DfaeG mutants. We used these data to compare the adhesion ability of the standard one. All data are the means of four independent experiments. Each experiment was repeated three times and representative results are shown (p < 0.05).
adhesion test was relatively varied compared with F4ab and F4ac, but still mostly influenced by the FaeG subunit. Previous results showed that the amino acids 125–163 of the FaeG subunit were the efficient site for the F4 fimbrial binding capacity and antigenicity [20]. In addition, the binding region involved in receptor recognition found in the FaeG subunit from all the three F4 serotypes seems different: the region of 140–145 and 151–156 were identified as the functional site for the F4ab fimbria while another two regions 148–150 and 156–158 were reported to inhibit F4ab adherence. For the F4ac fimbriae, the amino acids from 147 to 160 are the determinant epitopes for the fimbrial binding capacity, and only have five residues in difference with the binding region of the F4ad subunit [6, 21, 23, 24]. It seems likely that the different structure of F4ad FaeG subunit with two other variants provide affinity and specificity to the interaction with the host cells. This hypothesis was confirmed by Moonens et al., they found that F4ad FaeG interacts via its D0 -D00 -a 1-a 2 binding domain with the minimal galactose binding epitope, two short amino acid stretches Phe150–Glu152, and Val166– Glu170 are the key residues in the galactose–FaeG interaction. This crucial D0 -a 1 loop are lacking in the ab and ac variants and resulting in different structural and adhesive properties [25]. In the literature, there are two kinds of receptors that are considered important to the specific binding of F4 fimbriae, glycoproteins, and glycolipids [26, 27]. F4ab fimbriae bind to the transferrin protein GP74, the F4ab and F4ac fimbriae bind to the glycoprotein IMTGP, and ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
F4ad fimbriae recognize the small glycolipid IGLad [28, 29]. Since the three F4 variants are highly homologous and their differences are found only in the FaeG major subunit [30], the recognition of receptor must be determined by a small number of amino acids in the FaeG protein. Characterizing the FaeG subunit would help us to understand the mechanism behind the adaptation of pathogens to hosts and to develop effective subunit vaccines [31]. More importantly, it would benefit understanding receptors related to the three variants. In conclusion, the fimbrial subunit FaeG is the most prominent part for F4 adherence in vitro and is directly involved in the binding of the F4þ fimbriae to the host cells. However, further experiments on this fimbrial subunit are necessary to fully determine the effect it holds on the function of pathogen infection in vivo and to better elucidate the mechanisms by which the subunit recognizes the ideal receptors for F4þ E. coli.
Acknowledgments This study was supported by grants from the Chinese National Science Foundation Grant (No. 30571374, 30771603, 31072136, 31270171), the Genetically Modified Organisms Technology Major Project of China (2014ZX08006-001B), the 948 programme grant no. 2011-G24 from Ministry of Agriculture of the People’s Republic of China, a project founded by the Priority Academic Program of Development Jiangsu High Education Institution, Program for ChangJiang Scholars and Innovative Research Team In University “PCSIRT”
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 1118–1124
F4þ ETEC adhesion mediated by the FaeG subunit
(IRT0978), Program granted for Scientific Innovation Research of College Graduate in Jiangsu province (KYLX_1359).
[12] Verdonck, F., Snoeck, V., Goddeeris, B.M., Cox, E., 2004. Binding of a monoclonal antibody positively correlates with bioactivity of the F4 fimbrial adhesin FaeG associated with post-weaning diarrhoea in piglets. J. Immunol. Methods, 294(1–2), 81–88. [13] Zhang, J.J., Zhu, G.Q., 2007. Cloning and expression of F18 fimbrial operon gene clusters from enterotoxigenic Escherichia coli and their bioactivity. Wei. Sheng. Wu. Xue. Bao., 47(5), 790–794.
Conflicts of interest The authors declared no conflicts of interest.
[14] Zhou, M., Duan, Q., Zhu, X., Guo, Z., et al., 2013. Both flagella and F4 fimbriae from F4acþ enterotoxigenic Escherichia coli contribute to attachment to IPEC-J2 cells in vitro. Vet. Res., 44, 30.
References [1] Van den Broeck, W., Cox, E., Goddeeris, B.M., 1999. Receptor-specific binding of purified F4 to isolated villi. Vet. Microbiol., 68(3–4), 255–263. [2] Devriendt, B., Stuyven, E., Verdonck, F., Goddeeris, B.M., et al., 2010. Enterotoxigenic Escherichia coli (K88) induce proinflammatory responses in porcine intestinal epithelial cells. Dev. Comp. Immunol., 34(11), 1175–1182. [3] Fekete, P.Z., Mateo, K.S., Zhang, W., Moxley, R.A., et al., 2013. Both enzymatic and non-enzymatic properties of heat-labile enterotoxin are responsible for LT-enhanced adherence of enterotoxigenic Escherichia coli to porcine IPEC-J2 cells. Vet. Microbiol., 164(3–4), 330–335. [4] Bijlsma, I., de Nijs, A., van der Meer, C., Frik, J., 1982. Different pig phenotypes affect adherence of Escherichia coli to jejunal brush borders by K88ab, K88ac, or K88ad antigen. Infect. Immun., 37(3), 891–894. [5] Jin, L.Z., Zhao, X., 2000. Intestinal receptors for adhesive fimbriae of enterotoxigenic Escherichia coli (ETEC) K88 in swine-a review. Appl. Microbiol. Biotechnol., 54(3), 311– 318. [6] Bakker, D., Willemsen, P.T., Simons, L.H., van Zijderveld, F.G. et al., 1992. Characterization of the antigenic and adhesive properties of FaeG, the major subunit of K88 fimbriae. Mol. Microbiol., 6(2), 247–255. [7] Zhang, W., Fang, Y., Francis, D.H., 2009. Characterization of the binding specificity of K88ac and K88ad fimbriae of enterotoxigenic Escherichia coli by constructing K88ac/ K88ad chimeric FaeG major subunits. Infect. Immun., 77(2), 699–706. [8] Van den Broeck, W., Cox, E., Oudega, B., Goddeeris, B.M., 2000. The F4 fimbrial antigen of Escherichia coli and its receptors. Vet. Microbiol., 71(3–4), 223–244. [9] Van Molle, I., Moonens, K., Garcia-Pino, A., Buts, L., et al., 2009. Structural and thermodynamic characterization of pre- and postpolymerization states in the F4 fimbrial subunit FaeG. J. Mol. Biol., 394(5), 957–967. [10] Sugiharto, S., Hedemann, M.S., Jensen, B.B., Lauridsen, C., 2012. Diarrhea-like condition and intestinal mucosal responses in susceptible homozygous and heterozygous F4Rþ pigs challenged with enterotoxigenic Escherichia coli. J. Anim. Sci., 90(Suppl. 4), 281–283. [11] Verdonck, F., Cox, E., Van der Stede, Y., Goddeeris, B.M., 2004. Oral immunization of piglets with recombinant F4 fimbrial adhesin FaeG monomers induces a mucosal and systemic F4-specific immune response. Vaccine, 22(31– 32), 4291–4299. ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
1123
[15] Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA, 97(12), 6640–6645. [16] Jørgensen, C.B., Cirera, S., Anderson, S.I., Archibald, A.L., et al., 2003. Linkage and comparative mapping of the locus controlling susceptibility towards E. coli F4ab/ac diarrhoea in pigs. Cytogenet. Genome Res., 102(1–4), 157–162. [17] Nguyen, V.U., Goetstouwers, T., Coddens, A., Van Poucke, M., et al., 2012. Differentiation of F4 receptor profiles in pigs based on their mucin 4 polymorphism, responsiveness to oral F4 immunization and in vitro binding of F4 to villi. Vet. Immunol. Immunopathol., 152(1–2), 93–100. [18] Li, Y., Qiu, X., Li, H., Zhang, Q., 2007. Adhesive patterns of Escherichia coli F4 in piglets of three breeds. J. Genet. Genomics, 34(7), 591–599. [19] Verdonck, F., Joensuu, J.J., Stuyven, E., De Meyer, J., et al., 2008. The polymeric stability of the Escherichia coli F4 (K88) fimbriae enhances its mucosal immunogenicity following oral immunization. Vaccine, 26(45), 5728–5735. [20] Duan, Q., Zhou, M., Zhu, X., Bao, W., et al., 2012. The flagella of F18ab Escherichia coli is a virulence factor that contributes to infection in a IPEC-J2 cell model in vitro. Vet. Microbiol., 160(1–2), 132–140. [21] Jacobs, A.A., Venema, J., Leeven, R., van Pelt-Heerschap, H., et al., 1987. Inhibition of adhesive activity of K88 fibrillae by peptides derived from the K88 adhesin. J. Bacteriol., 169(2), 735–741. [22] Daudelin, J.F., Lessard, M., Beaudoin, F., Nadeau, E., et al., 2011. Administration of probiotics influences F4 (K88)positive enterotoxigenic Escherichia coli attachment and intestinal cytokine expression in weaned pigs. Vet. Res., 42, 69. [23] Thiry, G., Clippe, A., Scarcez, T., Petre, J., 1989. Cloning of DNA sequences encoding foreign peptides and their expression in the K88 pili. Appl. Environ. Microbiol., 55(4), 984–993. [24] Van Molle, I., Joensuu, J.J., Buts, L., Panjikar, S., et al., 2007. Chloroplasts assemble the major subunit FaeG of Escherichia coli F4 (K88) fimbriae to strand-swapped dimers. J. Mol. Biol., 368(3), 791–799. [25] Moonens, K., Van den Broeck, I., De Kerpel, M., Deboeck, F., et al., 2015. Structural and functional insight in the carbohydrate receptor binding of F4 fimbriae producing enterotoxigenic Escherichia coli. J. Biol. Chem., doi: 10.1074/ jbc.M114.618595 [26] Edfors-Lilja, I., Gustafsson, U., Duval-Iflah, Y., Ellergren, H., et al., 1995. The porcine intestinal receptor for
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 1118–1124
1124
Pengpeng Xia et al.
Escherichia coli K88ab, K88ac: regional localization on chromosome 13 and influence of IgG response to the K88 antigen. Anim. Genet., 26(4), 237–242. [27] Francis, D.H., Grange, P.A., Zeman, D.H., Baker, D.R., et al., 1998. Expression of mucin-type glycoprotein K88 receptors strongly correlates with piglet susceptibility to K88(þ) enterotoxigenic Escherichia coli, but adhesion of this bacterium to brush borders does not. Infect. Immun., 66(9), 4050–4055. [28] Grange, P.A., Erickson, A.K., Anderson, T.J., Francis, D.H., 1998. Characterization of the carbohydrate moiety of intestinal mucin-type sialoglycoprotein receptors for the K88ac fimbrial adhesin of Escherichia coli. Infect. Immun., 66(4), 1613–1621.
ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
[29] Grange, P.A., Mouricout, M.A., 1996. Transferrin associated with the porcine intestinal mucosa is a receptor specific for K88ab fimbriae of Escherichia coli. Infect. Immun., 64(2), 606–610. [30] Verdonck, F., Cox, E., Schepers, E., Imberechts, H., et al., 2004. Conserved regions in the sequence of the F4 (K88) fimbrial adhesin FaeG suggest a donor strand mechanism in F4 assembly. Vet. Microbiol., 102(3–4), 215–225. [31] Melkebeek, V., Rasschaert, K., Bellot, P., Tilleman, K., et al., 2012. Targeting aminopeptidase N, a newly identified receptor for F4ac fimbriae, enhances the intestinal mucosal immune response. Mucosal. Immunol., 5(6), 635–645.
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 1118–1124
Pengpeng Xia et al.
Research Paper F4þ enterotoxigenic Escherichia coli (ETEC) adhesion mediated by the major fimbrial subunit FaeG Pengpeng Xia1,2, Yujie Song1,2, Yajie Zou1,2, Ying Yang1,2 and Guoqiang Zhu1,2 1 2
College of Veterinary Medicine, Yangzhou University, Yangzhou, China Jiangsu Co-Innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, China
The FaeG subunit is the major constituent of F4þ fimbriae, associated with glycoprotein and/or glycolipid receptor recognition and majorly contributes to the pathogen attachment to the host cells. To investigate the key factor involved in the fimbrial binding of F4þ Escherichia coli, both the recombinant E. coli SE5000 strains carrying the fae operon gene clusters that express the different types of fimbriae in vitro, named as rF4ab, rF4ac, and rF4ad, respectively, corresponding to the fimbrial types F4ab, F4ac, and F4ad, and the three isogenic in-frame faeG gene deletion mutants were constructed. The adhesion assays and adhesion inhibition assays showed that DfaeG mutants had a significant reduction in the binding to porcine brush border as well as the intestinal epithelial cell lines, while the complemented strain DfaeG/pfaeG restored the adhesion function. The recombinant bacterial strains rF4ab, rF4ac, and rF4ad have the same binding property as wild-type F4þ E. coli strains do and improvement in terms of binding to porcine brush border and the intestinal epithelial cells, and the adherence was blocked by the monoclonal antibody anti-F4 fimbriae. These data demonstrate that the fimbrial binding of F4þ E. coli is directly mediated by the major FaeG subunit. Keywords: Adherence / FaeG subunit / F4þ Enterotoxigenic Escherichia coli Received: November 25, 2014; accepted: March 13, 2015 DOI 10.1002/jobm.201400901
Neonatal and post-weaning diarrhea (PWD) are prevalent gastrointestinal diseases in swine and are associated with the colonization of F4þ (or K88þ) enterotoxigenic Escherichia coli (ETEC) in the intestinal tract of infected piglets [1]. Secretion of heat-labile and heat-stable enterotoxins from the pathogen induces electrolyte imbalance in the host, leading to severe diarrhea [2, 3]. Three antigenic variants of F4 fimbriae have been identified, namely F4ab, F4ac, and F4ad [4, 5]. They have different hemagglutination characteristics and porcine enterocyte binding activities, suggesting that the fimbrial binding is variant specific [6, 7]. All F4þ
fimbriae are composed of some minor subunits (FaeC, FaeF, FaeH, and probably FaeI and FaeJ) and a major subunit (FaeG) [8, 9]. Comparative analysis of these subunit genes revealed that only the faeG gene is significantly different among the three variants. Because of the different localization of a, b, c, and d epitopes of the FaeG subunit, the three variants exhibit different specificities in their attachments to the epithelial cells of the small intestine [8]. Oral administration of ETEC F4 fimbriae or its fimbrial adhesin to piglets expressing a F4-specific receptor (F4R) on their intestinal epithelial cells induces a protective mucosal immune response [8, 10–12]. These findings implicate the major FaeG subunit as the mediator of F4þ ETEC binding activities.
Correspondence: Guoqiang Zhu, College of Veterinary Medicine, Yangzhou University, 12 East Wenhui Road, Yangzhou 225009, China E-mail: [email protected] Phone: (0086)-514-87972590 Fax: (0086)-514-87311374
The present study constructed F4þ ETEC strains that expressed either F4ab, F4ac, or F4ad fimbriae and evaluated the impact of deleting faeG on ETEC adherence to porcine brush border cells and IPEC-J2 cells.
Introduction
ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 1118–1124
F4þ ETEC adhesion mediated by the FaeG subunit
Materials and methods Bacterial strains, monoclonal antibody, cell lines, and culture conditions The bacterial strains used are listed in Table 1. The parent F4þ E. coli strains and the isogenic DfaeG mutants were cultivated in Luria Bertani (LB) medium. The engineered F4þ E. coli were grown in LB medium supplemented with ampicillin (100 mg ml1). All cultures were grown with agitation (178 rpm) at 37 °C. The monoclonal antibody anti-F4 fimbriae was developed in our laboratory using the method as described by Van den Broeck et al. [1]. The porcine neonatal jejunal epithelial cell line IPECJ2 was grown in RPMI 1640-F12 (1:1) (Gibco), supplemented with 10% fetal bovine serum (FBS, Gibco) and maintained in 75 ml flasks (Corning, NY, USA) at 37 °C in a humidified incubator in an atmosphere of 6% CO2. Cloning of F4 (F4ab, F4ac, F4ad) fimbrial operon gene clusters from enterotoxigenic E. coli The F4 fimbrial operons (from faeC to faeJ) were amplified using long-PCR from the F4þ E. coli reference
1119
strains (C83901,C83092,C83903, respectively) [13, 14]. PCR products were digested with NheI and BamHI and cloned into plasmid pBR322. Recombinant plasmids were transformed into E. coli SE5000. Construction of the isogenic DfaeG mutants for rF4ab, rF4ac, and rF4ad E. coli Isogenic DfaeG mutants were constructed using l-red mutagenesis [15] using primers described in Table 2. Preparation of brush border cells This study was conducted in compliance with the guidelines of the Yangzhou University Institutional Animal Care and Use Committee. After slaughter, 20 cm segments of jejunum from 35-day-old Large White (LW) piglets found to be susceptible to F4 ETEC [16, 17] were collected on ice and cut longitudinally. Intestinal samples were cleaned with cold PBR solution (PBS with 1.7 mM CaCl2, pH 7.4) four times and with cold IPBR solution (PBR with 1 mg glucose and 5 mg trypsin inhibitor per milliliter) once. The brush border cells were obtained by scraping the mucosal surface of the tissue with a glass microscope slide, and then mixed with
Table 1. Bacteria and plasmids used in this study. Strains and plasmids
Characteristic
Source reference
Strains F4ab (C83901)
wild-type, O8:K87:F4ab
F4ac (C83902)
wild-type, O8:K87:F4ac
F4ad (C83903)
wild-type, O141:K85:F4ad
Institute of veterinary drugs control, China Institute of ceterinary drugs control, China Institute of veterinary drugs control, China in this study in this study in this study laboratory store Laboratory store laboratory store in this study in this study in this study Invitrogen, Carlsbad, USA
rF4ab rF4ac rF4ad F4ab4faeG F4ac4faeG F4ad4faeG rF4ab4faeG rF4ac4faeG rF4ad4faeG DH5a BL21(DE3) SE5000
SE5000 carrying PBR- faeG(F4ab), Ampr SE5000 carrying PBR- faeG(F4ac), Ampr SE5000 carrying PBR- faeG(F4ad), Ampr faeG deletion in C83901 faeG deletion in C83902 faeG deletion in C83903 faeG deletion in rF4ab faeG deletion in rF4ac faeG deletion in rF4ad F supE44DlacU169 (f80 lacZDM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 F-, ompT, hsdS(rBB-mB-), gal, dcm(DE3) F araD193D(argF lac)U169 rpsL150 relA1 flbB5301 deoC1 ptsF25 rbsR recA56
Plasmids pKD3
Cmr; Cm cassette template
pKD46
Ampr; l-red recombinase expression
pCP20
Ampr; Cmr; Flp recombinase expression
pBR322 pBR-faeG pET28a(þ)
Expression vector, ampr pBR322 carrying intact ORF of faeG expression vector, kanr
ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
www.jbm-journal.com
Novagen, Madison, USA laboratory store Datsenko and Wanner (2000) Datsenko and Wan- ner (2000) Datsenko and Wan- ner (2000) Takara Ltd. Japen in this study Novagen, Madison, USA
J. Basic Microbiol. 2015, 55, 1118–1124
1120
Pengpeng Xia et al.
Table 2. Primers used in this study. Primers M1 M2 P1 P2
Sequence (50 30 ) ATTTCAATGGTTCGGTCGATATCGGTGGTAGTATCACTGCAG ATGATTATTGTGTAGGCTGGAGCTGCTTCG AGTTACAGCCTGATTAAAAGTTGCCTCAATAGTCTGACCGTT TGCAATCATATGAATATCCTCCTTAG ATTCGGGATCCATGAAAAAGAC ACTTATTACTAAGTCGACGCTG
200 ml cold IPBR solution at 113 g for 10 min. After incubation for 1 min at 4 °C, the solution was centrifuged at 113 g for 10 min to pellet the brush border cells. The pellet was re-suspended in the same buffer and centrifuged again under the same conditions. The small intestine cells used for this study were dissolved in the same buffer and adjusted the concentration of cells from 106 to 107 cells ml1 [13]. Porcine brush border bacterial adherence assay 0.5 ml 1 109 CFU ml1 bacterial suspensions and 0.5 ml 106–107 cells ml1 brush border cells were combined and incubated at 37 °C for 30 min. After centrifugation at 2795 g for 5 min, the pellet was resuspended in 1 ml cold PBR solution. Thereafter, 50 ml of mixed suspensions were analyzed using oil-immersion light microscopy [18, 19]. In vitro adherence assays In vitro adherence assays were performed as previously described [20]. Briefly, 1 107 CFUs bacteria were added to a monolayer of about 1 105 IPEC-J2 cells in each well of a 96-well culture plate (Corning, NY, USA) for 1 h at 37 °C. Cell monolayers were gently washed three times with phosphate buffered saline (PBS, pH 7.0) and then 0.5% Triton X-100 was added for 20 min. Lysates were serially diluted and spread on LB agar to enumerate adherent bacteria. The experiments were repeated three times. In vitro inhibition assays Adherent inhibition assay was measured in the same way as measured before [21]. This monoclonal antisera at 1:1000 dilutions were co-incubated with a monolayer of about 1 105 IPEC-J2 cells in each well of a 96-well culture plate for 2 h at 37 °C, 6% CO2 before adding bacteria into the well. The experiments were repeated three times and the data were the average value of all experimental data from the three independent experiments.
Results Recombinant rF4ab, rF4ac, rF4ad strains adhere to brush borders To study the interaction of F4þ fimbriae with the brush border cells of the porcine small intestine, enterocytes were isolated from 12 piglets. After co-incubation with the parent F4þ strains and staining with methylene blue, more than 20 brush border cells from piglets bind well to two or more F4þ fimbriaed E. coli in each one of five different horizons. Contrast to the wild type, rF4ab, rF4ac, rF4ad with the big difference in binding activity observed in Fig. 1, showing that the rF4ab, rF4ac, rF4ad strain strongly adhere to the brush border cells compared with the parent strain. Likewise, the same result came out with IPEC-J2 cell lines, ratio of adherent rF4ab, rF4ac, and rF4ad with the IPEC-J2 cells are improved 15.85, 10.72, and 6.66%, respectively, while compared with the parent strain (p < 0.05) (Fig. 2a). In the inhibition assay, 90% reduction in adherence with the wild-type strain was observed by co-incubating cells with anti-F4þ monoclonal antiserum (1:1000 dilution) while the rF4ab and rF4ac strains were down over 97% (p < 0.05) (Fig. 2b). Deleting faeG reduces ETEC binding There was a significant reduction in adherence with the F4þDfaeG strain as compared with the parent strain, while the complemented strains behaved similarly to wild-type. Ratio of adherent F4abDfaeG and F4acDfaeG with the IPEC-J2 cells decreased 78.69 and 77.66%, respectively. But there was only 66.51% reduction on adherent F4adDfaeG with the IPEC-J2 cells (p < 0.05) (Fig. 2a). These results confirmed that F4þ fimbriae are sufficient for adherence and that the fimbrial subunit protein FaeG is an important component of the fimbriae.
Discussion Statistical analysis All analyses were performed on SPSS 16.0 software (SPSS Inc., USA) using t-tests. A p-value of less than 0.05 was considered statistically significant. ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
ETEC F4þ causes huge economic loss to the pig industry. Fimbriae are a major virulence factor of F4þ E. coli. The major subunit FaeG of F4þ fimbriae is not only associated
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 1118–1124
F4þ ETEC adhesion mediated by the FaeG subunit
1121
Figure 1. Comparison of the binding of porcine brush border cells with different type of F4þ E. coli, i e., (a) F4ab, (b) F4ac, and (c) F4ad. The strain used in this experiment include the parent strain, the isogenic DfaeG mutants and the recombinant strains pBR-F4þ, the picture was shown from left to right to correspond with the same order. All porcine intestine cells came from the same piglet and maintained in the same method. The binding activity was observed by oil-immersion light microscopy (10 100).
with the adhesive properties, but is also essential for F4 variant specific binding [4, 7]. In this study, the difference in the binding activities of rF4ab, rF4ac, rF4ad, the wild-type F4þ strain, or the DfaeG mutants with the porcine brush border cells as well as IPEC-J2 cells showed that the binding activity of F4þ fimbriae is meditated by the FaeG subunit. With regard to the development of F4þ infection, the first step in the pathogenesis of diarrhea due to this ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
pathogen is attached to the host cells [22]. In our study case, no significant difference in the attachment of F4þ fimbriae with the porcine intestinal brush border cells was observed, although there was a tendency to a reduced adherence for F4ad strain. In addition, an in vitro attachment study demonstrated that ratio of adherent F4ad, rF4ad, and F4ad DfaeG mutant with the IPEC-J2 cells were weakly changed. It seems likely that the number of F4ad bacteria that adhered to cells in the
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 1118–1124
1122
Pengpeng Xia et al.
Figure 2. Comparison of the adhesion ability of IPEC-J2 cells with different F4þ E. coli. The strain adherent index in the group using the parent strain was assumed as 100%. (a) This monoclonal antisera at 1:1000 dilutions were co-incubated with IPEC-J2 cells for 2 h at 37 °C, 6% CO2 before adding the parent or the recombinant bacteria into the well. (b) A number of other groups in the index used different strains, i.e., the recombinant pBR-F4þ, the isogenic DfaeG mutants. We used these data to compare the adhesion ability of the standard one. All data are the means of four independent experiments. Each experiment was repeated three times and representative results are shown (p < 0.05).
adhesion test was relatively varied compared with F4ab and F4ac, but still mostly influenced by the FaeG subunit. Previous results showed that the amino acids 125–163 of the FaeG subunit were the efficient site for the F4 fimbrial binding capacity and antigenicity [20]. In addition, the binding region involved in receptor recognition found in the FaeG subunit from all the three F4 serotypes seems different: the region of 140–145 and 151–156 were identified as the functional site for the F4ab fimbria while another two regions 148–150 and 156–158 were reported to inhibit F4ab adherence. For the F4ac fimbriae, the amino acids from 147 to 160 are the determinant epitopes for the fimbrial binding capacity, and only have five residues in difference with the binding region of the F4ad subunit [6, 21, 23, 24]. It seems likely that the different structure of F4ad FaeG subunit with two other variants provide affinity and specificity to the interaction with the host cells. This hypothesis was confirmed by Moonens et al., they found that F4ad FaeG interacts via its D0 -D00 -a 1-a 2 binding domain with the minimal galactose binding epitope, two short amino acid stretches Phe150–Glu152, and Val166– Glu170 are the key residues in the galactose–FaeG interaction. This crucial D0 -a 1 loop are lacking in the ab and ac variants and resulting in different structural and adhesive properties [25]. In the literature, there are two kinds of receptors that are considered important to the specific binding of F4 fimbriae, glycoproteins, and glycolipids [26, 27]. F4ab fimbriae bind to the transferrin protein GP74, the F4ab and F4ac fimbriae bind to the glycoprotein IMTGP, and ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
F4ad fimbriae recognize the small glycolipid IGLad [28, 29]. Since the three F4 variants are highly homologous and their differences are found only in the FaeG major subunit [30], the recognition of receptor must be determined by a small number of amino acids in the FaeG protein. Characterizing the FaeG subunit would help us to understand the mechanism behind the adaptation of pathogens to hosts and to develop effective subunit vaccines [31]. More importantly, it would benefit understanding receptors related to the three variants. In conclusion, the fimbrial subunit FaeG is the most prominent part for F4 adherence in vitro and is directly involved in the binding of the F4þ fimbriae to the host cells. However, further experiments on this fimbrial subunit are necessary to fully determine the effect it holds on the function of pathogen infection in vivo and to better elucidate the mechanisms by which the subunit recognizes the ideal receptors for F4þ E. coli.
Acknowledgments This study was supported by grants from the Chinese National Science Foundation Grant (No. 30571374, 30771603, 31072136, 31270171), the Genetically Modified Organisms Technology Major Project of China (2014ZX08006-001B), the 948 programme grant no. 2011-G24 from Ministry of Agriculture of the People’s Republic of China, a project founded by the Priority Academic Program of Development Jiangsu High Education Institution, Program for ChangJiang Scholars and Innovative Research Team In University “PCSIRT”
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 1118–1124
F4þ ETEC adhesion mediated by the FaeG subunit
(IRT0978), Program granted for Scientific Innovation Research of College Graduate in Jiangsu province (KYLX_1359).
[12] Verdonck, F., Snoeck, V., Goddeeris, B.M., Cox, E., 2004. Binding of a monoclonal antibody positively correlates with bioactivity of the F4 fimbrial adhesin FaeG associated with post-weaning diarrhoea in piglets. J. Immunol. Methods, 294(1–2), 81–88. [13] Zhang, J.J., Zhu, G.Q., 2007. Cloning and expression of F18 fimbrial operon gene clusters from enterotoxigenic Escherichia coli and their bioactivity. Wei. Sheng. Wu. Xue. Bao., 47(5), 790–794.
Conflicts of interest The authors declared no conflicts of interest.
[14] Zhou, M., Duan, Q., Zhu, X., Guo, Z., et al., 2013. Both flagella and F4 fimbriae from F4acþ enterotoxigenic Escherichia coli contribute to attachment to IPEC-J2 cells in vitro. Vet. Res., 44, 30.
References [1] Van den Broeck, W., Cox, E., Goddeeris, B.M., 1999. Receptor-specific binding of purified F4 to isolated villi. Vet. Microbiol., 68(3–4), 255–263. [2] Devriendt, B., Stuyven, E., Verdonck, F., Goddeeris, B.M., et al., 2010. Enterotoxigenic Escherichia coli (K88) induce proinflammatory responses in porcine intestinal epithelial cells. Dev. Comp. Immunol., 34(11), 1175–1182. [3] Fekete, P.Z., Mateo, K.S., Zhang, W., Moxley, R.A., et al., 2013. Both enzymatic and non-enzymatic properties of heat-labile enterotoxin are responsible for LT-enhanced adherence of enterotoxigenic Escherichia coli to porcine IPEC-J2 cells. Vet. Microbiol., 164(3–4), 330–335. [4] Bijlsma, I., de Nijs, A., van der Meer, C., Frik, J., 1982. Different pig phenotypes affect adherence of Escherichia coli to jejunal brush borders by K88ab, K88ac, or K88ad antigen. Infect. Immun., 37(3), 891–894. [5] Jin, L.Z., Zhao, X., 2000. Intestinal receptors for adhesive fimbriae of enterotoxigenic Escherichia coli (ETEC) K88 in swine-a review. Appl. Microbiol. Biotechnol., 54(3), 311– 318. [6] Bakker, D., Willemsen, P.T., Simons, L.H., van Zijderveld, F.G. et al., 1992. Characterization of the antigenic and adhesive properties of FaeG, the major subunit of K88 fimbriae. Mol. Microbiol., 6(2), 247–255. [7] Zhang, W., Fang, Y., Francis, D.H., 2009. Characterization of the binding specificity of K88ac and K88ad fimbriae of enterotoxigenic Escherichia coli by constructing K88ac/ K88ad chimeric FaeG major subunits. Infect. Immun., 77(2), 699–706. [8] Van den Broeck, W., Cox, E., Oudega, B., Goddeeris, B.M., 2000. The F4 fimbrial antigen of Escherichia coli and its receptors. Vet. Microbiol., 71(3–4), 223–244. [9] Van Molle, I., Moonens, K., Garcia-Pino, A., Buts, L., et al., 2009. Structural and thermodynamic characterization of pre- and postpolymerization states in the F4 fimbrial subunit FaeG. J. Mol. Biol., 394(5), 957–967. [10] Sugiharto, S., Hedemann, M.S., Jensen, B.B., Lauridsen, C., 2012. Diarrhea-like condition and intestinal mucosal responses in susceptible homozygous and heterozygous F4Rþ pigs challenged with enterotoxigenic Escherichia coli. J. Anim. Sci., 90(Suppl. 4), 281–283. [11] Verdonck, F., Cox, E., Van der Stede, Y., Goddeeris, B.M., 2004. Oral immunization of piglets with recombinant F4 fimbrial adhesin FaeG monomers induces a mucosal and systemic F4-specific immune response. Vaccine, 22(31– 32), 4291–4299. ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
1123
[15] Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA, 97(12), 6640–6645. [16] Jørgensen, C.B., Cirera, S., Anderson, S.I., Archibald, A.L., et al., 2003. Linkage and comparative mapping of the locus controlling susceptibility towards E. coli F4ab/ac diarrhoea in pigs. Cytogenet. Genome Res., 102(1–4), 157–162. [17] Nguyen, V.U., Goetstouwers, T., Coddens, A., Van Poucke, M., et al., 2012. Differentiation of F4 receptor profiles in pigs based on their mucin 4 polymorphism, responsiveness to oral F4 immunization and in vitro binding of F4 to villi. Vet. Immunol. Immunopathol., 152(1–2), 93–100. [18] Li, Y., Qiu, X., Li, H., Zhang, Q., 2007. Adhesive patterns of Escherichia coli F4 in piglets of three breeds. J. Genet. Genomics, 34(7), 591–599. [19] Verdonck, F., Joensuu, J.J., Stuyven, E., De Meyer, J., et al., 2008. The polymeric stability of the Escherichia coli F4 (K88) fimbriae enhances its mucosal immunogenicity following oral immunization. Vaccine, 26(45), 5728–5735. [20] Duan, Q., Zhou, M., Zhu, X., Bao, W., et al., 2012. The flagella of F18ab Escherichia coli is a virulence factor that contributes to infection in a IPEC-J2 cell model in vitro. Vet. Microbiol., 160(1–2), 132–140. [21] Jacobs, A.A., Venema, J., Leeven, R., van Pelt-Heerschap, H., et al., 1987. Inhibition of adhesive activity of K88 fibrillae by peptides derived from the K88 adhesin. J. Bacteriol., 169(2), 735–741. [22] Daudelin, J.F., Lessard, M., Beaudoin, F., Nadeau, E., et al., 2011. Administration of probiotics influences F4 (K88)positive enterotoxigenic Escherichia coli attachment and intestinal cytokine expression in weaned pigs. Vet. Res., 42, 69. [23] Thiry, G., Clippe, A., Scarcez, T., Petre, J., 1989. Cloning of DNA sequences encoding foreign peptides and their expression in the K88 pili. Appl. Environ. Microbiol., 55(4), 984–993. [24] Van Molle, I., Joensuu, J.J., Buts, L., Panjikar, S., et al., 2007. Chloroplasts assemble the major subunit FaeG of Escherichia coli F4 (K88) fimbriae to strand-swapped dimers. J. Mol. Biol., 368(3), 791–799. [25] Moonens, K., Van den Broeck, I., De Kerpel, M., Deboeck, F., et al., 2015. Structural and functional insight in the carbohydrate receptor binding of F4 fimbriae producing enterotoxigenic Escherichia coli. J. Biol. Chem., doi: 10.1074/ jbc.M114.618595 [26] Edfors-Lilja, I., Gustafsson, U., Duval-Iflah, Y., Ellergren, H., et al., 1995. The porcine intestinal receptor for
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 1118–1124
1124
Pengpeng Xia et al.
Escherichia coli K88ab, K88ac: regional localization on chromosome 13 and influence of IgG response to the K88 antigen. Anim. Genet., 26(4), 237–242. [27] Francis, D.H., Grange, P.A., Zeman, D.H., Baker, D.R., et al., 1998. Expression of mucin-type glycoprotein K88 receptors strongly correlates with piglet susceptibility to K88(þ) enterotoxigenic Escherichia coli, but adhesion of this bacterium to brush borders does not. Infect. Immun., 66(9), 4050–4055. [28] Grange, P.A., Erickson, A.K., Anderson, T.J., Francis, D.H., 1998. Characterization of the carbohydrate moiety of intestinal mucin-type sialoglycoprotein receptors for the K88ac fimbrial adhesin of Escherichia coli. Infect. Immun., 66(4), 1613–1621.
ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
[29] Grange, P.A., Mouricout, M.A., 1996. Transferrin associated with the porcine intestinal mucosa is a receptor specific for K88ab fimbriae of Escherichia coli. Infect. Immun., 64(2), 606–610. [30] Verdonck, F., Cox, E., Schepers, E., Imberechts, H., et al., 2004. Conserved regions in the sequence of the F4 (K88) fimbrial adhesin FaeG suggest a donor strand mechanism in F4 assembly. Vet. Microbiol., 102(3–4), 215–225. [31] Melkebeek, V., Rasschaert, K., Bellot, P., Tilleman, K., et al., 2012. Targeting aminopeptidase N, a newly identified receptor for F4ac fimbriae, enhances the intestinal mucosal immune response. Mucosal. Immunol., 5(6), 635–645.
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 1118–1124
