Cell, Vol. 66, 519431,

August

9, 1991, Copyright

0 1991 by Cell Press

Feedback Control of Mitosis in Budding Yeast

Rong Li’t and Andrew W. Murray’t* *Program in Cell Biology tDepartment of Biochemistry and Biophysics *Department of Physiology University of California San Francisco, California 94143-0444

Summary We have investigated the feedback control that prevents cells with incompletely assembled spindles from leaving mitosis. We isolated budding yeast mutants sensitive to the anti-microtubule drug benomyl. Mitotic arrest-deficient (mad) mutants are the subclass of benomyl-sensitive mutants in which the completion of mitosis is not delayed in the presence of benomyl and that die as a consequence of their premature exit from mitosis. A number of properties of the mad mutants indicate that they are defective in the feedback control over the exit from mitosis: their killing by benomyl requires passage through mitosis; their benomyl sensitivity can be suppressed by an independent method for delaying the exit from mitosis; they have normal microtubules; and they have increased frequencies of chromosome loss. We cloned MADP, which encodes a putative calcium-binding protein whose disruption is lethal. We discuss the role of feedback controls in coordinating events in the cell cycle. Introduction Accurate chromosome segregation during mitosis is essential for the faithful inheritance of genetic information. Mitosis is controlled by the activation and inactivation of maturation-promoting factor (MPF), a protein kinase whose catalytic subunit is the product of the CDC28 gene in the budding yeast Saccharomyces cerevisiae and the c&2 gene in the fission yeast Schizosaccharomyces pombe. (MPF is identical to the growth-associated histone Hl kinase of mammalian cells [Langan et al., 19891.) The activation of MPF induces entry into mitosis and the assembly of the mitotic spindle, while MPF inactivation induces chromosome segregation, cell division, and progression to the next interphase (reviewed in Murray and Kirschner, 1989; Nurse, 1990). Orderly progression through the cell cycle requires that some events be completed before others can begin. For example, if cells attempt to segregate their chromosomes before the spindle has been fully assembled, errors in chromosome segregation will occur. In most cell types, these errors are prevented by checkpoints, points in the cell cycle that cannot be passed unless certain prior events have been successfully completed (reviewed in Hartwell and Weinert, 1989). Feedback controls are the regulatory mechanisms that make passage through checkpoints dependent on the successful completion of prior events.

Experimentally, feedback controls are identified by finding conditions that overcome the cell cycle arrest that results from the failure to complete a particular step in the cell cycle. Thus the feedback control that prevents cells that have not finished DNA replication from entering mitosis was identified by the ability of caffeine treatment (Schlegel and Pardee, 1986) or mutations in mammalian cells (Nishimoto et al., 1978) Aspergillus (Osmani et al., 1988) and fission yeast (Enoch and Nurse, 1990) to allow cells containing unreplicated DNA to enter mitosis. Similarly, the control that prevents entry into mitosis in cells that contain damaged DNA was uncovered by showing that caffeine treatment (Lau and Pardee, 1982) or mutations in the budding yeast RAD9 gene (Weinert and Hartwell, 1988) allow cells with unrepaired DNA damage to enter mitosis. It is likely that both of these controls affect entry into mitosis by regulating the activation of MPF. We have identified a feedback control that makes the exit from mitosis dependent on the completion of spindle assembly. We isolated mitotic arrest-deficient (mad) mutants in the budding yeast that allow cell division to proceed even when spindle assembly is inhibited. (Throughout the text we refer to strains in which all of the MAD genes are wild type as MAD strains, and strains in which one or more of these genes are mutant as mad strains.) Analysis of the mad mutants has shown that they define three genes, MADl, MAD2, and MAD3; that their products are part of the feedback control that prevents the inactivation of MPF and exit from mitosis until spindle assembly is complete; and that this feedback control helps to ensure accurate chromosome segregation. Analysis of the MAD2 gene reveals that it is an essential gene that encodes a putative calcium-binding protein. The accompanying paper (Hoyt et al., 1991) describes the isolation of other yeast mitotic feedback control mutants using a screen different from the one described here. Results Isolation of mad Mutants We set out to isolate budding yeast mutants defective in the feedback control that prevents cells from leaving mitosis until spindle assembly is complete. Because some cell cycles, such as the first few divisions of fertilized frog eggs (Hara et al., 1980; Kimelman et al., 1987; A. W. M., unpublished data), proceed successfully in the absence of feedback controls, we needed to devise conditions in which the absence of the spindle assembly feedback control would be lethal. The successful division of early frog embryos implies that, starting at the time of MPF activation, the time taken to assemble the spindle is less than the time taken to complete the biochemical reactions that inactivate MPF (Figure 1). If the completion of spindle assembly is normally faster than the inactivation of MPF, then yeast mutants defective in the feedback control over the exit from mitosis might not be detectable. However, if the rate of spindle assembly is reduced to the point at which the

Cell 520

Figure 1. Feedback Controls and Timing Mechanisms Can Coordinate Events in the Cell Cycle NORMALRATEOF SP,NDLEASSEM.9LY ) ACn”AnoN

OF MPF

lNACnVAnON (EXIT FROM

OF MPF MlTOSlSl ~ I

(ENTRYINTO MITOSIS)

REDUCED RATE SPINDLEASSEMBLY

Inum$;ll*-t

Ci$$y

OF INACTWAT1ON (EXIT FROM

OF YPF MITOSIS,

EXIVPROM UTOEJS DELAYED W”,‘XE,SFULLVA~EMB~ED

REDUCED SWNDLE

RATE OF ASSEMBLY ACIIVATION OF MPF (ENTRY INTO MITOSIS)

INACTIVATION (EXIT FROM

-c

UNIX

The inactivation of MPF can be made to follow the completion of spindle assembly in two ways. In feedback control the incompletely assembled spindle generates a signal that inhibits the inactivation of MPF, thereby preventing exit from mitosis until spindle assembly is finished. Reducing the rate of spindle assembly delays the inactivation of MPF, so that cells spend more time in mitosis and therefore still segregate their chromosomes normally. In cells that lack feedback controls but have a timing mechanism, the events leading to the inactivation of MPF and spindle assembly are both triggered by the activation of MPF, but MPF inactivation takes longer than spindle assembly. If the rate of spindte assembly is reduced, cells exit from mitosis before spindle assembly is complete, leading to errors in chromosome segregation and cell death.

OF MPF MITOSIS)

CELL LEA YES ASVOSIS BEFORE SPlNDLE IS FULL V ASSEMBLED

inactivation of MPF occurs before the spindle assembly is finished, these mutant cells will exit mitosis with incompletely assembled spindles and die, probably as a consequence of inaccurate chromosome segregation (Figure 1). We used benomyl, an inhibitor of microtubule polymerization, to slow spindle assembly. Growth on medium containing anti-microtubule drugs considerably lengthens the cell cycle of MAD cells, presumably due to slower assembly of the mitotic spindle and the ability of the mitotic feeclback control to delay the exit from mitosis until spindle assembly is complete (Johnston and Singer, 1983). Under these conditions the time taken to complete spindle assembly is much longer than the time that it would take to inactivate MPF in mutants that no longer possess the feedback control over the exit from mitosis. Although these mutants will grow normally on benomyl-free medium, they should exit mitosis with incompletely assembled spindles in the presence of benomyl and die. Thus feedback control mutants will be present in collections of benomyl-sensitive mutants. Benomyl-sensitive growth could be due either to lesions in feedbackcontrol, or to mutations in tubulin (Stearns and Botstein, 1988) or other proteins (Hoyt et al., 1990; Stearns et al., 1990) that make spindle assembly more sensitive to disruption by benomyl. Benomyl-sensitive mutants defec-

tive in structural components of the spindle will not assemble a spindle at a concentration of benomyl that delays but does not block the completion of spindle assembly in MAD cells, and will therefore suffer cell cycle arrest at this concentration of benomyl. In contrast, the madmutants, which cannot delay the exit from mitosis, will initially divide faster than MAD cells in the presence of benomyl. We screened 10,000 colonies arising from ethyl methanesulfonate (EMS)-mutagenized cells and found 12 colonies that were unable to grow on 15 fig/ml benomyl. To distinguish between mad and structural mutants, we performed microcolony assays on the benomyl-sensitive mutants. Cells were plated on plates containing 15 pglml benomyl, and the growth of individual cells was examined over the next 12 hr. Figure 2 shows that MAD cells divide slowly and continuously at this concentration of benomyl. Five of the benomyl-hypersensitive mutants divide more rapidly than MAD cells and are candidates for mitotic feedback control mutants. The division of these mutants on benomyl-containing plates is almost as fast as that of MAD strains on plates without benomyl (data not shown). Although the initial divisions of the mutants are rapid, cell division ceases on further incubation, yielding microcolonies containing between 20 and 50 dead cells (data not shown). We suggest that these mutants are not able to

Feedback 521

Control

of Mitosis

in Budding

--+-

Yeast

MAD mad2

-I 0

3

6

time, Figure

2. Microcolony

Assay

on mad2

9

12

hrs and tub7 Ceils

Single cells of a stationary phase culture were picked with a dissection needle on YEPD plates containing 15 @ml benomyl and incubated at 23%. The number of cells in each of 50 microcolonies was counted under a light microscope at the indicated times, and the average number of cells per microcolony was calculated. Each visible object was scored as a cell, so that a cell plus a bud is scored as two cells. The strains are indicated as follows: open circles, Al (MAD); closed circles, BEN19 (ma&?); squares, BEN25 (tubl).

delay cell division when spindle assembly is inhibited by benomyl, leading to massive chromosome loss. These mutants are also sensitive to 5 pglml nocodazole, another microtubule-depolymerizing drug. Tetrad analysis indicated that the phenotype in each of the five mad mutants is due to a single recessive genetic defect. Complementation and allelism tests showed that the five mutants fall into three complementation groups designated madl, mad2, and mad3, of which mad7 has three members and mad2 and mad3 each have one. The remaining seven benomyl-sensitive mutants are probably mutations in structural components of the spindle: they budded only once on benomyl-containing plates and arrested with a single large bud (Figure 2). Complementation and allelism testing revealed that one of these mutations is t&l-73, a new mutant allele of TU87, the major a-tubulin gene (Schatz et al., 1986). Benomyl Kills mad Mutants at Nuclear Division At what point in the cell cycle does benomyl kill mad mutants? Cells were synchronized in Gl by treatment with a factor and were then released from the block into medium containing 15 pglml benomyl. At different times after release from the a factor block, one sample of cells was plated on medium lacking benomyl to determine viability, and another was fixed and stained with DAPI (4’,6diamidino-2-phenylindole) to determine their nuclear morphology. After release from a factor into benomyl, MAD cells bud within 1 hr and then accumulate a&cells with large

buds. DAPI staining showed that these cells are delayed in mitosis: the nucleus is located in the neck and is partially elongated (data not shown). Figure 3A shows that 3 hr after release, only 10% of the elongated nuclei had divided, whereas cells incubated in the absence of benomyl completed nuclear division within 2 hr of release from the a factor block (data not shown). Although their cell cycle was delayed, the viability of MAD cells remained high during the 3 hr benomyl treatment. In mutantsof each of the three mad genes, nuclear division started to occur 1.5 hr after release from a factor into benomylcontaining medium, and about 90% of the nuclei had divided by 3 hr. The viability of mad cells stayed high through nuclear elongation and dropped abruptly as nuclear division took place. The extent of cell death almost exactly paralleled the fraction of cells that had completed nuclear division (Figures 3D-3F). We tested whether the lethal effects of benomyl on mad mutants required passage through mitosis. When mad2 cells were transferred to benomyl-containing medium that also had 5 pglml a factor, the cells remained arrested as unbudded cells with undivided nuclei and their viability remained high (Figure 3B). Release of mad2 cells from the a factor block into benomyl-containing medium that also contained either 4 mg/ml hydroxyurea (a DNA synthesis inhibitor, which at this concentration prevents the completion of DNA synthesis during the time of the experiment), produced viable cells that were arrested with large buds and undividednuclei(Figure3C). Theseexperimentsdemonstrate that benomyl kills mad cells only as they pass through nuclear division, suggesting that the lethal event is the attempt to segregate chromosomes in the absence of a fully functional spindle. Benomyl Hypersensitivity Can Be Rescued by Cell Cycle Delay in S Phase If the failure of mad mutants to grow in the presence of benomyl is due to the inability of improperly assembled spindles to delay the exit from mitosis, then an independent means of delaying the exit from mitosis should allow mad mutants to grow on benomyl. In budding yeast, formation of a short intranuclear spindle occurs during S phase. Therefore the feedback controls that detect the presence of unreplicated DNA must act either to prevent some event that induces a maturation of the spindle (the equivalent of entry into mitosis in other organisms), or to prevent the exit from mitosis that triggers chromosome separation. In either case, the effect of slowing down DNA synthesis will be to increase the interval between the beginning of spindle assembly and the end of mitosis, allowing longer for spindle assembly and suggesting that low doses of DNA synthesis inhibitors should rescue the benomyl hypersensitivity of mad mutants. We used the benomylsensitive t&l-73 mutant as a control for these experiments, since these cells are presumed to be sensitive to benomyl because they cannot assemble a spindle, rather than because they pass through mitosis precociously. We determined that growth on 2.5 mglml hydroxyurea substantially lengthened the cell cycle, presumably by increasing the duration of S phase (data not shown). Cells

Cdl 522

C

A loo-

MAD,

ben

mad2,

loo:

ben + aF

g

80.

S

80-

3 B 8

60.

8 B z

60-

40.

1

0

2

3

ben

.

1 time, hr 2

3

time, hr

mad2,

ben + HU

40-

0

time. hr

1

time, hr

2

3

D loo]

madl.

i

Figure

0

3. Benomyl

100,

I

Kills mad

4

Mutants

at Nuclear

0

mad2.

I

ben

I

1 time, hr 2

,

1

3

100,

mad3.

4

0

1

time, hr

ben

1

I

2

3

Division

Cells were synchronized in Gl by treatment with 5 pg/ml a factor in YEPD for 3 hr. They were then transferred into YEPD containing either 15 ug/ ml benomyl (A, D, E, and F), 15 ug/ml benomyl plus 5 fig/ml a factor(B), or 15 uglml benomyl and 4 mglml hydroxyurea (C). At the indicated times after the end of the initial a factor treatment, cells were plated on YEPD plates to determine viability, or fixed and stained with DAPI to determine their nuclear morphology. (A) A MAD strain (Al) released into benomyl; (B) a mad2 strain (BEN1 9) transferred into benomyl plus o factor; (C)a mad2 strain (BEN19) released into hydroxyurea plus benomyl; (D) a mad7-l strain (BEN24) released into benomyl; (E) a mad2 strain (BENIS) released into benomyl; (F) a mad31 strain (BEN30) released into benomyl. Open squares, the percentage of dead cells; closed squares, the percentage of cells that have completed nuclear division.

from a MAD strain, mutants in all three mad genes, and the f&l-73 mutant were spotted on plates that contained either 15 uglml benomyl or 15 uglml benomyl plus 2.5 mgl ml hydroxyurea. Figure 4 shows that the t&l-73 mutant failed to grow on either the benomyl or the benomyl plus hydroxyurea plate. In contrast, although the mad mutants failed to grow on benomyl, they all showed strong growth on the plates that contained both benomyl and hydroxyurea. This result shows that mad mutants die on benomyl because they cannot delay the exit from mitosis, rather than because of mechanical difficulties in nuclear division,

and therefore suggests that the mad mutants deficient in feedback control.

are truly

The Microtubule Cytoskeleton of mad Mutants Many mutations in yeast that affect mitosis alter the stability of microtubules (Hoyt et al., 1990). We examined the benomyl sensitivity of the microtubules of the mad mutants. We performed anti-tubulin immunofluorescence on exponentially growing MAD, t&l-73, and mad cells, or cells that had been treated with 15 uglml benomyl for 3 hr. Figure 5 shows that in the tubl-73 mutant, benomyl

Feedback 523

Control

MAD

of Mitosis

in Budding

Yeast

MAD + benomyl

mad2 + benomyl

Figure

5. mad Strains

Have

Normal

Microtu-

tub7 + benomyl

treatment led to the loss of almost all microtubules. In contrast, in both MAD and mad cells, a significant minority retained visible microtubule structures even after benomyl treatment. The extent of microtubule depolymerization was similar in MAD and mad cells. In the MAD culture, a majority of the cells were arrested as large budded cells whose nuclei were at, or stretched through, the neck of the bud. Tubulin staining showed some of these M phase arrested cells had a short intranuclear spindle, but there were few elongated spindles (Figure 5). In contrast, only a minority of mad cells were arrested in M phase, and some of the cells with dividing nuclei had elongated spindles (Figure 5). Unfortunately, we could not quantify the spindle length distribution since many of the cells, especially those with large buds, had lost their buds during preparation for tubulin staining. MAD Genes Regulate the Inactivation of Hl Kinase The wild-type products of the MAD genes must be involved in the pathway whereby incompletely assembled spindles prevent the exit from mitosis. Studies on both embryonic and somatic cell cycles have strongly suggested that this transition is triggered by inactivation of MPF: the activity of MPF, assayed as histone Hl kinase, declines at the onset of anaphase (Meijer and Pondhaven, 1988; T. Hunt and J. Ruderman, personal communication); forms of MPF that cannot be inactivated arrest cells in metaphase (Murray et al., 1989; Ghiara et al., 1991); inhibitors of microtubule polymerization arrest cells in metaphase with high levels of MPF (Draetta and Beach, 1988); and the inactivation of the catalytic subunit of the kinase can induce exit from mitosis (Ghiara et al., 1991). We tested whether the MAD2 gene product played a role in maintaining high levels of Hl kinase activity in benomyltreated cells. MAD and mad2 cells were released from the a factor block into medium with and without benomyl.

CDC28containing kinase activity was assayed as Hl kinase activity in crude cell extracts, and cells were scored for morphology during cell cycle progression. In benomylfreemedium, theH1 kinaseactivityof both MADandmad2 cells peaked during mitosis and then dropped at the time of nuclear division, before increasing again during the next cell cycle (Figures 6A and 6C). In MAD cells in the presence of benomyl, Hl kinase levels remained high as the cells are delayed in M phase (Figure 66). However, mad2 cells treated with benomyl failed to arrest in mitosis, and there was no stabilization of Hl kinase activity (Figure 6D). Experiments in exponentially growing cultures showed that the mad7 and mad3 mutants are also unable to maintain elevated levels of Hl kinase when treated with benomyl (data not shown). These results demonstrate that products of the MAD genes are required to maintain high Hl kinase levels in response to the failure to complete spindle assembly. mad Mutations Increase the Rate of Chromosome Loss If mitotic feedback controls play a role in ensuring the accuracy of chromosome segregation, mutations in these controls should result in increased frequencies of chromosome loss. We investigated the loss of chromosome Ill in the mad mutants by a mass mating assay using haploid strains (Gordenin et al., 1990). Loss of MATa information from chromosome Ill of a haploid strain converts the cell into an a-mating strain that will now mate to a MATa tester (McCusker and Haber, 1981). The MATa information can be lost as the result of mutation, gene conversion, or the loss of all or part of chromosome Ill. In the latter case, the cells will be inviable but can be rescued by mating to a MATa cell. Cells that have lost all of chromosome Ill can be distinguished from the other classes of event, because only those cells that have lost all of chromosome Ill will

Cdl 524

A

B MAD2

MAD2

ooo8Rs:g O=rIDcorrrrr

C

pius 15 ug/mt

benomyl

o~gg$a~~g

cl

D

mad2

Cl

benomyl r

s-

F

+

--m--=-

-

I^*

have also lost the LEUP gene that lies on the opposite side of the centromere. MATa MAD and MATa mad strains were grown to early log phase. These cells were then transferred to fresh medium with or without 15 @ml benomyl and grown for 3 hr at room temperature before performing mass matings. While benomyl treatment of MADcells has little or no effect on the frequency of chromosome loss, all three mad mutants showed massive chromosome loss after benomyl treatment (Table 1). In addition, even in the absence of benomyl, mad7 and mad2 had 30- and l5-fold elevated rates of chromosome loss compared with MAD strains, demonstrating that the functions identified by these mutations are required for accurate chromosome segregation in otherwise unperturbed cells. In all three mad mutants the combined frequencies of partial chromosome loss, gene conversion, and mutation at MAT were virtually the same as those in MAD cells, suggesting that nuclear division in the absence of a functional spindle stimulates chromosome loss without increasing the frequency of chromosome breakage.

Table

1. mad Mutants

Strain MAD MAD madl-I mad&l mad2 mad2 mad3 mad3

MAD (DRL79.2C) and mad2 (DRL9.2A) cells were released from a factor block into YEPD with or without 15 kg/ml benomyl. Fractions of the cultures were harvested at the indicated times and assayed for Hl kinase activity as described in Experimental Procedures. (A) MADwithout benomyl; (8) MADin the presence of 15 @ml benomyl; (C) mad2 without benomyl; (D) mad2 in the presence of 15 us/ml benomyl. The timeof nucleardivision isboxed. MAD cells incubated with benomyl did not undergo nuclear division.

v-

mad2 PIUS 15 Ughnl agggggs%:

,P~O~lSZS

Figure 6. mad2 Strains Cannot Maintain Hl Kinase Activity in the Presence of Benomyl

Increase

Chromsome

Loss

Benomyl(l5 (DRL79.X) (DRL79.3C) (DRL106.3C) (DRL106.3C) (DRL95A) (DRL95A) (DRL1072A) (DRL1072A)

+ + + +

Interactions of mad2 with a Mutant That increases Chromosome Loss Rates Ultimately, we wish to determine the nature of the defect in spindle assembly, in response to which the MAD gene products arrest the cell cycle. One approach to doing so is to study the interaction between mad mutations and other mutations that affect mitosis. The inability of mad mutants to delay their cell cycle in response to microtubule-depolymerizing drugs strongly suggests that they would also fail to respond to microtubule depolymerization caused by missense mutations in tubulin genes (Stearns and Botstein, 1988) or in other genes that affect microtubule structure and stability (Hoyt et al., 1990; Stearns et al., 1990). Mutations in a number of other genes alter the fidelity of chromosome transmission and/or arrest cells in mitosis without grossly altering microtubule-containing structures (Hartwell and Smith, 1985; Palmer et al., 1990; Spencer et al., 1990). If these mutations interact with the mad mutations, it implies that they give rise to aberrations in spindle structure or function that are detected by the MADdependent feedback control.

&ml)

Total Loss (Events/Cell) 0.2 0.3 6 9300 3300 3.1 0.7 1400

x lo5

Other Events (Events/Cell)

x IO5

0.5 1.4 0.9 6 0.4 2.3 0.3 1.1

Frequencies of chromosome loss for cells growing exponentially in YEPD or cells that had been incubated in YEPD plus 15 us/ml benomyl 3 hr. Frequencies were determined as described in Experimental Procedures by mating to the tester strain DRL13.4A. Other events represent sum of partial chromosome loss, mutation, and conversion at the MAT locus.

for the

Feedback 525

Table

Control

2. mad2

of Mitosis

Interacts

in Budding

Yeast

with Achll

Relevant Genotype

% of Divisions with One Dead Progeny Cell

Cell Divisions Observed

MAD2 CHLI mad2 CHLl MAD2 Achll mad2 Achll

4 2 3 30

112 241 106 90

Pedigree analysis was performed on the indicated strains on YEPD plates. Only those divisions that produced at least one viable cell are included in the number of cell divisions observed. Strains used were DRL116.7A (mad2 CHLI), DRL116.7B (mad2 CHLI), DRL1197C (mad2 Achll), DRLl16.7D (mad2 Achll), DRLI 19.2A (MAD2 Achll), DRL179.28(MAD2Ach/7),DRL119.2C(MAD2CHL7),andDRL119.2D (MAD2 CHL7).

We examined the interaction between mad2 mutations and mutations in the CHL7 gene, which was identified in a screen for mutants with decreased fidelity of chromosome transmission (Liras et al., 1978; Spencer et al., 1990). Deletion of the CHL7 gene leads to greatly increased rates of chromosome loss, but not to increased sensitivity to benomyl or cold, suggesting that microtubule stability in these strains is normal (Gerring et al., 1990). Achll strains have a cell cycle delay between the completion of DNA replication and cell division, which is maintained in a rad9 mutant (Gerring et al., 1990). This cell cycle delay could reflect either a defect in the reactions that activate or inactivate MPF, or a defect that leads to reduced rate of spindle assembly that lengthens mitosis by activating the MADdependent feedback control over the exit of mitosis. If the latter possibility is correct the delay should be abolished in mad chll double mutants, leading to cell division with incompletely assembled spindles and increased frequencies of chromosome loss and cell death. We examined the phenotype of double mutants in mad2 and chll by sporulating and dissecting MAD/MAD and mad2/mad2 homozygotes that were heterozygous for a Achl7::HISS gene disruption. The MAD CHL7 and MAD Achll spores had indistinguishable growth rates as judged by colony size. Pedigree analysis showed that there was little cell death in either strain (Table 2). In contrast, the mad2 Achll spore colonies grew extremely slowly and had many cell divisions that produced dead cells compared with their mad2 CHL7 counterparts (Table 2). Because the chll mutation does not alter the total length of the cell cycle, and because the large fraction of dead cells in mad2 Achll cultures precludes meaningful FACS analysis, we were unable to demonstrate directly that mad2 abolished the cell cycle delay caused by Achll. Nevertheless, we conclude that the absence of the functional CHL7 gene product leads to aberrations in mitosis that are detected by the MAD-dependent feedback control pathway. MAD2 Is Essential and Calcium-Binding Protein Wecloned the MADPgene sensitivity of the mad2-7 we recovered a unique

Encodes

a Putative

by complementing the benomyl mutant. From a low copy library sequence that complemented

mad2-7 and that directed integration at the MAD2 locus (see Experimental Procedures). Deletion analysis localized the minimal complementing region, and nucleotide sequencing of a 1.4 kb fragment revealed a single open reading frame coding for a polypeptide of 294 amino acids (Figure 7A). No extensive homology to any known protein has been identified. However, Figure 76 shows that the amino acid sequences in three regions (amino acids 1 l40, 131-160, and 221-250) show an organization of hydrophobic and possible calcium-chelating amino acids that resembles that of known calcium-binding domains (Kretsinger, 1987). Comparisons of MAD2 with proteins that contain the EF hand calcium-binding domain suggest that MAD2 is not homologous to this class of calciumbinding proteins (S. Nakayama and R. E. Kretsinger, personal communication). However, a-lactalbumin (Stuart et al., 1986) and the bacterial galactose-binding protein (Vyas et al., 1987) neither of which is homologous to EF hand proteins, have calcium-binding domains that resemble the classical EF hand both structurally and in the location of oxygen-chelating amino acids and that may have arisen by convergent evolution (Kretsinger, 1987; Stuart et al., 1986; Vyaset al., 1987). Wesuggest that MAD2 may also contain calcium-binding domains that are structurally, but not evolutionarily, related to the EF hand. We investigated the phenotype of deleting MADP. Integration of the plasmid pRL9 at MAD2 deletes all but the 45 C-terminal amino acids of the MAD2 gene. pRL9 was integrated into a diploid MAD strain. Tetrad analysis of the diploid transformants showed 2:2 segregation for viability, and none of the viable spores contained the integrating plasmid. All of the dead spores had germinated and divided one to three times before arresting at apparently random points in the cell cycle. This result shows that MAD2 is an essential gene.

Discussion We have isolated mutations in three genes, MAD7, MADP, and MAD3, that are involved in regulating the exit from mitosis in budding yeast. These mutations allow cells that have not yet assembled a functional mitotic spindle to exit mitosis, leading to errors in chromosome segregation and cell death. The existence of these mutants shows that the cell cycle arrest induced by impaired spindle assembly is mediated by a cell cycle feedback control pathway and that this pathway contributes to the faithful transmission of the genetic material during mitosis. Molecular analysis of the MAD2 gene shows that it encodes a potential calcium-binding protein that is essential for viability. The accompanying paper (Hoyt et al., 1991) describes the isolation of other mutants, bubl, bub2, and bub3, that affect the feedback control over the exit from mitosis. Difficulties in complementation and allelism testing between different strain backgrounds have made it hard to test rigorously whether any of the mad and bub mutations lie in the same genes, but comparison of the cloned genes and mapping data (P. Meluh, personal communication) indicates that MAD2 is not any one of the BUB genes.

Cdl 526

A 1 83

CCCCTTTGAAGTGGTTTTCAATACTCTTGTACGAGTATTTAACATCAATCATTCTTCGGGGCGATTTCTATCTTGAAAT GTTAAATCATAAACCATACGTAAACATTTGAAATTAAAGGCAAAAAAGAAAAAAACCACATTTTTGAGCCACATAT

160

240

TCTTTTTTTTACTGACTACCAAGCAATTTTTTATATTTGCCACATTAAACAGCATGGCATTAAAAGGAAACAGTGGACCA

320

AGGAATTACTGAGACAAAAGAGAGTTCAAGACGAAAAGAAAATATATGATTATAGAAGCTTGACTGAAAATGTTTTGAAT

400 1

ATC AGA GAT MET arg asp

460 21

AAA AAT CCG GAA TTT AAT GCT ATT

520 41

TCT GAG TTG GAA ATA CCT TTC TGG GAT AAA GAG TTA GTT TTT GTA ser glu leu glu ile pro phe trp asp lys glu leu val phc val

580 61

GAT TAC CCC AAA GTC TAT TGG ATA TGG RAT CAC AGA CTT TGG GTC TTG AAA CAT TAT CCT asp tyr pro lys val tyf trp ile trp asn his arg leu trp val leu lys his tyr pro

640 81

ACG AGT TCC CCT AAA GTG TGG CAA ACT GAA CTT GCT GTC GTG AAT AAG TTA TTG GAA CAA thr ser ser pro lys val trp yin thi qlu leii ala val val as" lys leu leu glu gln

700

GAT GCA AGA AAT TAC CAC GGA TGG CAT TAC CGC AGA ATA GTT GTT GGT AAC ATA GAG AGT asp ala arq asn tyr his qly trp his tyr arq arq ile ~11 vdi qly asn ile glu sfr

101

GAA AAA ATT TAC TCA ATT GAA GCT CTG AAG AAA ACA TCA GAA CTT CTT GAG glu lys ile tyr ser ile glu pla leu lys Ivs tbr leu leu TGG ART TAC AGA AGG GAT ATT ATA GCG AGT TTG GCT

ATG ATG CTA TTG AAG met met leu leu lys

760

ATC ACT AAT AAA AGT CTT GAC AAG GAG GAG 1"I"i‘ GAA TAC CCA ACA ATA AAG ATT

AAC

RAT

121

ile

asn

-

820 141

AAC ATT TCA AAT TAT TCT GCA TGG CAC CAA AGA GTA CAG ATC ATA AGC AGA ATG TTT CAG

880

161

AAA GGA GAG GTT GGG AAT CAA AAC GAG TAT ATT CGG ACT GAA ATA TCT TAT ATC ATC AAC lys gly glu val gly asn gln lys qlu tyr ile arg thr glu ile ser tyr ile ile asn

940 181

GCT ATG TTT ACC GAC GCC GAA GAC CAA TCC GTA TGG TTT TAT ATC RAG TGG TTC ATT AAA ala met phe thr asp ala glu asp gin ser val trp phe tyr ile lys trp phe ile lys

1000 201

AAC GAC ATT GTT TGT AAA ACT CTG GAC GAA CAA GAG TAC CTT AAA ATG TTG AAA GAC TTG asn asp ile val cys lys thr leu asp glu gln glu tyr leu lys met leu lys asp leu

1060 221

AGA GAA AAC ATT CTG TTA ATA AAT AAT GAC GAA ATT GAA TTT TCC GGG AAG CAA AAT ATT =rg alu le" ~~LJL.z ==n as al" ~'e 01" he ser 41~ 1~s aln =sn JA

1120 241

TGG TGC TTG AAA ATT TTA TTA GTT CTC GAA GAT ATT CTG GAA GAA AAG GAA GCT CTA ACG m CYS leu lvs ile ale" v&j leu & asp ile leu glu glu lys qlu ala leu thr

1180 261

GAA AGA AGC TCG GAA CAA TAT TTG GTC CAA TTA ATA GAT GCG GAT CCG TTA AGA RAG AAT glu arg ser ser glu gin tyr leu val qln leu ile asp ala asp pro Leu arg Lys asn

1240 281

AGA TAC CTA CAT CTC CTG GAG CAG CAT AAG TGA TGA TATACATATATAACATATATATATATGTATA arg tyr leu his Leu leu glu gln his lys OPA OPA

1307

TATGATGGAAGCCTGTTCACTATAAG

B

thr

EL

asn

LL

lys

LD

sfr

leu

D

asp

DG

iys

glu

LD

qlu

DL

be

oiv

tvr

LL

ua#

DUO

L

thr

11e

lvs

ile

Hydrophobic/Chelating Matches

pattern Protein

55

E_&DAUEEYPEPGSGTIPFE~~LV~RQ~

16/16

rabbit

81

ETKTUKAGPSPGPGKIGVDEETAUKA

12/16

carp

tropc~in parvalbumin

71

N1CDLSCDKFLPDPITDpIMCAKKUDIK

7/16

human

125

KHWABNQGWPLtiKPGQrQFVLbKGEPGHP

S/16

galactose

221

ENILUNNDgIEFSGKQ~IWC~KIUVLE

11/16

MdDZ,

130

EFEYPTIKIhNKISNYSAWHQRVQ~SR~

10/16

MAD.?,

aa130-159

11

ALKKTSELLHKKPgFNAIWNXRRD~AS~

9/16

M?.DZ,

aall-40

Figure

7. MAD2

Is a Putative

Calcium-Binding

C

a-lactalbumin binding

protein

~1.~221-250

Protein

(A) The nucleotide sequence of the MAD2 coding region and its flanking Underlined sequences are regions of similarity to known calcium-binding

sequence proteins.

are shown.

The deduced

protein

sequence

is also shown

Feedback 527

Control

of Mitosis

in Budding

Yeast

MAD-Dependent Mitotic Feedback Control In normal yeast cells, anti-microtubule drugs, such as benomyl, cause a reversible cell cycle arrest in mitosis. In contrast, the mad?, mad2, and mad3 mutants do not arrest and are rapidly killed by benomyl. A number of lines of evidence suggest that the products of the MAD genes are part of a feedback control over the exit from mitosis: the death of mad mutants coincides with the time of nuclear division, and treatments that block nuclear division block the lethality of benomyl; reducing the rate of DNA synthesis increases the duration of mitosis and allows mad mutants to grow on concentrations of benomyl that are otherwise lethal; and benomyl treatment of mad mutants induces chromosome loss at very high frequencies, consistent with the hypothesis that chromosome loss is the primary cause of death of benomyl-treated mad cells. The mad mutants are clearly distinct from mutants defective in structural components of the spindle, such as tubl, whose cell cycle is arrested by concentrations of benomyl much lower than are needed to arrest wild-type cells. How does the MAD-dependent feedback control arrest the cell cycle? A great deal of evidence supports the hypothesis that the exit from mitosis is triggered by the destruction of cyclin that leads to the inactivation of MPF, the cdc2/CDC28-containing kinase. Therefore the MAD-dependent feedback control should act by stabilizing MPF activity in cells with incompletely assembled spindles. It has been shown that CDC28-containing kinase activity may be monitored as the Hl kinase activity present in crude yeast extracts (Langan et al., 1989). We have demonstrated that MAD cells maintain high levels of Hl kinase when passage through mitosis is delayed by growth in the presence of benomyl. In contrast, benomyl treatment of mad mutants neither blocks passage through mitosis nor maintains high levels of Hl kinase activity. We conclude that the MAD gene products arrest the cell cycle in mitosis in the presence of benomyl by maintaining high levels of MPF activity. It remains to be determined whether these gene products interact directly with mitotic cyclins or CDC28, or act indirectly to prevent MPF inactivation. Interesting parallels can be drawn between MADdependent cell cycle arrest and the physiological arrest of unfertilized frog eggs in metaphase of meiosis II. The latter arrest is mediated by an activity named cytostatic factor, which is intimately related to the product of the c-mos proto-oncogene (Sagata et al., 1989) and prevents the degradation of cyclin by an unknown mechanism. Fertilization leads to a transient increase in the intracellular calcium concentration, which in turn induces the degradation of c-mos and cyclin. Cytostatic factor acts as a feedback regulator of the embryonic cell cycle, which makes

exit from mitosis dependent on fertilization. In a variety of cell types increases in intracellular calcium concentrations are associated with both the entry into and exit from mitosis (Poenie et al., 1988; Steinhardt and Alderton, 1988; Tombes and Borisy, 1989), and premature rises in intracellular calcium concentrations can induce precocious entry into mitosis (Twigg et al., 1988). We propose that the role of these transients is to inactivate components like cytostatic factor that act as inhibitors of cell cycle progress and thus mediate feedback controls of the cell cycle. It is intriguing that the deduced protein sequence of MAD2 shows similarities to known calcium-binding domains. Ensuring the Completion of Events in the Cell Cycle Many events in the cell cycle are not initiated until previous events have been completed. There are three mechanisms to ensure this coordination. The first is a substrateproduct relationship: the product of the early event can be a substrate for the later one. The dependence of cytokinesis on budding in S. cerevisiae is an example of such a relationship. The second is a timing mechanism: the reactions that lead to two events are initiated at the same time, but take different periods to complete so that the endpoint of one set of reactions is reached before that for another. Timing mechanisms are particularly visible in some early embryonic cell cycles (Hara et al., 1980; Kimelman et al., 1987; Picard et al., 1988; Raff and Glover, 1988) that lack other detectable coordination mechanisms. In at least one case, the inability of unreplicated DNA to block entry into mitosis in early frog embryos and the apparent lack of feedback controls reflect a requirement to reach a critical nucleus to cytoplasm ratio before the feedback controls become competent to arrest the ceil cycle (Dasso and Newport, 1990). Feedback controls, which prevent the initiation of an event until the completion of an earlier event, are the third mechanism for ordering events in the cell cycle. It now seems likely that many of the treatments that delay or arrest progress through the cell cycle do so by activating feedback controls (Hartwell and Weiner?, 1989). These controls must have three parts: a system for detecting the failure to complete a particular event, a signal that is generated by the incomplete event, and a mechanism by which this signal inhibits a biochemical reaction, such as the activation or inactivation of MPF, that mediates passage through the cell cycle. An important goal is to determine the extent to which feedback controls and timing controls act as redundant mechanisms to coordinate events within the cell cycle. It is likely that some of the rate-limiting steps in the sequence of reactions that form timing mechanisms are the targets

(6) The putative calcium-binding sequence ofMAD and the relevant regions of troponin, parvalbumin, a-lactalbumin. and bacterial galactose-binding protein are aligned with the pattern of hydrophobic and calcium-chelating amino acids (in bold) characteristic of the EF hand calcium-binding domain. D in the pattern sequence represents an amino acid with an oxygen-containing side chain: aspartate, aeparagine. glutamate, glutamine, serine, threonine, and tyrosine. L represents one of the following hydrophobic amino acids: leucine, isoleucine, valine, phenylalanine. and methiinine. The residues in the protein sequences that correspond to the EF hand pattern are italicized and underlined. Amino acids in the sequences Of troponin C, parvalbumin. a-lactalbumin, and the galactose-binding protein, which chelate calcium in the crystal structure of these proteins, and putative caloum-chelating amino acids in MADP, are in bold.

Cdl

528

Table

3. Strain

List

Name

Genotype

Source

Al A2 A3 BEN19 BEN24 BEN30 BEN25 BEN76 DRL9.2A DRL79.2C DRL9.5A DRLlO.GC DRLI06.3C DRL12.4B DRL79.5A DRLl07.2A DRL79.3C DRL13.4A DRL118.7A DRLll8.78 DRLI l8.7C DRL118.7D DRLl19.2A DRLl19.28 DRL119.2C DRL119.2D

a his3 leu2 trpl ura3-52 a his3 /au2 trpl ura3-52 Arad9::LEUP

T. Weinert T. Weinert N. Hollingswotih This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work

(I ade2-1

his7 ura3-52 trpl ura3-52 Arad9::LElJP trpl ura3-52 Arad9::LELJP trpl ura3-52 Arad9::LEUZ trpl ura3-52 AradS::LElJ2 rrpl ura3-52 Arad9::LEUP a his7 leu2 mad2-1 trpl ura3-52 a leu2 trpl ura3-52 a his3 mad2-1 ura3-52 (I ade2 madl-1 trpl ura3-52 a his3 mad+1 ura3-52 a his3 leu2 mad3-1 trpl ura3-52 a ura3-52 a his3 mad3-1 ura3-52 a ade2 his3 trpl ura3-52 a ade2 his7 leu2 ura3-52 a his3 leu2 ura3-52 mad2-1 a his3 leu2, ura3-52 mad2-l (1 his3 ura3-52 mad2-1 Achll::H/SS a his3 ura3-52 mad2-1 Achll::H/SS a his3 ura3-52 Achll::HISS a his3 ura3-52 Achll::H/SS a his3 trpl ura3-52 cz his3 trpl ura3-52

a his3 leu2 mad2-1 a his3 leu2 madl-1 a his3 leu2 mad3-1 a his3 leu2 tubl-13, a his3 leu2 madl-3

that are regulated by feedbackcontrols. Mutations in these targets may affect both the intrinsic timing mechanism and the ability of feedback controls to regulate cell cycle timing, and will therefore be scored both as timing and feedback control mutants. It will be useful to distinguish those mutants that affect only feedback controls from those that affect both feedback and timing controls. Only by carefully making this distinction can we accurately assess the importance of feedback controls in the cell cycle. One well-studied feedback control is the ability of unreplicated DNA to prevent entry into mitosis. This has been identified by conditions that overcome the cell cycle arrest caused by unreplicated DNA, including caffeine treatment of mammalian cells (Schlegel et al., 1987; Schlegel and Pardee, 1988), the bin% mutation of Aspergillus (Engle et al., 1990; Osmani et al., 1988) and the tsBN2 mutation of CHO cells (Nishimoto et al., 1978), and, in fission yeast, overexpression of c&25 or certain mutations in c&2 (Enoch and Nurse, 1990). The bimf and tsBN2 mutations are lethal even when DNA replication is normal and may therefore identify important timing components, while the mutations in fission yeast are viable in cells that have not been treated with inhibitors of DNA synthesis. The best-characterized feedback control in budding yeast is the cell cycle arrest caused by damaged DNA. Mutations in the RAD9 gene abolish this feedback control and increase frequencies of chromosome loss, but the deletion of the gene is not lethal, suggesting that this gene is involved exclusively in feedback control and that in most cells the successful repair of lesions in DNA, such as single-stranded gaps that are formed during DNA replication, is mediated by timing controls (Weinert and Hartwell, 1988; Hartwell and Weinert, 1989).

Deletion of the MAD2 gene is lethal. This lethality can be explained in three ways: the feedback control induced by unassembled spindles is required in every cell cycle to prevent precocious exit from mitosis; the gene product functions in other essential cellular processes in addition to feedback control; and MAD2 is involved in both feedback and timing controls. Interaction of mad Mutants with Other Mitotic Mutants What is the molecular nature of the spindle defect detected by the spindle assembly feedback control? One method of answering this question is to identify a number of different conditions that lead to MAD-dependent cell cycle delay or arrest. This can be done by crossing mad mutants to other mutations delaying the progression through mitosis. The disruption of the CHL7 gene in amad2strain leads to avery high frequency of cell death. Since the CHL7 disruption in MAD strains delays the cell cycle after the completion of S phase, but does not affect microtubule number or stability (Gerring et al., 1990), the chll mutation is likely to delay spindle assembly by affecting a target other than microtubules. It has also been shown that the combination of the mad2 mutation and the disruption of the KAR3 gene is lethal (P. Meluh and M. Rose, personal communication). The KAR3 gene product shows sequence homology to the microtubule motor kinesin and can associate with microtubules, and the gene disruption causes a delayed passage through mitosis (Meluh and Rose, 1990). One interpretation of the lethality of the mad2 Akar3 double mutant is that the KAR3 gene product is a component of the spindle and that the absence of this protein reduces the rate of spindle assembly activating the MAD-dependent feed-

Feedback 529

Control

of Mitosis

in Budding

Yeast

back control. We suggest that lesions in the mitotic apparatus, rather than alterations in the monomerpolymer ratio of tubulin, are the primary signals for the MAD-dependent cell cycle feedback control. The presence of feedback controls can make it difficult to assess the structural requirements for cell cycle events. For example, in yeast the mitotic arrest induced by microtubule polymerization inhibitors has made it impossible to assess the role of microtubules in nuclear division and cytokinesis, since these events occur as cells leave mitosis. The mad mutants, therefore, provide a potentially unique system where the role of microtubules can be reevaluated. Our preliminary results have shown that when cellular microtubules are eliminated, by treating mad mutants with high concentrations of benomyl or nocodazole, cytokinesis and nuclear division continue to occur (unpublished data). Thus studies of feedback control mutants promise to shed light on individual steps of the cell cycle, in addition to the mechanisms that ensure the faithful transmission of genetic information and the connections between regulatory and structural events in the cell cycle. Experimental

Procedures

Media and Genetic Methods Yeast media and genetic manipulations were performed as described (Sherman et al., 1974). Pedigree analysis was performed as described (Murray and Szostak, 1983). Strains used in this work are listed in Table 3. Drug and a Factor Treatments Benomyl, nocodazole, and a factor stock solutions were 15 mglml, 10 mglml, and IO mg/ml. respectively, in DMSO. Media containing benomyl and nocodazole were made by addition of the stock solutions into hot YEPD media. Benomyl and nocodazole treatments were generally carried out at 23’C. Cells were arrested in Gl by incubating cultures at IO’ cells per ml in YEPD containing 5 kg/ml a factor for 2 hr at 30°C, or 3 hr at 23OC. Synchronous release from this block was accomplished by washing the cells and transferring them to fresh YEPD without a factor. Mutant Isolation The mad mutants were isolated in a screen for benomyl- or hydroxyurea-sensitive mutants that was conducted in a fad9 background. Cells (log) of strain A2 were mutagenized with EMS to 70% killing. Approximately 10,000 colonies were plated on 100 YEPD plates and grown for 3 days at 23OC. These plates were subsequently replica plated to YEPD plus 15 us/ml benomyl. Benomyl-hypersensitive colonies were identified after 2 days of incubation at 23OC. Mutant strains were outcrossed to demonstrate that benomyl sensitivity segregated as a single recessive mutation and to remove the fad9 mutation and other unlinked mutations. Mlcrocolony Assays Exponentially growing cultures were spotted sparsely onto either YEPD or YEPD plus 15 ug/ml benomyl plates. Punch marks were made by a dissection needle next to small-budded single cells. The number of cells (buds) in each marked microcolony was counted after different times of incubation at 23OC. Mlcroscopy For microscopy cells were harvested, fixed, and stained with antibodies to a-tubulin and with DAPI to visualize DNA as described (Stearns et al., 1990). Cells were photographed on a Nikon FX-A microscope with a 100 x oil objective. Chromosome Loss Measurements Chromosome loss was measured by a quantitative mating assay. Haploid MATa LEU.2 his3 HIS7 strains, whose chromosome loss frequency

was to be determined, were mated to DRL13.4A, a MATa leu2 HIS3 his7tester strain. Diploids were selected on medium without histidine. Cells from these strains can only mate if one of the two strains loses its copy of MATa and thus becomes a-mating. Complete loss of chromosome from the LEU2 strain gives rise to His’ Leu- diploids. Loss of part of chromosome Ill from the LEU2 strain, gene conversion, and mutation at MAT, or loss of all or part of chromosome Ill from the leu2 tester, produces-His+ Leu’ diploids. Thus the frequency His+ Leu diploids gives the frequency of total loss of chromosome Ill in the LEU2 strain being tested, while the frequency of His+ Leu’ diploids gives the combined frequency of loss of part of chromosome Ill from the LEU2 strain, gene conversion, and mutation at MAT, or loss of all or part of chromosome Ill from the leu2 tester. Since the same tester strain was used for all matings, changes in the frequency of His* Leu’ diploids must reflect differences in events in the LEM strain. To perform quantitative matings, cultures of MAD and mad strains were grown to early log phase in YEPD medium, which contained a factor to prevent any viable MATa cells that arose in the culture from dividing. These cells were then transferred to fresh YEPD with or without 15 ug/ml bunomyl and incubated for 3 hr at room temperature. Viable cell number after these incubations was determined by plating out a portion of the culture on YEPD plates. The matings were carried out on filters as previously described (Murray et al., 1966). Diploid His+ colonies resulting from mating were subsequently tested for leucine auxotrophy. The frequency of chromosome loss is the number of His+ Leu diploids divided by the number of viable cells. The reversion frequency of the leu2 his3 and his7alleles was negligible. Comparison of the number of diploids produced by mating the benomyl-treated strains to a MA Ta tester (which mates to cells that have not lost chromosome Ill) to the number of viable cells after benomyl treatment demonstrated that there is not a substantial population of cells that are incapable of giving rise to colonies but can be rescued by mating. Histone Hl Klnase Assay Cultures (500 ml) of exponentially growing cells were arrested with a factor and released into YEPD with or without 15 uglml benomyl. Aliquots (50 ml) were harvested, washed with 500 nl of extraction buffer (EB; 60 mM f3-glycerolphosphate, 15 mM MgCk, 20 mM K-EGTA, 50 mM K-HEPES [pH 7.51) and resuspended in 250 ul of EB with protease inhibitors (10 uglml each leupeptin, chymostatin, and pepstatin). Cells could be stored frozen at -7OOC after resuspension in EB without affecting the final assayed level of Hi kinase. The resuspended cells were vortexed for 10 to 15 1 min pulses with an equal volume of glass beads (tubes were chilled on ice for 1 min after each pulse and the whole procedure was carried out in a cold room). The homogenates were spun at 15,000 rpm for 15 min at 4°C. To precipitate cell wall fragments, cold acetone was added to the supernatants to give a final concentration of 20% (v/v). After 5 min on ice, followed by spinning for 15 min at 15,000 rpm, the supernatants from acetone precipitation were aliquoted and stored at -70°C. Protein concentrations were measured by the method of Bradford (1976). Acetone supernatants were diluted to 0.1 mglml in EB plus protease inhibitors. Kinase reactions (16 nl) contained 0.375 mM ATP. 105 uglml histone Hl (Boehringer Mannheim), 0.5 PCi of [y-“P]ATP. and 10 ul of the diluted extracts and were incubated at room temperature for 15 min before stopping the reactions by adding SDS sample buffer, electrophoresing the reaction products on 10% SDS-polyacrylamide gels, and analyzing them by autoradiography. Cloning of MAD2 A YCp50 library(Rose et al., 1987) was introduced into strain DRL9.2A by lithium acetate transformation. The Ura’ transformants were replica plated onto YEPD plus 15 @g/ml benomyl, and benomyl-resistant colonies were picked after 3 days at room temperature. Plasmids were recovered by preparing DNA from benomyl-resistant clones and transforming Escherichia coli strain BAl (Murray et al., 1966) to ampicillin resistance byelectroporation. Plasmid DNA was then transformed into DRL9.2A to test its ability to suppress the mad2 mutation. Two overlapping clones, PRLl and PRLlO, were obtained by this procedure. The Insert in PRLl was subcloned as a 5.6 kb Clal-Sphl fragment into Ylp5 to yield the plasmid pRL2, which was targeted to integrate into the homologous locus in DRL92A by digestion with Xhol. Analysis of the resulting Mad+ transformants on Southern blots showed that integra-

Cdl 530

tion had occurred at the site of homology to the insert on pRL2. These Mad+ strains were mated to a MAD strain to create a diploid that was sporulated and dissected. No benomyl-hypersensitive spores were seen in 16 four-spored tetrads, showing that the cloned gene is MADP, or a locus that is tightly linked to it. A disruption of MADPwas created that removes genomic sequences from 19 bp upstream of the initiator methionine to about amino acid 240 of MAD2 by integrating the plasmid pRL9 at the MAD2 locus. pRL9 was created by ligating a 2.6 kb BarnHI-Hindlll fragment that lies just upstream of the MAD2 gene to a 0.1 kb BamHI-Sacl fragment that contained sequences near the C-terminus of MAD2 from about amino acid 240 to amino acid 275, at their BamHl sites, and inserting the resulting fragment into the URA3 plasmid pRS306(Sikorski and Hieter, 1969). A diploid MAD strain was transformed with BarnHI-cut pRL9, and Southern blotting (Southern, 1975) confirmed that pRL9 had integrated at and disrupted one copy of the MAD2 gene. The transformant was sporulated and dissected and gave rise to tetrads that contained two viable and two dead spores.

Nucleotlde

Sequence

Analysis

of MAD2

The 5.3 kb insert in PRLI was subcloned into pRS316 as a Clal-Sphl fragment to yield pRL3, and a series of deletions was generated from either end of the insert byexonuclease Ill digestion. The minimal DNA fragment that could complement mad2 was determined by testing whether different deletion plasmids could suppress the benomyl hypersensitivity of DRL9.2A. A 1.4 kb stretch of contiguous DNA sequence containing all but the C-terminal 15 amino acids of the MAD2 open reading frame was determined by sequencing on both strands by the dideoxy chain termination method using Sequenase (US Biochemical Corp.). Neither PRLl nor PRLlO contains the C-terminal sequence of MADP. This region was recovered from a derivative of DRL9 that had pRL2 integrated at MADP. Genomic DNA from this strain was digested with Clal, which does not cut within the MAD2 insert in pRL2, ligated, and transformed into E. coli to yield plasmid pRL11, which contained the entire MAD2 open reading frame. Sequencing of this plasmid provided the missing C-terminal sequence of MADL.

Acknowledgments We thank Ted Weinert and Lee Hartwell for inspiration, supplying strains, and many stimulating discussions and Andrew Hoyt for helpful discussions and for communicating his results before publication. We are grateful to Sandra Gerring, Nancy Hollingsworth, Jeremy Minshull, Mark Schena, Marc Solomon, and Peter Sorger for supplying strains, reagents, and advice and to Ray Deshaies, Jeremy Minshull, Tim Mitchison, David Morgan, Caroline Shamu, Peter Sorger, and Tim Stearns for comments on the manuscript. We are especially grateful to Sandy Johnson and members of his laboratory for their hospitality and tolerance. A. W. M. is a Lucille P. Markey scholar, and this work was supported in part by a grant from the Lucille P. Markey Charitable Trust. We thank NIGMS for general support of this work. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisemenl’ in accordance with 16 USC Section 1734 solely to indicate this fact. Received

April 16, 1991; revised

June

11, 1991

References Bradford, M. (1976). A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254. Dasso. M., and Newport, J. W. (1990). Completion of DNA replication is monitored by a feedback system that controls the initiation of mitosis in vitro: studies in Xenopus. Cell 61, 611-623. Draetta, G., and Beach, D. (1988). Activation of cdc2 protein kinase during mitosis in human cells: cell cycle-dependent phosphorylation and subunit rearrangement. Cell 54, 17-26. Engle, D. B., Osmani, S. A., Osmani, A. H., Rosborough, S., Xin, X. N., and Morris, N. R. (1990). Anegative regulator of mitosisinAspergi//usis a putative membrane-spanning protein. J. Biol. Chem. 265, 1613216137.

Enoch, T., and Nurse, P. (1990). Mutation of fission yeast cell cycle control genes abolishes dependence of mitosis on DNA replication. Cell 60, 665-673. Gerring, S. L., Spencer, F., and Hieter, P. (1990). The CHL7(CTF7) gene product of Saccharomyces cerevisiae is important for chromosome transmission and normal cell cycle progression in G21M. EMBO J. 9, 4347-4356. Ghiara, J. B., Richardson, H. E., Sugimoto, K.. Henze, M., Lew, D. J., Wittenberg, C., and Reed, S. I. (1991). A cyclin B homolog in S. cerevisiae: chronic activation of the Cdc26 protein kinase by cyclin prevents exit from mitosis. Cell 65, 163-174. Gordenin, D. A., Proscyavichus, Y. Y., Malkova, A. L.. Trofimova, M. V., and Peterzen, A. (1990). Yeast mutants with increased bacterial Tn 5 excision. Yeast 7, 37-50. Hara, K., Tydeman, P., and Kirschner, M. (1960). A cytoplasmic clock with the same period as the division cycle in Xenopus eggs. Proc. Natl. Acad. Sci. USA 77,462-466. Hartwell, L. H., and Smith, D. (1965). Altered fidelity of mitoticchromosome transmission in cell cycle mutants of S. cerevisiae. Genetics 7 10, 361-395. Hartwell, L. H., and Weinert, T. A. (1969). Checkpoints: controls ensure the order of cell cycle events. Science 246, 629-634. Hoyt, M. A., Stearns, T., and Botstein, D. (1990). Chromosome ity mutants of Saccharomyces cerevisiae that are defective tubule-mediated processes. Mol. Cell. Biol. 70, 223-234.

that

instabilin micro-

Hoyt, M. A., Totis, L., and Roberts, 6. T. (1991). S. cerevisiae genes required for cell cycle arrest in response to lossof microtubule function. Cell, this issue. Johnston, G. C., and Singer, R. A. (1963). Growth and the cell cycle of the yeast Saccharomyces cerevisiae. I. Slowing S phase or nuclear division decreases the Gl cell cycle period. Exp. Cell Res. 149, 1-14. Kimelman, D., Kirschner, M., and Scherson, T. (1967). The events of the midblastula transition in Xenopus are regulated by changes in the cell cycle. Cell 48, 399-407. Kretsinger, R. H. (1967). Calcium coordination and the calmodulin fold: divergent versusconvergent evolution. Cold Spring Harbor Symp. Quant. Biol. 52, 499-510. Langan, T. A., Gautier, J., Lohka, M., Hollingsworth, R., Moreno, S., Nurse, P., Mailer, J., and Sclafani, R. A. (1989). Mammalian growthassociated Hl histone kinase: a homolog of cd&+/WC28 protein kinase controlling mitotic entry in yeast and frog cells. Mol. Cell. Biol. 9, 3860-3868. Lau, C. C., and Pardee, A. B. (1982). Mechanism by which caffeine potentiates lethality of nitrogen mustard. Proc. Natl. Acad. Sci. USA 79, 2942-2946. Liras, P., McCusker, J., Mascioli, S., and Haber, J. E. (1978). Characterization of a mutation in yeast causing nonrandom chromosome loss during mitosis. Genetics 88, 651-671. McCusker, J. H., and Haber, J. E. (1961). Evidence breaks near the mating type locus of S. cerevisiae MATa x MATa matings. Genetics 99, 383-404. Meijer, L., and Pondhaven, P. (1988). kinase during sea urchin egg mitotic 116-129.

of chromosomal that accompany

Cyclic activation of histone Hl divisions. Exp. Cell Res. 774,

Meluh, P. B., and Rose, M. D. (1990). KAR3, a kinesin-related required for yeast nuclear fusion. Cell 60, 1029-1041. Murray, A. W., and Kirschner, M. W. (1989). union of two views of cell cycle regulation. Murray, A. W., and Szostak, J. W. (1983). segregation in yeast. Cell 34, 961-970.

gene

Dominoesand clocks: the Science 246, 614-621.

Pedigreeanalysisof

plasmid

Murray, A. W., Schultes, N. P., and Szostak, J. W. (1986). Chromosome length controls mitotic chromosome segregation in yeast. Cell 45, 529436. Murray, A. W., Solomon, M. J., and Kirschner, M. W. (1989). The role of cyclin synthesis and degradation in the control of maturation promoting factor activity. Nature 339, 280-286. Nishimoto, T., Eilen, E., and Basilica, C. (1976). Premature chromosome condensation in a ts DNA- mutant of BHK cells. Cell 75, 47% 463.

Feedback 531

Control

of Mitosis

in Budding

Yeast

Nurse, P. (1990). Universal control mechanism timing of M-phase. Nature 344, 503-508.

regulating

cell cycle

Osmani, S. A., Engle, D. B., Doonan, J. H., and Morris, N. R. (1988). Spindle formation and chromatin condensation in cells blocked at interphase by mutation of a negative cell cycle control gene. Cell 52, 241-251. Palmer, R. E., Hogan, E., and Koshland, D. (1990). Mitotic transmission of artificial chromosomes in cdc mutants of the yeast, Saccharomyces cerevisiae. Genetics 125, 783-774. Picard, A., Labbe, J. C., and Doree, M. (1988). Germinal vesicle components are not required for the cell-cycle oscillator of the early starfish embryo. Dev. Biol. 728, 121-128. Poenie, M., Alderton, J., Steinhardt, Ft. A., and Tsien, R. Y. (1988). Calcium rises abruptly and briefly throughout the cell at the onset of anaphase. Science 223, 888-889. Raff, J. W., and Glover, D. M. (1988). Nuclear and cytoplasmic mitotic cyclescontinueinDrosophi/aembryos in which DNAsynthesisisinhibited with aphidicolin. J. Cell Biol. 707, 2009-2019. Rose, M. D.. Novick, P., Thomas, J. H., Botstein, D., and Fink, G. R. (1987). A Saccharomyces cerevisiae genomic plasmid bank based on a centromere-containing shuttle vector. Gene 60, 237-243. Sagata. N., Watanabe, N., Vande Woude, G. F., and Ikawa, Y. (1989). The c-mos proto-oncogene product is a cytostatic factor responsible for meiotic arrest in vertebrate eggs. Nature 342, 512-518. Schatz, (1988). encode

P. J., Pillus, L., Grisafi, F., Solomon, F., and Botstein. D. Two functional a-tublin genes of Saccharomyces cerevisiae divergent proteins. Mol. Cell. Biol. 6, 371 l-3721.

Schlegel, R., and Pardee, A. B. (1988). Caffeine-induced uncoupling of mitosis from the completion of DNA replication in mammalian cells. Science 232, 1284-l 288. Schlegel, R., Croy. R. G., and Pardee, A. B. (1987). Exposure to caffeine and suppression of DNA replication combine to stabilize the proteins and RNA required for premature mitotic events. J. Cell Physiol. 737, 85-91. Sherman, F., Fink, G., and Lawrence, C. (1974). Methods in Yeast Genetics (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory). Sikorski, R. S.. and Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 722, 19-27. Southern, E. (1975). Detection of specific ments separated by gel electrophoresis.

sequences among DNA fragJ. Mol. Biol. 98, 503-517.

Spencer, F., Gerring, S. L., Connelly, C., and Hieter, chromosome transmission mutants in Saccharomyces netics 724, 237-249. Stearns, T., and Botstein, D. (1988). Unlinked isolation of new conditional-lethal mutations genes of Saccharomyces cerevisiae. Genetics

P. (1990). Mitotic cerevisiae. Ge-

non-complementation: in each of the tubulin 7 79, 249-280.

Stearns, T., Hoyt, M. A., and Botstein, D. (1990). Yeast mutants sensitive to anti-microtubule drugs define three genes that affect microtubule function. Genetics 724, 251-282. Steinhardt, R. A., and Alderton, J. (1988). Intracellular free calcium rise triggers nuclear envelope breakdown in the sea urchin embryo. Nature 322, 384-388. Stuart, D. I., Acharaya, K. R.. Walker, N. C. P., Smith, S. G., Lewis, M., and Philips, D. C. (1988). a-Lactalbumin possessesa novel calcium binding loop. Nature 324, 84-87. Tombes, R. M., and Borisy, G. G. (1989). Intracellular free calcium mitosis in mammalian cells: anaphaseonset iscalcium modulated, is not triggered by a brief transient. J. Cell Biol. 709, 827-838. Twigg, J., Patel, R., and Whitaker, M. (1988). Translational control InsP3-induced chromatin condensation during the early cell cycles sea urchin embryos. Nature 332, 388-369.

and but of of

Vyas, N. K., Vyas, M. N., and Quiocho, F. A. (1987). A novel calciumbinding site in the galactose-binding protein of bacterial transport and chemotaxis. Nature 327, 835-838. Weinert, T. A., and Hartwell, L. H. (1988). The RAD9 gene controls the cell cycle response to DNA damage in Saccharomyces cerevisiae. Science 241. 317-322.