MOLECULAR REPRODUCTION AND DEVELOPMENT 33:436-442 (1992)

Fate of Microinjected Genes in Preimplantation Mouse Embryos THOMAS G. BURDON AND ROBERT J. WALL Beltsville Agricultural Research Center, Livestock and Poultry Sciences Institute, Gene Evaluation and Mapping Laboratory, U.S. Department of Agriculture, Agricultural Research Service, Beltsville, Maryland The state of genes microinjected ABSTRACT into mouse embryos was followed from the one-cell to the blastocyst stage using the polymerase chain reaction (PCR). Microinjected DNA was detected in all one-, two-, and four-cell injected embryos and in 44% of morula and 26% of blastocysts. Head-to-tail ligation of microinjected genes, a common feature of stably integrated transgene arrays, was detected in all embryos after injection of microinjected genes and occurred irrespective of the structure at the ends of the injected genes. Sensitivity of microinjected DNA to a methylation-dependent restriction endonuclease Dpn I was lost in all embryos by the two-cell stage (24 hr), indicating a change in DNA methylation, independent of transgene integration. Dissociation of blastomeres prior to compaction revealed a mosaic distribution of the microinjected DNA within the embryo and supports the notion that injected genes form a limited number of arrays, which segregate independently until they integrate into the genome or are degraded. Published 1992 Wiley-Liss, Inc.

Key Words: Transgenic animals, DNA methylation, Concatemer formation, Mosaicism

INTRODUCTION Transgenic animals are a n increasingly popular experimental system with which to address many questions in biology (Jaenisch, 1988; Purse1 et al., 1989; Hanahan, 1989). Since the production of transgenic mice has become routine in many laboratories, there has been little incentive to elucidate the processes that occur when generating a transgenic animal. However, in large animals, these processes may not be a s efficient (Wall et al., 1990), resulting in increased costs and limiting the use of transgenic livestock. Typically, a transgenic founder animal carries a single cluster of transgenes arranged predominantly in tandem head-to-tail fashion (Palmiter and Brinster, 1986). Together with results from tissue culture transfection experiments, this has been taken to indicate that ligation and recombination between injected DNAs occurs either before or after insertion in the genome (Bishop and Smith, 1989). Integration is presumed to be the limiting factor and is thought to depend on the formation of breaks in the genomic DNA (Palmiter and Brinster, 1986). Rather than inferring the fate of microinjected DNA from the arrangement of stably PUBLISHED 1992 WILEY-LISS, INC.

inherited transgenes in adult animals, we have studied the status of microinjected DNA in preimplantation embryos, a stage when integration is thought to occur. The transgene employed in this study is a modified allele of the endogenous mouse whey acidic protein gene (Campbell et al., 1984; Burdon et al., 1991) and as a model system has several advantages. More than 30 lines of transgenic mice carrying the transgene have been produced in this laboratory, so the efficiency of generating mice is established. Expression of the WAP gene is specific to the mammary gland (Pittius et al., 1988) and is therefore unlikely to affect early embryonic development. The insertion of a novel restriction site in the transgene allows discrimination between endogenous and transgene-derived polymerase chain reaction (PCR) products. Since the transgenic and endogenous PCR products can be coamplified by the same primers, the ratio of the products may give some semiquantitative indication of the abundance of the transgene relative to the endogenous gene. Finally, every PCR reaction containing a haploid genome equivalent of embryonic DNA should at a minimum produce the band generated from the endogenous WAP gene, a useful control when working with samples containing single cells.

MATERIALS AND METHODS Collection, Microinjection, and Culture of Embryos Fertilized mouse ova were collected from superovulated B6/SJL F1 females approximately 12 h r after fertilization (Hogan et al., 1986). Pronuclei were visualized under differential interference optics and injected with DNA solution. Following injection, embryos were transferred to a microdrop containing modified Ham’s F10 medium (Kane, 1987) and cultured at 37°C in 5% CO, in air. After culture, embryos were washed twice in phosphate-buffered saline (PBS) and once in I X PCR buffer (50 mM KC1, 10 mM Tris HC1, pH 8.3, 1.5 mM MgCl,, 0.001% gelatin) prior to being transferred to a microfuge tube with a 5 ~1 positive displacement pipette. Embryos were stored frozen a t -80°C.

~

Received April 21,1992; accepted J u n e 4, 1992. Address reprint requests to Dr. Robert Wall, USDA-ARS, Bldg. 200, Rm. 16, BARC-East, Beltsville, MD 20705.

MICROINJECTED GENES IN EARLY EMBRYOS Blastomeres of two-, four-, and eight-cell embryos were dissociated by first removing the zone pellucida with a 2-3 min incubation in acid tyrodes solution (Pratt, 1987) at 37°C. Zona-free embryos were incubated in calciumimagnesium-free PBS containing 1 mg/ml bovine serum albumin (BSA) plus EDTA for 20-60 min, and blastomeres were dissociated by vigorous pipetting. Blastomeres were washed twice in PBS without EDTA and aliquoted into microfuge tubes with a 5 pl positive displacement pipette.

Preparation of DNA for Microinjection Unless otherwise stated, the microinjected gene was the 7.2 kb WAP K H gene (Burdon et al., 1991) separated from plasmid sequences by EcoRI digestion. To alter the ends of the gene, the 7.2 kb fragment, cloned into pBluescript KS, was excised with SmaI/EcoRV or KpnIiXmaI to generate a WAP gene with blunt or noncompatible ends, respectively. The 5' and 3' fragments were generated by digesting the WAP K H gene with EcoRI and HindIII. DNA fragments, isolated from agarose gels by electroelution (Sambrook et al., 1989) or using glass beads (Vogelstein and Gillespie, 19791, were purified on a n Elutip (Schliecher and Schuell) column before being resuspended in 10 mM Tris HC1, pH 7.5,O.l mM EDTA a t a concentration of 1-4 pg/ml.

PCR Analysis of Embryos PCR was performed, with modifications, as described previously (Li e t al., 1988, 1990). Reactions were prepared from stock solutions using positive displacement pipettes and aliquoted with pipettes containing aerosolresistant tips (Continental Labs) in a biological containment cabinet. Embryos or blastomeres were incubated in 20 p1 of PCR buffer containing 0.05 mgiml Proteinase K, 1.7 p M sodium dodecyl sulfate (SDS) and 20 pM dithiothreitol (DTT) for 30 min a t 55°C followed by 20 min a t 85°C. Samples were then diluted with 50 p1 of PCR buffer containing 125 pM dNTPs (Pharmacia) and 0.1 pg of primers 1, 2, 130, and 141 (sequences listed below). Denaturation of embryonic DNA and inactivation of any remaining proteinase K activity was achieved by heating the samples to 97°C for 8 min. After denaturation, samples were cooled to 75°C for 15 min, during which time 1.25 units of Taq polymerase (Cetus Perkin Elmer) diluted in 10 pl PCR buffer was added to each tube. Samples were then subjected to 10 cycles of 1 min 94"C, 3 min 60"C, 2 min 72"C, followed by 35 cycles of 30 sec 94"C, 2 min 60"C, 2 rnin 72°C. In the second round of heminested PCR, samples contained 5 p1 of the completed first PCR reaction mixed with 50 p1 of PCR buffer including 125 pM dNTPs, 1.25 units of Taq polymerase and 0.1 pg of either primers 2 and 132 (across the first exon of WAP) or primers 130 and 3 (for detection of gene-gene ligation), a s shown in Figure 1. After 4 min a t 95"C, the samples were subjected to 35 cycles of 30 sec 94"C, 2 rnin 60°C, 2 rnin 72°C. Samples, either untreated or after incubation with 20 units of restriction enzyme HindIII, were ana-

#1

#2

#132

Dpnl

c

Exon 1

- - L A

L -

437

I

Kpnl / Hindlll

RI

Y

I

II

Ill

IV

RI

Y f # 130

3' #I41

#3

Fig. 1. Structure of the WAP gene and location of the PCR primers. The four exons of the WAP gene are shown a s solid boxes. Arrows denote the position and orientations of PCR primers.

lyzed on 3% agarose gels. The sequence of oligonucleotide primers are: No. 1, AACCCAACCACTCAAAG; No. 2, CCTCCTCAGCATAGACA; No. 132, TAGAGCTGTGCCAGCCTCTTC; No. 3, GTGAGCAAGCCAGTAAAG; No. 130, TCCTCCCGCCCTGTTTTAGC, No. 141, AGACATTGTCTTGATTAGTC.

Analysis of Transgene Methylation Methylation at the N6 of the adenine within the nucleotide sequence GATC (Hattman et al., 1978) is a characteristic of darn+ Escherichia coli. Mammalian cells do not normally methylate this adenine and consequently the absence of methylation following introduction into mammalian cells is taken to indicate that bacterial DNA has been replicated within the host cell. Since replication would be expected to occur following integration in dividing cells, the absence of methylation would be indicative of transgene integration. DpnI treatment of embryonic DNA was performed following the proteinase K digestion and prior to PCR. Samples were diluted with 50 pl of PCR buffer containing 125 pM dNTPs, 0.1 pg primers, and 5 units of DpnI and incubated for 90 min at 37°C. The samples were heated to 97°C for 8 min and subjected to the PCR protocol a s described above following the denaturation step. RESULTS Figure 1 shows the structure of the WAP K H gene. Primers 1and 2 were selected to amplify a 590 bp DNA fragment spanning a KpnI restriction site specific to the endogenous gene, the corresponding HindIII restriction site of the K H gene, and also two sites for the methylation dependent restriction enzyme DpnI. Amplification of samples containing only a few cells with primers 1 and 2 did not reliably generate the expected PCR product. A subsequent round of amplification with primers 2 and 132 produced the appropriate 290 bp band, which could be clearly visualized on a n agarose gel in >90% of reactions (Fig. 2). Digestion of the product with either KpnI or HindIII prior to electrophoresis demonstrated that the band was derived from the endogenous or microinjected WAP gene, respectively (Fig. 2). Amplification of samples containing the microin-

438

T.G. BURDON AND R.J. WALL

Fig. 2. Detection of microinjected WAP genes in individual blastomeres. PCR reactions of one-cell embryos were treated with restriction enzyme HindIII (HIII) or KpnI (KI). All the PCR reactions of blastomeres from two-, four., and eight-cell embryos were treated with HindIII. Ten microlitres of each reaction was fractionated on a 3%agarose gel. The sizes (base pairs) of appropriate DNA standards, run in lane M, are shown at left.

TABLE 1. PCR Analysis of Mouse Embryos Injected With K H Transgenes* Stage a t which embryos were analyzed One-cell Two-cell Four-cell Morula Blastocvsts

Embryos containing K H transgenes 100 (30130)" 100 (30130)" 100 (30130)" 44 i38187Ib

26 (22185)"

KH-positive embryos with Head-to-tail concatemers

Embryos with transgenes resistant to DpnI digestion

100 (30130)"

33 (5115)" 93 i14115)b 93 (1411F1)~ Not tested Not tested

100 (15115)" 100 (15115)" Not tested 95 i21122)"

*Percentage (number with characteristichumber tested). "-'Percentages, in columns, with different superscripts differed iP < 0.05, with transgene = 81.0; concatemers = 2.8; DpnI resistant = 18.4).

jected KH gene also generated, in addition to the expected 290 bp fragment, a band of -320 bp. The band was absent from uninjected eggs and was not cut by HindIII, indicating that i t might be a n artifact generated from an interaction between endogenous and K H gene-derived amplified fragments, A similar heminested PCR strategy, amplifying first with primers 1301141 and then 13013, was employed to amplify the junctions generated from the ligation together of the 5' and 3' ends of the microinjected K H gene.

x2 for: embryos

PCR analysis of whole embryos following microinjection demonstrated that microinjected WAP K H genes were detected in 100% (30130) of one-cell, two-cell (301 301, and four-cell embryos (30130)and in 44% (38187)of morula and 26% (22185) of blastocysts (Table 1).In all one-cell embryos, the amplified band was generated primarily from K H genes (Fig. 2). However, the percentage of embryos where the microinjected WAP KH genes were more abundant than the endogenous gene declined to 47% (14130) and 13% (4130) for two- and four-cell embryos, respectively.

MICROINJECTED GENES IN EARLY EMBRYOS TABLE 2. Transgene Mosaicism in Cleavage-Stage Mouse Embryos"

439

sistant to cleavage by DpnI (Table 11, indicating a change in methylation status of the K H gene. In conStage at which Blastomeres trast to the treatment with DpnI, microinjected genes embryos were containing in four-cell embryos were still sensitive to the restricana1v z e Mosaic embryos transgenes tion enzyme HindIII (Fig. 4), indicating that the lack of sensitivity of DpnI was not necessarily because K H Two-cell 33 (7121)" 83 (35142)" 69 (11116Ib 62 (39163)b genes had become inaccessible to restriction enzymes a t Four-cell 100 (19/19)" 26 (371145)' Eight-cell this stage or due to conditions inhibitory to restriction enzyme function. *Percentage(number with characteristicinumber analyzed). ""Percentages with different superscripts differed (P < 0.05, PCR analysis with primers designed to detect the x2 for embryos = 19.8, x2 for blastomeres = 54.6). ligation of microinjected WAP K H genes in a head-totail manner demonstrated that virtually all embryos carrying the K H gene also contained the ligation products (Table 1).This structure was detected in embryos 5-10 min after injection (Table 3; Fig. 5). To determine whether the rapid ligation of microinjected DNA was 60 due to the noncovalent association of genes prior to aJ 0 injection, DNA was heated to 65°C before injection, and m K H genes with blunt or noncompatible ends were 40 tested. None of these treatments affected the detection 2 of K H gene ligation. Interestingly, the sizes of PCR E products generated from embryos injected with genes 20 carrying blunt and noncompatible ends were discrete and correspondingly larger, as would be predicted from n the additional polylinker-derived DNA sequences used " 012 01234 012345678 to excise the WAP K H genes (Fig. 5). Ligation of microu injected genes was decreased significantly by injecting 2-cell 4-cell 8-cell the DNA into the cytoplasm rather than the pronuEmbryos Embryos Embryos cleus. No ligation product was detected in the DNA Number of Blastomereswith Transgenes injection solution or in uninjected embryos (data not shown). Fig. 3. Distribution of blastomeres containing microinjected genes To test whether the rapid detection of K H gene ligain two-, four-, and eight-cell embryos. tion was due to a n intramolecular event, i.e., circularization of microinjected genes, 5' and 3' fragments of To determine the distribution of K H genes within the WAP K H gene were coinjected either at the same microinjected embryos, blastomeres of two-, four-, and time or 2 hr apart. The products of head-to-tail ligation eight-cell stage embryos were dissociated and analyzed were detected in 95% (19120) of coinjected and 22% (41 individually (Table 2). A mosaic distribution of the mi- 18) of asynchronously injected embryos and therefore croinjected DNA was detected in 33% (7121) of two-cell, did not depend on circularization. Furthermore, the de69% (11116) of four-cell, and 100% (19119) of eight-cell tection of ligation products in a t least some embryos embryos tested. The products of a representative PCR following asynchronous injection indicated that, in analysis of blastomeres from two-, four- and eight-cell spite of the efficiency of the pronucleus at joining DNA embryos are shown in Figure 2. The distribution of fragments together, all the DNA ends were not rapidly blastomeres carrying K H genes in two-, four- and sequestered and free ends still remained 2 h r after injection. eight-cell embryos is shown in Figure 3. Treatment of embryonic DNA with the restriction DISCUSSION enzyme DpnI, which cleaves at the nucleotide sequence GATC only when adenine is methylated, was used to The 30 founder WAP transgenic mice that have been discriminate between microinjected genes that re- produced in this laboratory represent 17% of the mice tained their original bacterial methylation pattern born following injection with the WAP transgene (Wall, (DpnI sensitive) or had adopted the mammalian pat- unpublished observation). This is somewhat lower than tern (DpnI resistant). Thirty-three percent (5115) of the 26% of blastocysts that carried the WAP K H gene one-cell embryos contained K H genes resistant to DpnI and may indicate the continued presence of unintedigestion. This data probably overestimate the propor- grated DNA or integration within cells that do not contion of embryos with DpnI-resistant K H genes due to tribute to the inner cell mass of the blastocyst. This incomplete digestion. Treatment with the restriction conclusion is supported by the results of a previous enzyme HindIII prior to PCR also did not completely study in which analysis of half-morulae and transfer of cleave all the microinjected K H genes of some embryos the remainder indicated that the 35% of morulae iden(data not shown). In almost all two-cell (14115) and tified as positive overestimated the true number of four-cell (14/15) embryos, microinjected genes were re- transgenic mice (Ninomiya et al., 1989).

5

-

-

440

T.G. BURDON AND R.J. WALL

Fig. 4. Sensitivity of microinjected WAP genes in one-, two-, and four-cell embryos to restriction enzyme DpnI. Microinjected embryos were treated with restriction enzymes DpnI or HindIII or left untreated prior to PCR amplification. Amplification of three representative embryos are shown for each treatment. Reaction products were digested with HindIII and analyzed on a 3% agarose gel. The sizes (base pairs) of appropriate DNA standards, run in lane M, are shown a t left.

two- and four-cell embryos, WAP K H genes were detected that had become insensitive to the restriction enzyme DpnI and presumably had lost the original bacEmbryos terial pattern of methylation. This occurred while the containing head-to-tail level of K H genes declined relative to the endogenous Treatment concatemers WAP genes and without integration (only 26% of blas100 (20120) tocysts carry the transgene) and suggested that the Embryos incubated for 5-10 min after apparent change in methylation did not depend upon transgene injection 30 (6120) Injection of transgenes into cytoplasm integration. Although resistance to digestion by DpnI 95 (19120) could be due to the presence of some inhibitory factor in Transgene heated before injection 100 (20120) Injection of blunt ended transgenes 95 (19120) two- and four-cell embryos, microinjected genes a t the Injection of transgenes with incompatible 5' four-cell stage were sensitive to treatment with restricand 3' ends 95 (19120) tion enzyme HindIII. Recent tissue culture experiments Coinjection of 5' and 3' fragments 22 (4118) Asynchronous injection of 5' and 3' have shown that cell-specific methylation (Sandberg et fragments al., 1991) and demethylation (Paroush et al., 1990) of "Percentages (number with characteristicinumber analyzed). cytosine does not depend on DNA replication. However, Paroush et al. (1990) found that adenine residues within DpnI restriction sites on the transfected plasSince microinjection of fertilized ova is usually per- mids remained methylated up to 96 h r after transfecformed during or after the replication of pronuclear tion. Modification of the two DpnI sites in the WAP DNA has taken place (Luthardt and Donahue, 19731, gene may possibly be atypical and not require replicaan unequal distribution of microinjected genes in em- tion or might be mediated by a DNA repair mechanism. bryos would be expected a s a consequence of integra- Alternatively, early embryonic cells may represent a tion, even if it occurred prior to the first cell division. unique environment where, a s a result of the changes However, the mosaic distribution of WAP K H genes in in methylation that occur during gametogenesis and two-, four-, and eight-cell embryos indicates that micro- early embryonic development (Chaillet et al., 1991), injected genes, integrated or unintegrated, are orga- the demethylation of adenine residues may occur withnized into a limited number of arrays and segregate out requiring DNA replication. The products of head-to-tail K H gene ligation were independently as blastomeres divide. This would explain the mosaic patterns of transgene expression pre- detected in embryos almost immediately after microinviously observed in preimplantation embryos following jection (5-10 min). Rapid ligation did not require the microinjection (Stevens et al., 1989; Takeda and Toy- association of the genes prior to injection and was not necessarily dependent on intramolecular ligation. Lioda, 1991). The conversion from a bacterial to a mammalian pat- gation of microinjected genes occurred even when the 3' tern of methylation has been cited as evidence for repli- and 5' gene fragments were injected asynchronously, cation of transfected DNA in tissue culture cells (Peden indicating that, despite the propensity of the pronuet al., 1980) and in embryos (Wirak et al., 1985). It was cleus to ligate microinjected DNA, not all ends of the therefore important to determine whether a change in microinjected genes were utilized within 2 hr. Ligation methylation pattern of microinjected DNA could be in- was not inhibited by the structure a t the ends of K H terpreted as a n indication of integration. In almost all gene, and the detection of discrete bands from injections TABLE 3. Analysis of Transgene Concatemer Formation in One-Cell Mouse Embryos*

MICROINJECTED GENES IN EARLY EMBRYOS

M

Cytoplasmic injections

5-1 0 minutes

3’ + 5’ fragments

Blunt ends

441

Noncomp. ends

Fig. 5. Ligation of microinjected genes in one-cell embryos. One-cell embryos, microinjected with the KH gene, were analyzed by PCR for the formation of head-to-tail concatemers. Treatments were: injection of KH genes into the cytoplasm, collection of embryos 5-10 min after pronuclear injection, pronuclear coinjection of 5’ and 3’ fragments of

the KH gene, and pronuclear injection of K H genes with blunt or incompatible 5’ and 3’ ends. Amplification of three representative embryos are shown for each treatment. PCR reaction products were fractionated on a 3% agarose gel. The sizes (base pairs) of appropriate DNA standards, run in lane M, are shown a t left.

with genes with blunt and noncompatible ends indicated that extensive nibbling of the ends did not necessarily occur prior to ligation. The capacity of the pronucleus to join together microinjected genes suggests that ligation plays a n important role in generating transgene arrays, the fusion of separate arrays and their reorganization, to stabilize the arrangement of transgenes, presumably being achieved through recombination. In conclusion, these results suggest that demethylation of DpnI sites may not be useful a s an indicator of transgene replication and hence integration. The mosaic distribution of microinjected genes in embryos, detected as early a s the two-cell stage, indicates that identification of transgenic embryos by biopsy may be more informative a t the morula or blastocyst stage of development. Since the proportion of positive blastocysts (26%) was close to that of transgenic mice born (1520%), selection of embryos at the blastocyst stage should eliminate nontransgenic embryos and increase the efficiency of generating transgenic animals.

Chaillet JR, Vogt TF, Beir DR, Leder P 11991):Parental-specific methylation of an imprinted transgene is established during gametogenesis and progressively changes during embryogenesis. Cell 66:‘7783. Hanahan D (1989):Transgenic mice as probes into complex systems. Science 246:1265-1275. Hattman S, Brooks J E , Masurekar M (1978): Sequence specificity of the P1 modification methylase (M.Eco P1) and the DNA methylase IM.Eco dam) controlled by Escherzchza coli dam gene. J Mol E5iol 126:367. Hogan B, Constantini F, Lacy E (1986): “Manipulating the Mouse Embryo: A Laboratory Manual.” Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Jaenisch R (1988):Transgenic animals. Science 240:1468-1474. Kane M 11987):Culture media and culture of early embryos. Theriogenology 27:49-57. Li H, Cui X, Arnheim N (1990):Direct electrophoretic detection of the allelic state of single DNA molecules in human sperm by using the polymerase chain reaction. Proc Natl Acad Sci USA 87:45804584. Li H, Gyllensten UB, Cui X, Saiki RK, Erlich HA, Arnheim N (1988): Amplification and analysis of DNA sequences in single human sperm and diploid cells. Nature 335:41&417. Luthardt FW, Donahue RP (1973): Pronuclear DNA synthesis in mouse eggs. Exp Cell Res 82:143-151. Ninomiya T, Hoshi M, Mizuno A, Nagao M, Yuki A 11989):Selection of mouse preimplantation embryos carrying exogenous DNA by polymerase chain reaction. Mol Reprod Dev 1:242-248. Palmiter RD, Brinster RL 11986): Germ-line transformation of mice. Annu Rev Genet 20:465499. Paroush Z, Keshet I, Yisraeli J, Cedar H (1990):Dynamics of demethylation and activation of the alpha-actin gene in myoblasts. Cell 63:1229-1237. Peden KWC, Pipas JM, Pearson-White S, Nathans D (1980):Isolation of mutants of an animal virus in bacteria. Science 209:1392-1396. Pittius CW, Hennighausen L, Lee E, Westphal H, Nichols E, Vitale J, Gordon K (1988): A milk protein gene promoter directs the expression of human tissue plasminogen activator cDNA to the mammary gland in transgenic mice. Proc Natl Acad Sci USA 85:587&5878. Pratt HPM (1987): Isolation, culture and manipulation of pre-implantation mouse embryos. In M Monk led): “Mammalian Development: A Practical Approach.” Oxford: IRL Press, pp 1 3 4 2 . Purse1 VG, Pinkert CA, Miller KF, Bolt DJ, Campbell RG, Palmiter RD, Brinster RL, Hammer RE (1989): Genetic engineering of livestock. Science 244:1281-1288. Sambrook J, Fritsch EF, Maniatis T (1989): “Molecular Cloning: A Laboratory Manual.” Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Sandberg G, Guhl E, Graessmann M, Graessmann A (1991): After microinjection hemimethylated DNA is converted into symmetri-

ACKNOWLEDGMENTS We thank Geoffrey Waldbieser for his valuable advice, for providing plasmid subclones and purified DNA insert, and for help with the microinjections. We also thank Lothar Hennighausen for the sequences of primers 141 and 130, Mark Spencer for technical help, Barbara Hughes for taking care of the mice, and Linda Neuenhahn for preparation of the manuscript.

REFERENCES Bishop JO, Smith P (1989):Mechanism of chromosomal integration of microinjected DNA. Ma1 Biol Med 6:283-298. Burdon T, Sankaran L, Wall RJ, Spencer M, Hennighausen L 11991): Expression of a whey acidic protein transgene during mammary development: Evidence for different mechanisms of regulation during pregnancy and lactation. J Biol Chem 211:6909-6914. Campbell SM, Rosen JM, Hennighausen L, Strech-Jurk U, Sippel AE (1984): Comparison of the whey acidic protein genes of the rat and mouse Nucleic Acids Res 123685-8697.

442

T.G. BURDON AND R.J. WALL

cally methylated DNA before DNA replication. FEBS Lett 283247250. Stevens ME, Meneses J J , Pederson RA (1989): Expression of a mouse metallothionein-Escherichia coli beta-galactosidase fusion gene (MT-beta-Gal)in early mouse embryos. Exp Cell Res 183:319-325. Takeda S, Toyoda Y (1991): Expression of SV40-lacZ gene in mouse preimplantation embryos after pronuclear microinjection. Mol Reprod Dev 30:90-94.

Vogelstein B, Gillespie D (1979):Preparative and analytical purification of DNA from agarose. Proc Natl Acad Sci USA 76:615-619. Wall W, Bolt DJ, Frels WI, Hawk HW, King D, Purse1 VG, Rexroad CE Jr, Rohan RM (1990):Transgenic farm animals: current state of the art. AgBiotech News Inform 2:391-395. Wirak DO, Chalifour LE, Wassarman PM, Muller WJ, Hassell JA, DePamphilis ML (1985): Sequence dependent DNA replication in preimplantation mouse embryos. Mol Cell Biol5:2924-2935.