ORIGINAL ARTICLE

Fenofibrate Modulates Cytochrome P450 and Arachidonic Acid Metabolism in the Heart and Protects Against Isoproterenol-induced Cardiac Hypertrophy Hassan N. Althurwi, BSc, Osama H. Elshenawy, BCPS, and Ayman O.S. El-Kadi, PhD

Abstract: It has been previously shown that the cytochrome P450 (P450) modulator, fenofibrate, protects against cardiovascular diseases. P450 and their metabolites, epoxyeicosatrienoic acids (EETs) and 20-hydroxyeicosatetraenoic acid (20-HETE) were found to play an important role in cardiovascular diseases. Therefore, it is important to examine whether fenofibrate would modulate the cardiac P450 and its associated arachidonic acid metabolites and whether this modulation protects against isoproterenol-induced cardiac hypertrophy. For this purpose, male Sprague-Dawley rats were treated with fenofibrate (30 mg$kg21$d21), isoproterenol (4.2 mg$kg21$d21), or the combination of both. The expression of hypertrophic markers and different P450s along with their metabolites was determined. Our results showed that fenofibrate significantly induced the cardiac P450 epoxygenases, such as CYP2B1, CYP2B2, CYP2C11, and CYP2C23, whereas it decreased the cardiac v-hydroxylase, CYP4A3. Moreover, fenofibrate significantly increased the formation of 14,15-EET, 11,12-EET, and 8,9-EET, whereas it decreased the formation of 20-HETE in the heart. Furthermore, fenofibrate significantly decreased the hypertrophic markers and the increase in heart-to-body weight ratio induced by isoproterenol. This study demonstrates that fenofibrate alters the expression of cardiac P450s and their metabolites and partially protects against isoproterenol-induced cardiac hypertrophy, which further confirms the role of P450s, EETs, and 20-HETE in the development of cardiac hypertrophy. Key Words: fenofibrate, cardiovascular disease, cytochrome P450, EETs, 20-HETE (J Cardiovasc Pharmacol  2014;63:167–177)

INTRODUCTION Cardiovascular diseases (CVD), primarily coronary heart disease (CHD), remain the leading cause of mortality and morbidity worldwide. CVD accounts for approximately Received for publication April 14, 2013; accepted October 16, 2013. From the Faculty of Pharmacy and Pharmaceutical Sciences, University of Alberta, Edmonton, Alberta, Canada. Supported by Canadian Institute of Health Research (CIHR) Operating Grant 106665 to A. O. S. El-Kadi. H. N. Althurwi is the recipient of Salman Bin Abdulaziz University Scholarship, Saudi Arabia. O. H. Elshenawy is the recipient of Alberta Cancer Foundation Graduate Studentship Award and Alberta Innovates Technology Futures Scholarship. The authors report no conflicts of interest. Reprints: Ayman O.S. El-Kadi, PhD, Faculty of Pharmacy and Pharmaceutical Sciences, 2142J Katz Group-Rexall Centre for Pharmacy and Health Research, University of Alberta, Edmonton, Alberta T6G 2E1, Canada (e-mail: [email protected]). Copyright © 2013 by Lippincott Williams & Wilkins

40% of all deaths in the world and more than 30% of deaths in Canada alone.1 In the United States, total inpatient care cost is approximately $71 billion, whereas in Canada, it costs over $20 billion annually.2,3 Despite the substantial progress made during the past 2 decades in heart research, CVD prevalence is expected to increase in coming decades, mainly because of sedentary lifestyles and increasing number of obese and patients with diabetes.4 P450 is a superfamily of mixed function mono-oxygenases that is involved in the oxidative metabolism of a wide range of xenobiotics and endogenous substances.5 Several P450 enzyme families have been identified in the heart, endothelium, and smooth muscle of blood vessels.5 Furthermore, increasing evidence has revealed the contributions of P450 enzymes in CVD, such as hypertension, CHD, myocardial infarction, heart failure, stroke, cardiomyopathy, and arrhythmias.5 In the presence of NADPH and oxygen, P540 v-hydroxylases, mainly CYP4 family, metabolize arachidonic acid (AA) to 20-hydroxyeicosatetraenoic acid (20-HETE), whereas P450 epoxygenases, mainly CYP2 family, metabolize AA to 4 regioisomers of epoxyeicosatrienoic acids (EETs), 5,6-EET, 8,9-EET, 11,12-EET, and 14,15-EET metabolites.6 EETs are the major cardioprotective products of AA metabolism catalyzed by P450 enzymes. Once produced, EETs are either incorporated into membrane phospholipid pools, secreted into the extracellular space, or efficiently hydrolyzed by soluble epoxide hydrolase (sEH) to biologically less active dihydroxyeicosatrienoic acids (DHETs), thus reducing their beneficial cardiovascular effects.7,8 EETs are potent vasodilators that function as endothelium-derived hyperpolarizing factors, possess anti-inflammatory effect mediated by the inhibition of nuclear factor kappa B (NF-kB), and affect endothelial and vascular smooth cell proliferation and angiogenesis.9–11 In contrast to EETs, 20-HETE has detrimental cardiovascular effects. 20-HETE is reported to be a potent vasoconstrictor and was found to stimulate mitogenic and angiogenic responses in vitro and in vivo.12 Moreover, 20-HETE was found to activate NF-kB and increase the generation of inflammatory cytokines that aggravates the inflammatory condition.13 Altogether, these findings place EETs and 20-HETE as promising therapeutic targets for CVD. Fenofibrate is a well-known hypolipidemic agent that was found to decrease total CVD events in patients at increased risk of CHD and considered as possible therapeutic agent for cardiac remodeling.14,15 The beneficial effects of fenofibrate on the heart are believed to be independent of

J Cardiovasc Pharmacol   Volume 63, Number 2, February 2014

www.jcvp.org |

167

J Cardiovasc Pharmacol   Volume 63, Number 2, February 2014

Althurwi et al

its lipid-lowering action.16 More striking, fenofibrate was shown to decrease the binding of nuclear factor of activated T-cells c4 (NFATc4) with p65 subunit of NF-kB, thus prevents the transactivation of NFATc4 and attenuates cardiac hypertrophy in vivo and in vitro.17 Moreover, fenofibrate was reported to increase the cardiac expression of PPARa and regress the left ventricular hypertrophy spontaneously hypertensive rats (SHRs).18 Furthermore, fenofibrate was shown to inhibit the myocardial fibrosis associated with pressure-overloaded heart by suppressing AP-1–mediated ET-1 gene increase.19 In addition, fenofibrate decreased the expression of the adhesion molecules: vascular cell adhesion molecule-1 (VCAM-1), platelet endothelial cell adhesion molecule (PECAM), and intercellular adhesion molecule-1 (ICAM-1), and ameliorated the angiotensin-II (Ang-II)–induced inflammation and hypertension.20 Interestingly, fenofibrate was reported to increase renal P450 epoxygenases, thus increasing renal EETs bioavailability, and confer nephroprotection in Ang-II–induced renal injury, diabetic, and obese rats.21–24 Accordingly, we hypothesized that fenofibrate will induce P450 epoxygenases enzymes and increase EETs bioavailability in the heart. This induction of P450 epoxygenases enzymes will protect the heart against isoproterenolinduced cardiac hypertrophy. Our results provide for the first time that fenofibrate confers cardioprotection by causing cardiac-specific changes in P450 and their associated AA metabolites.

MATERIALS AND METHODS Animals The investigation follows the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (Publication No. 85-23, revised 1996). All experimental animal procedures were approved by the University of Alberta Health Sciences Animal Policy and Welfare Committee. Male Sprague-Dawley rats weighing 200–250 g were obtained from Charles River Canada (St. Constant, QC, Canada). All animals were maintained on a 12-hour light/dark cycle with food and water available ad libitum.

Chemicals and Reagents AA, fenofibrate, and isoproterenol were purchased from Sigma-Aldrich Chemical Co (St Louis, MO). TRIzol reagent was purchased from Invitrogen (Carlsbad, CA). High-capacity complementary DNA Reverse Transcription Kit, SYBR Green SuperMix, and 96-well optical reaction plates with optical adhesive films were purchased from Applied Biosystems (Foster City, CA). Primers used for real-time polymerase chain reaction (PCR) were synthesized by Integrated DNA Technologies Incorporation (San Diego, CA) according to previously published sequences. AA metabolite standards 5,6-EET, 8,9-EET, 11,12-EET, 14,15-EET, 5,6-DHET, 8,9-DHET, 11,12-DHET, 14,15-DHET, 20-HETE, and 14(15)-EET-d11 were obtained from Cayman Chemical (Ann Arbor, MI). Acrylamide, N0 N0 -bis-methylene-acrylamide, b-mercaptoethanol, ammonium persulfate, glycine, pure nitrocellulose membrane (0.45 mm), and N,N,N0 ,N0 -tetramethylethylenediamine were purchased from Bio-Rad Laboratories (Hercules, CA). Detection reagents used in chemiluminescent Western blotting were purchased from GE Healthcare Life Sciences (Piscataway, NJ). Rabbit anti–rat CYP2C11, rabbit anti–rat CYP2C23, and rabbit anti–human CYP4F primary antibodies were purchased from Abcam (Cambridge, United Kingdom). Rabbit anti–mouse CYP2Js primary antibody was a generous gift from Dr. Darryl Zeldin (National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, NC). Mouse anti–rat CYP2B1/2, mouse anti–rat CYP4A, goat anti–mouse/rat sEH, rabbit anti–rat actin, and secondary antibodies were purchased from Santa Cruz Biotechnology, Inc (Santa Cruz, CA). Other chemicals were purchased from Fisher Scientific Co (Toronto, ON, Canada).

Experimental Design Male SD rats (200–250 g) were treated daily for 7 days orally with either 1% methylcellulose (n = 6) or fenofibrate dissolved in 1% methylcellulose (30 mg$kg21$d21) (n = 6). Thereafter, animals were killed under isoflurane anesthesia 24 hours after the last injection. Heart, kidney, and liver were excised, immediately frozen in liquid nitrogen, and stored at 2808C until analysis. To study the effect of fenofibrate on cardiac hypertrophy, additional groups were treated daily for 7 days with fenofibrate (oral gavage, 30 mg$kg21$d21),

TABLE 1. Primers Sequences Used for Real-time PCR Reactions Gene ANP BNP CYP2B1 CYP2B2 CYP2C11 CYP2C23 CYP2J3 CYP2J4 CYP4A3 CYP4F4 EPHX2 GAPDH

168

| www.jcvp.org

Forward Primer

Reverse Primer

GGAGCCTGCGAAGGTCAA CAGAAGCTGCTGGAGCTGATAAG AACCCTTGATGACCGCAGTAAA CCATCCCTTGATGATCGTACCA CACCAGCTATCAGTGGATTTGG CGTCCAATCACACGGTCAAGT CATTGAGCTCACAAGTGGCTTT GCTCGGACCTTCATTCCACA CTCGCCATAGCCATGCTTATC CAGGTCTGAAGCAGGTAACTAAGC GATTCTCATCAAGTGGCTGAAGAC CAAGGTCATCCATGACAACTTTG

TATCTTCGGTACCGGAAGCTGT TGTAGGGCCTTGGTCCTTTG TGTGGTACTCCAATAGGGACAAGATC AATTGGGGCAAGATCTGCAAA GTCTGCCCTTTGCACAGGAA TTCGGGCTCCTGCTCCTT CAATTCCTAGGCTGTGATGTCG GATCGTGGCTACCAGAGAGC CCTTCAGCTCATTCATGGCAATC CCGTCAGGGTGGCACAGAGT GGACACGCCACTGGCTAAAT GGGCCATCCACAGTCTTCTG

 2013 Lippincott Williams & Wilkins

J Cardiovasc Pharmacol   Volume 63, Number 2, February 2014

isoproterenol (mini osmotic pump, Alzet 2001, 4.2 mg$kg21$d21), or the combination of both. Fenofibrate administration was started 24 hours before isoproterenol administration and continued concurrently thereafter. Weight-matched control group received the vehicles (1% methylcellulose by oral gavage plus saline in mini osmotic pump). Thereafter, animals were killed under isoflurane anesthesia 24 hours after the last injection. Heart, kidney, and liver were excised, immediately frozen in liquid nitrogen, and stored at 2808C until analysis.

Fenofibrate and CYP450

Total RNA from the frozen tissues was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s

instructions and quantified by measuring the absorbance at 260 nm. The relative gene expression was determined by realtime PCR using the ABI Prism 7500 System (Applied Biosystems) according to the manufacturer’s protocol. The primers used in this study were previously published25 and are listed in Table 1. A melting curve was determined at the end of each cycle to confirm the specificity of the primers and the purity of the PCR product. Thereafter, real-time PCR data were analyzed using the relative gene expression method as described previously.26 GAPDH was used as the endogenous control, and the untreated control was used as the calibrator when any changes in gene expression induced by fenofibrate, isoproterenol, and isoproterenol plus fenofibrate were being studied.

FIGURE 1. Effect of fenofibrate treatment on CYP2B subfamily gene expression in the heart, kidney, and liver. SpragueDawley rats received daily injections of either 1% methylcellulose or fenofibrate (30 mg/kg, oral), for 7 days. Total RNA was isolated from the heart, kidney, and liver of control and fenofibrate-treated rats, and the relative gene expression of (A) CYP2B1 and (B) CYP2B2 was determined by real-time PCR. Duplicate reactions were performed for each experiment, and the results are presented as the means of 6 independent experiments 6SEM (n = 6). #P , 0.05 compared with control.

FIGURE 2. Effect of fenofibrate treatment on CYP2C subfamily gene expression in the heart, kidney, and liver. Sprague-Dawley rats received daily injections of either 1% methylcellulose or fenofibrate (30 mg/kg, oral), for 7 days. Total RNA was isolated from the heart, kidney and liver of control and fenofibratetreated rats, and the relative gene expression of (A) CYP2C11 and (B) CYP2C23 was determined by real-time PCR. Duplicate reactions were performed for each experiment, and the results are presented as the means of 6 independent experiments 6SEM (n = 6). #P , 0.05 compared with control.

RNA Extraction and Relative Gene Expression Analysis by Real-time PCR

 2013 Lippincott Williams & Wilkins

www.jcvp.org |

169

Althurwi et al

J Cardiovasc Pharmacol   Volume 63, Number 2, February 2014

Microsomal Preparation and Western Blot Analysis Microsomal protein was prepared from the heart as described previously.27 Briefly, hearts were washed in ice-cold KCl (1.15%, KCl wt/vol), cut into pieces, and homogenized separately in ice-cold sucrose solution (1 g of tissue in 25 mL of 0.25 M sucrose). Tissue homogenates were centrifuged at 600g for 8 minutes. Then, the supernatant was centrifuged at 12,000g for 10 minutes. Thereafter, supernatants resulting from the previous step were centrifuged at 100,000g for an hour. The resulting pellets were suspended in 0.15 M KCl and recentrifuged at 27,000g for 15 minutes. Final pellets were

FIGURE 3. Effect of fenofibrate treatment on CYP2J subfamily gene expression in the heart, kidney, and liver. Sprague-Dawley rats received daily injections of either 1% methylcellulose or fenofibrate (30 mg/kg, oral), for 7 days. Total RNA was isolated from the heart, kidney and liver of control and fenofibratetreated rats, and the relative gene expression of (A) CYP2J3 and (B) CYP2J4 was determined by real-time PCR. Duplicate reactions were performed for each experiment, and the results are presented as the means of 6 independent experiments 6SEM (n = 6). #P , 0.05 compared with control.

170

| www.jcvp.org

resuspended in cold sucrose, and a supernatant, cytosol, were stored at 2808C. Heart microsomal protein concentration was determined by the Lowry method using bovine serum albumin as a standard.28 Western blot analysis was carried out using a previously described method.29

Microsomal Incubation and Separation of Different AA Metabolites by Liquid Chromatography-Electrospray Ionization Mass Spectrometry Heart microsomes (protein, 1 mg/mL) were incubated in the incubation buffer (5 mM magnesium chloride hexahydrate dissolved in 0.1 M potassium phosphate buffer, pH 7.4) at

FIGURE 4. Effect of fenofibrate treatment on CYP4 family gene expression in the heart, kidney, and liver. Sprague-Dawley rats received daily injections of either 1% methylcellulose or fenofibrate (30 mg/kg, oral), for 7 days. Total RNA was isolated from the heart, kidney and liver of control and fenofibrate-treated rats, and the relative gene expression of (A) CYP4A3 and (B) CYP4F4 was determined by real-time PCR. Duplicate reactions were performed for each experiment, and the results are presented as the means of 6 independent experiments 6SEM (n = 6). #P , 0.05 compared with control.  2013 Lippincott Williams & Wilkins

J Cardiovasc Pharmacol   Volume 63, Number 2, February 2014

378C in a shaking water bath (50 revolutions per minute). A pre-equilibration period of 5 minutes was performed. The reaction was initiated by the addition of 1 mM NADPH. AA was added to a final concentration of 50 mM and incubated for 30 minutes. The reaction was stopped by the addition of 600 mL acetonitrile (ice-cold) followed by the internal standard, 14 (15)-EET-d11. AA metabolites were extracted, dried, and then analyzed by LC-ESI-MS method (Waters Micromass ZQ 4000 Spectrometer; Waters, Milford, MA) as described previously.30 The mass spectrometer was operated in negative ionization mode with single-ion recorder acquisition. The nebulizer gas was obtained from an in-house high-purity nitrogen source. The temperature of the source was set at 1508C, and the voltages of the capillary and the cone were 3.51 kV and 25 V, respectively. The samples (10 mL) were separated on a reversephase C18 column (Kromasil, 250 · 3.2 mm) using a linear gradient mobile phase system water/acetonitrile with 0.005% acetic acid as mobile phase at a flow rate of 0.2 mL/min. The mobile phase system started at 60% acetonitrile, linearly increased to 80% acetonitrile in 30 minutes, increased to 100% acetonitrile in 5 minutes, and held for 5 minutes.

Fenofibrate and CYP450

Our results demonstrated that fenofibrate treatment caused a significant increase in CYP2B1 and CYP2B2 gene expression in the heart by 2- and 1.8-fold, respectively. In the liver, fenofibrate treatment significantly induced CYP2B1 and CYP2B2 gene expression by 73- and 1.6-fold, respectively. However, neither CYP2B1 nor CYP2B2 mRNA levels were altered in the kidney (Fig. 1). Likewise, fenofibrate treatment caused a significant induction of CYP2C11 and CYP2C23 mRNA levels in the heart by 1.8- and 3.3-fold, respectively compared with control group. However, no significant changes were observed in either kidney or liver (Figs. 2A, B). With respect to CYP2J subfamily, a significant induction of CYP2J4 mRNA level was observed in the heart and the liver of fenofibrate-treated rats by 1.5- and 4-fold, respectively, whereas CYP2J3 mRNA was significantly induced only in the liver of fenofibrate-treated rat by 2-fold (Figs. 3A, B). Regarding P450 v-hydroxylases, fenofibrate treatment significantly decreased CYP4A3 gene expression by 2.7-fold

sEH Activity Assay sEH activity was measured using Morisseau and Hammock method with modifications.31 14,15-EET was used as the natural substrate. Briefly, the cytosolic fraction was diluted with sodium phosphate buffer (0.076 M, pH 7.4) supplemented with bovine serum albumin (2.5 mg/mL) to 0.4 mg/mL). The assay was initiated by the addition of 14,15-EET (final concentration of 14,15-EET is 2 mg/mL) with the final volume of incubates is 200 mL. The mixture was incubated at 378C for 10 minutes. The reaction was terminated by the addition of 600 mL ice-cold acetonitrile followed by the internal standard. 14,15-EET and its corresponding 14,15-DHET were extracted by 1 mL ethyl acetate twice and dried using speed vacuum (Savant, Farmingdale, NY). Extracted 14, 15-EET and its metabolites were analyzed using LC-ESI-MS method (Waters Micromass ZQ 4000 spectrometer) as described previously.32

Statistical Analysis

Data were presented as mean 6 SEM. Comparative gene and protein expression and metabolite formation across groups were analyzed using Student’s t test. Kruskal–Wallis 1-way analysis of variance on ranks were used when applicable. A result was considered statistically significant where P , 0.05.

RESULTS Effect of Fenofibrate Treatment on P450 Gene Expression in the Heart, Kidney, and Liver To examine the effect of fenofibrate on P450 gene expression, total RNA was extracted from the heart, kidney, and liver of control and fenofibrate-treated rats. Thereafter, the expression of different P450 genes was measured using reverse transcription followed by real-time PCR.  2013 Lippincott Williams & Wilkins

FIGURE 5. Effect of fenofibrate treatment on P450 protein expression. Sprague-Dawley rats received daily injections of either 1% methylcellulose or fenofibrate (30 mg/kg, oral), for 7 days. Heart microsomal protein was isolated from the hearts of control and fenofibrate-treated rats. Thereafter, 25 mg of microsomal protein was separated on a 10% sodium dodecyl sulphate–polyacrylamide gel electrophoresis. CYP2B1/2, CYP2C11, CYP2C23, CYP2J, CYP4A, and CYP4F proteins were detected using the enhanced chemiluminescence method. The graph represents the relative amount of protein normalized to b-actin signals (mean 6 SEM, n = 4), and the results are expressed as percentage of the control values taken as 100%. #P , 0.05 compared with control. www.jcvp.org |

171

Althurwi et al

J Cardiovasc Pharmacol   Volume 63, Number 2, February 2014

in the heart of fenofibrate-treated rats, whereas its expression was significantly increased in the kidney and the liver of fenofibrate-treated rats by 2- and 4-fold, respectively (Fig. 4A). In contrast, fenofibrate treatment caused a significant induction of CYP4F4 gene expression in the heart by 1.5-fold but not in the kidney or the liver of fenofibratetreated rats (Fig. 4B).

Effect of Fenofibrate Treatment on P450 Protein Expression To investigate whether the changes in P450 were further translated into protein, the microsomal protein was prepared from hearts of control and fenofibrate-treated rats. Thereafter, CYP2B1/2, CYP2C11, CYP2C23, and CYP2J protein levels were determined using Western blot analysis. Similar to the mRNA level, fenofibrate treatment significantly increased the protein level of CYP2B1/2, CYP2C11, CYP2C23, and CYP2J by 2.9-, 3.1-, 3.4-, and 3.6-fold, respectively (Fig. 5). In contrast, fenofibrate treatment caused a significant decrease in CYP4F protein expression by 2.3-fold, whereas no significant changes were observed in CYP4A protein expression (Fig. 5).

Effect of Fenofibrate Treatment on sEH at Gene, Protein, and Activity Levels sEH enzyme is the major determinant of EETs level. Therefore, we determined the effect of fenofibrate treatment on the expression of EPHX2 gene, which encodes for the sEH enzyme. Our results showed that fenofibrate treatment caused a significant induction of EPHX2 gene expression in the kidney and the liver by 2.4- and 4-fold, respectively (Fig. 6A). However, fenofibrate did not cause any significant changes in the mRNA, protein, and activity of sEH in the heart (Figs. 6B, C).

Effect of Fenofibrate Treatment on P450-mediated AA Metabolism To investigate the effect of fenofibrate treatment on P450-derived AA metabolites, heart microsomes of control and fenofibrate-treated rats were incubated with AA for 30 minutes. Thereafter, AA metabolites were determined using LC-ESI-MS. Our results showed that fenofibrate treatment significantly increased the formation rate of 8,9-, 11,12-, and 14,15-EET by 1.9-, 1.9-, and 2-fold, respectively, in heart microsomes (Fig. 7A). However, the formation rates of 5,6-EET and DHETs were not significantly altered (Figs. 7A, B). Moreover, the effect of fenofibrate treatment on the total epoxygenase activity was calculated as the sum of total EETs and DHETs in the control and fenofibrate-treated rats. Our results showed that fenofibrate significantly increased the total epoxygenase activity in the heart microsomes by 2.1fold as compared with the control microsomes (Fig. 7C).

FIGURE 6. Effect of fenofibrate treatment on sEH at gene, protein, and activity levels. Sprague-Dawley rats received daily injections of either 1% methylcellulose or fenofibrate (30 mg/kg, oral), for 7 days. Total RNA was isolated from the heart, kidney and liver of control and fenofibrate-treated rats, and the relative

172

| www.jcvp.org

gene expression of EPHX2 was determined by real-time PCR (A) sEH protein level was determined by Western blot analysis, (B) sEH activity was calculated using sEH assay (C). Duplicate reactions were performed for each experiment, and the results are presented as the means of 6 independent experiments 6SEM (n = 6). #P , 0.05 compared with control.  2013 Lippincott Williams & Wilkins

J Cardiovasc Pharmacol   Volume 63, Number 2, February 2014

To determine the effect of fenofibrate treatment on P450 v-hydroxylase activity, we measured the formation rate of 20-HETE in heart microsomes from the control and fenofibrate-treated rats. Fenofibrate treatment significantly decreased the 20-HETE formation by 2-fold in comparison with the control microsomes (Fig. 7C).

Effect of Fenofibrate Treatment on the Cardiac Hypertrophy Induced by Isoproterenol To investigate whether the fenofibrate-mediated induction of P450 epoxygenases would confers cardioprotection in isoproterenol-induced cardiac hypertrophy in rats, we measured the hypertrophic markers, atrial natriuretic peptide (ANP)

Fenofibrate and CYP450

and brain natriuretic peptide (BNP). Our results showed that isoproterenol treatment caused a significant increase in the hypertrophic markers, ANP and BNP by 20- and 1.8-fold, respectively (Fig. 8A). On the other hand, fenofibrate treatment significantly decreased the isoproterenol-mediated induction of ANP and BNP by 1.6- and 1.5-fold, respectively (Fig. 8A). In addition, fenofibrate treatment alone did not alter the gene expression of ANP and BNP. Moreover, isoproterenol significantly increased the heart weight to body weight ratio by 40%, whereas treatment with fenofibrate significantly decreased the isoproterenol-mediated increase in the heart weight to body weight ratio by 10%, compared with isoproterenol alone. Furthermore, no significant difference was observed between control and fenofibrate-treated rats (Fig. 8B).

FIGURE 7. Effect of fenofibrate treatment on P450-mediated AA metabolism. Sprague-Dawley rats received daily injections of either 1% methylcellulose or fenofibrate (30 mg/kg, oral), for 7 days. Heart microsomes of control and fenofibrate-treated rats were incubated with 50 mM AA. The reaction was started by the addition of 1 mM NADPH and lasted for 30 minutes. The reaction was terminated by the addition of ice-cold acetonitrile. EETs, DHETs, and 20-HETE were extracted twice by 1 mL of ethyl acetate and dried using speed vacuum. Reconstituted metabolites were injected into LC-ESI-MS for the determination of A, EETs, B, DHETs, C, total epoxygenase activity, and D, v-hydroxylase activity. Duplicate reactions were performed for each experiment, and the results are presented as the means of 6 independent experiments 6SEM (n = 6). #P , 0.05 compared with control.  2013 Lippincott Williams & Wilkins

www.jcvp.org |

173

J Cardiovasc Pharmacol   Volume 63, Number 2, February 2014

Althurwi et al

DISCUSSION It is well established that the P450 epoxygenase enzymes and their associated AA metabolites are altered during CVD, suggesting their roles in cardiovascular health.5 For instance, CYP2B1 and CYP2B2 gene expression were increased in SHRs,33 whereas CYP2C11 expression was decreased in the hypertrophied hearts.34 In addition, overexpression of CYP2C and CYP2J subfamilies increased endothelial cell proliferation and angiogenesis, improved postischemic recovery of the left ventricle, and protected against hypoxia–reoxygenation injury and cardiotoxicity.35–40

FIGURE 8. Effect of fenofibrate treatment on the cardiac hypertrophy induced by isoproterenol. Sprague-Dawley rats received daily injections of vehicles, fenofibrate (30 mg/kg, oral), isoproterenol (mini osmotic pump, 4.2 mg kg21 day21), or isoproterenol (mini osmotic pump, 4.2 mg kg21 day21) plus fenofibrate (30 mg/kg, oral) for 7 days, whereas weightmatched controls received the same volume of 1% methylcellulose and saline. A, Gene expression of the hypertrophic genes, ANP and BNP was determined in the heart. B, Heart-to-body weight ratio (in milligrams per gram) was determined for each animal after 7 days of treatment with vehicles, fenofibate, isoproterenol, or the combination of these reagents. Duplicate reactions were performed for each experiment, and the results are presented as the means of 6 independent experiments 6SEM (n = 6). #P , 0.05 compared with control, *P , 0.05 compared with isoproterenol-treated rats.

174

| www.jcvp.org

Of interest, EETs were shown to protect against various cardiovascular disorders, such as hypertension, endothelial dysfunction, cardiac hypertrophy, and heart failure.7,41,42 In addition, EETs were shown to inhibit the NF-kB, which is a downstream target of several signaling pathways implicated in cardiac abnormalities, such as Ang-II, a-adrenergic stimulation, PI3K/Akt, ras, P38, MEKK1/4, PKC, and gp130 pathways.42 In this study, we investigated whether fenofibrate would induce P450 epoxygenase enzymes and increase EETs bioavailability in the heart. Our results demonstrated that fenofibrate significantly induced P450 epoxygenases CYP2B1, CYP2B2, CYP2C11, CYP2C23, and CYP2J4 in the heart at both mRNA and protein levels. CYP2B1, CYP2B2, CYP2C11, CYP2C23, and CYP2J were all reported to produce EETs where CYP2C and CYP2J subfamilies seem to be the primary P450 epoxygenases in rat and human heart, respectively.6,37,43 sEH enzyme is a critical determinant of EETs level, as it catalyzes their degradation to DHETs, thus eliminating their biological activity.7 Therefore, any change in AA metabolism because of the alteration on P450 enzymes can be further influenced by sEH level. Accordingly, it was necessary to investigate the effect of fenofibrate treatment on sEH expression. Surprisingly, we found that fenofibrate treatment did not cause any changes in sEH mRNA, protein and activity levels in the heart tissue, whereas it caused significant induction of sEH gene expression in the kidney and the liver. In line with our results, it has been previously reported that fenofibrate treatment significantly increases sEH in the liver and the kidney.44 Thus, these results suggest that the effect of fenofibrate on sEH expression is tissue-specific. In agreement with the P450 epoxygenase mRNA and protein levels, fenofibrate treatment significantly increased the formation rates of 8,9-, 11,12-, and 14,15-EET. Moreover, the total epoxygenase activity was significantly increased in fenofibrate-treated heart microsomes compared with the control microsomes. In accordance with sEH mRNA, protein and activity levels, DHETs formation was not significantly altered. Similar to P450 epoxygenases, the evidence for the involvement of P450 v-hydroxylases, mainly CYP4A and CYP4F in CVD is well established.6,45,46 The expression of CYP4A and CYP4F subfamilies was found to be upregulated in failing and hypertrophied hearts and was associated with higher synthesis of 20-HETE in SD rats.5,42,47 Increasing 20-HETE formation was accompanied by an increase in systolic blood pressure, plasma levels of Ang-II, and angiotensinconverting enzyme. On the other hand, inhibition of 20-HETE formation by HET0016, significantly attenuated these changes.48 Likewise, the inhibition of 20-HETE formation prevented the development of hypertension in SHRs,5 reduced myocardial infarct size,49 and significantly reversed the benzo(a)pyreneinduced cardiac hypertrophy.50 Furthermore, 20-HETE was found to be involved in the secretion of endothelin-1– stimulated natriuretic peptide from the heart5 and increased cellular hypertrophy in H9C2 cells.51 Taken together, these data highlight the importance of 20-HETE and P450 v-hydroxylase enzymes in the development of CVD. In this study, our results demonstrated that fenofibrate treatment decreased CYP4A3 gene expression whereas it  2013 Lippincott Williams & Wilkins

J Cardiovasc Pharmacol   Volume 63, Number 2, February 2014

significantly induced the gene expression of CYP4F4 in the heart. However, Western blots revealed that the protein level of CYP4A was not changed, whereas the protein expression of CYP4F was significantly decreased in fenofibrate-treated rats. The difference observed in P450 expression pattern could be attributed to several factors: first, it has been reported that the transcriptional regulation of CYP4F gene expression differs substantially from the CYP4A subfamily. For instance, PPARa ligand like clofibrate, which known to induce CYP4A expression, either downregulate or have no effect on CYP4F subfamily.52,53 Second, there are several processes between transcription and translation that could be responsible for such discrepancy that include but not limited to RNA and protein stability, post-transcriptional and post-translational modifications in addition to miRNA. Finally, it is known that the transcriptional regulation is a complex process, and usually involve more than 1 nuclear receptor that are involved in the regulation of different P450 isoenzymes in different organs.54 Hence, further studies need to be conducted to understand such discrepancy which is beyond the scope of this study. Microsomal incubation with AA revealed that fenofibrate treatment significantly decreased 20-HETE formation in the heart. Despite the disparity between P450 v-hydroxylases mRNA and protein levels, the decrease in 20-HETE formation in fenofibrate-treated rats is suggestive of the lower activity of v-hydroxylases and consistent with CYP4A3 and CYP4F gene and protein expression, respectively. To assess whether the cardiac-specific changes seen in fenofibrate treatment would confer cardioprotective effect, we tested the cardioprotective effect of fenofibrate in isoproterenol model of cardiac hypertrophy. We chose cardiac hypertrophy in this study for several reasons. First, cardiac hypertrophy considers as an established risk factor for heart failure and an early event associated with many CVD.55 Second, we have

Fenofibrate and CYP450

recently demonstrated that the induction of cardiac hypertrophy in isoproterenol-treated rats caused heart-specific changes of several P450 and sEH gene expression. The total balance of these changes has led to higher formation of cardiotoxic metabolite, 20-HETE and lower formation of cardioprotective metabolites, EETs in the hypertrophied hearts.42 Finally, inhibition of sEH and increasing EETs bioavailability have protected against isoproterenol-induced cardiac hypertrophy, suggesting the involvement of EETs in the development of cardiac hypertrophy in this model.42 In this study, we showed that increasing EETs and decreasing 20-HETE formations by fenofibrate administration have significantly decreased the isoproterenol-mediated induction of the hypertrophy markers ANP, BNP, and the increase in the heart-to-body weight ratio (Fig. 9). In agreement with our results, it has been previously demonstrated that fenofibrate decreases the left ventricular hypertrophy, heart to body weight ratio, and the hypertrophy markers in aortic banding model and aldosterone-induced hypertension model.56,57

CONCLUSIONS

In this study, we have demonstrated for the first time that treatment with fenofibrate significantly induced the cardiac P450 epoxygenase enzymes and their associated EETs metabolites. On the other hand, fenofibrate decreased the cardiac v-hydroxylase and their associated 20-HETE metabolite. Furthermore, fenofibrate partially protected against isoproterenol-induced cardiac hypertrophy. Taking into account the accumulating evidence for the role of EETs and 20-HETE in the pathogenesis of cardiac diseases, manipulating the expression of epoxygenases and hydroxylases enzymes by fenofibrate will reveal novel points of intervention to be exploited in the development of new therapies for the treatment

FIGURE 9. Diagrammatic summary illustrating the cardioprotective effects of fenofibarate on P450s and their metabolites.  2013 Lippincott Williams & Wilkins

www.jcvp.org |

175

J Cardiovasc Pharmacol   Volume 63, Number 2, February 2014

Althurwi et al

and prevention of cardiac diseases. However, more studies are needed to explore the mechanisms by which fenofibrate confers cardioprotection. ACKNOWLEDGMENTS We are grateful to Dr. Vishwa Somayaji for technical assistance with LCMS. REFERENCES 1. Canada HaSFo. The Growing Burden of Heart Disease and Stroke in Canada. Heart and Stroke Foundation of Canada: Ottawa, Canada; 2003. 2. Lloyd-Jones D, Adams R, Carnethon M, et al. Heart disease and stroke statistics—2009 update: a report from the American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Circulation. 2009;119:e21–e181. 3. Canada CBo. The Canadian Heart Health Strategy: Risk Factors and Future Cost Implications. In: Louis Thériault CS, Browarski S, eds. The Conference Board of Canada: Ottowa, Canada; 2010. 4. Sacks FM. Reducing cardiovascular risk in metabolic syndrome and type 2 diabetes mellitus beyond low-density lipoprotein cholesterol lowering: a role for fenofibrate. Introduction. Am J Cardiol. 2008;102:1L–3L. 5. Elbekai RH, El-Kadi AO. Cytochrome P450 enzymes: central players in cardiovascular health and disease. Pharmacol Ther. 2006;112:564–587. 6. Roman RJ. P-450 metabolites of arachidonic acid in the control of cardiovascular function. Physiol Rev. 2002;82:131–185. 7. Imig JD, Zhao X, Capdevila JH, et al. Soluble epoxide hydrolase inhibition lowers arterial blood pressure in angiotensin II hypertension. Hypertension. 2002;39:690–694. 8. Spector AA, Fang X, Snyder GD, et al. Epoxyeicosatrienoic acids (EETs): metabolism and biochemical function. Prog Lipid Res. 2004; 43:55–90. 9. Campbell WB, Gebremedhin D, Pratt PF, et al. Identification of epoxyeicosatrienoic acids as endothelium-derived hyperpolarizing factors. Circ Res. 1996;78:415–423. 10. Node K, Huo Y, Ruan X, et al. Anti-inflammatory properties of cytochrome P450 epoxygenase-derived eicosanoids. Science. 1999;285: 1276–1279. 11. Michaelis UR, Fisslthaler B, Barbosa-Sicard E, et al. Cytochrome P450 epoxygenases 2C8 and 2C9 are implicated in hypoxia-induced endothelial cell migration and angiogenesis. J Cell Sci. 2005;118:5489–5498. 12. Miyata N, Roman RJ. Role of 20-hydroxyeicosatetraenoic acid (20-HETE) in vascular system. J Smooth Muscle Res. 2005;41:175–193. 13. Ishizuka T, Cheng J, Singh H, et al. 20-Hydroxyeicosatetraenoic acid stimulates nuclear factor-kappaB activation and the production of inflammatory cytokines in human endothelial cells. J Pharmacol Exp Ther. 2008;324:103–110. 14. Balakumar P, Rohilla A, Mahadevan N. Pleiotropic actions of fenofibrate on the heart. Pharmacol Res. 2011;63:8–12. 15. Keech A, Simes RJ, Barter P, et al. Effects of long-term fenofibrate therapy on cardiovascular events in 9795 people with type 2 diabetes mellitus (the FIELD study): randomised controlled trial. Lancet. 2005; 366:1849–1861. 16. Delerive P, Fruchart JC, Staels B. Peroxisome proliferator-activated receptors in inflammation control. J Endocrinol. 2001;169:453–459. 17. Zou J, Le K, Xu S, et al. Fenofibrate ameliorates cardiac hypertrophy by activation of peroxisome proliferator-activated receptor-alpha partly via preventing p65-NFkappaB binding to NFATc4. Mol Cell Endocrinol. 2013;370:103–112. 18. Chen HJ, Chen JZ, Wang XX, et al. PPAR alpha activator fenofibrate regressed left ventricular hypertrophy and increased myocardium PPAR alpha expression in spontaneously hypertensive rats [in Chinese]. Zhejiang Da Xue Xue Bao Yi Xue Ban. 2007;36:470–476. 19. Ogata T, Miyauchi T, Sakai S, et al. Stimulation of peroxisomeproliferator-activated receptor alpha (PPAR alpha) attenuates cardiac fibrosis and endothelin-1 production in pressure-overloaded rat hearts. Clin Sci (Lond). 2002;103(suppl 48):284S–288S. 20. Diep QN, Benkirane K, Amiri F, et al. PPAR alpha activator fenofibrate inhibits myocardial inflammation and fibrosis in angiotensin II-infused rats. J Mol Cell Cardiol. 2004;36:295–304.

176

| www.jcvp.org

21. Zhao X, Li LY. PPAR-alpha agonist fenofibrate induces renal CYP enzymes and reduces blood pressure and glomerular hypertrophy in Zucker diabetic fatty rats. Am J Nephrol. 2008;28:598–606. 22. Zhao X, Quigley JE, Yuan J, et al. PPAR-alpha activator fenofibrate increases renal CYP-derived eicosanoid synthesis and improves endothelial dilator function in obese Zucker rats. Am J Physiol Heart Circ Physiol. 2006;290:H2187–H2195. 23. Huang H, Morisseau C, Wang J, et al. Increasing or stabilizing renal epoxyeicosatrienoic acid production attenuates abnormal renal function and hypertension in obese rats. Am J Physiol Renal Physiol. 2007;293:F342–F349. 24. Muller DN, Theuer J, Shagdarsuren E, et al. A peroxisome proliferatoractivated receptor-alpha activator induces renal CYP2C23 activity and protects from angiotensin II-induced renal injury. Am J Pathol. 2004;164: 521–532. 25. Zordoky BN, Anwar-Mohamed A, Aboutabl ME, et al. Acute doxorubicin toxicity differentially alters cytochrome P450 expression and arachidonic acid metabolism in rat kidney and liver. Drug Metab Dispos. 2011;39: 1440–1450. 26. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. 27. Barakat MM, El-Kadi AO, du Souich P. L-NAME prevents in vivo the inactivation but not the down-regulation of hepatic cytochrome P450 caused by an acute inflammatory reaction. Life Sci. 2001;69:1559–1571. 28. Lowry OH, Rosebrough NJ, Farr AL, et al. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265–275. 29. Gharavi N, El-Kadi AO. tert-Butylhydroquinone is a novel aryl hydrocarbon receptor ligand. Drug Metab Dispos. 2005;33:365–372. 30. Nithipatikom K, Grall AJ, Holmes BB, et al. Liquid chromatographicelectrospray ionization-mass spectrometric analysis of cytochrome P450 metabolites of arachidonic acid. Anal Biochem. 2001;298:327–336. 31. Morisseau C, Hammock BD. Measurement of soluble epoxide hydrolase (sEH) activity. Curr Protoc Toxicol. 2007;Chapter 4:Unit 4 23, pp 1-18. 32. Zordoky BN, El-Kadi AO. 2,3,7,8-Tetrachlorodibenzo-p-dioxin and beta-naphthoflavone induce cellular hypertrophy in H9c2 cells by an aryl hydrocarbon receptor-dependant mechanism. Toxicol In Vitro. 2010;24: 863–871. 33. Thum T, Borlak J. Testosterone, cytochrome P450, and cardiac hypertrophy. FASEB J. 2002;16:1537–1549. 34. Zordoky BN, El-Kadi AO. Modulation of cardiac and hepatic cytochrome P450 enzymes during heart failure. Curr Drug Metab. 2008;9:122–128. 35. Michaelis UR, Fisslthaler B, Medhora M, et al. Cytochrome P450 2C9derived epoxyeicosatrienoic acids induce angiogenesis via cross-talk with the epidermal growth factor receptor (EGFR). FASEB J. 2003;17: 770–772. 36. Fleming I. Epoxyeicosatrienoic acids, cell signaling and angiogenesis. Prostaglandins Other Lipid Mediat. 2007;82:60–67. 37. Imig JD. Epoxides and soluble epoxide hydrolase in cardiovascular physiology. Physiol Rev. 2012;92:101–130. 38. Zhang Y, El-Sikhry H, Chaudhary KR, et al. Overexpression of CYP2J2 provides protection against doxorubicin-induced cardiotoxicity. Am J Physiol Heart Circ Physiol. 2009;297:H37–H46. 39. Seubert J, Yang B, Bradbury JA, et al. Enhanced postischemic functional recovery in CYP2J2 transgenic hearts involves mitochondrial ATPsensitive K+ channels and p42/p44 MAPK pathway. Circ Res. 2004; 95:506–514. 40. Yang B, Graham L, Dikalov S, et al. Overexpression of cytochrome P450 CYP2J2 protects against hypoxia-reoxygenation injury in cultured bovine aortic endothelial cells. Mol Pharmacol. 2001;60:310–320. 41. Monti J, Fischer J, Paskas S, et al. Soluble epoxide hydrolase is a susceptibility factor for heart failure in a rat model of human disease. Nat Genet. 2008;40:529–537. 42. Althurwi HN, Tse MM, Abdelhamid G, et al. Soluble epoxide hydrolase inhibitor, TUPS, protects against isoprenaline-induced cardiac hypertrophy. Br J Pharmacol. 2013;168:1794–1807. 43. El-Sherbeni AA, Aboutabl ME, Zordoky BN, et al. Determination of the dominant arachidonic acid cytochrome P450 monooxygenases in rat heart, lung, kidney, and liver: protein expression and metabolite kinetics. AAPS J. 2012. 44. Schladt L, Hartmann R, Timms C, et al. Concomitant induction of cytosolic but not microsomal epoxide hydrolase with peroxisomal beta-oxidation by various hypolipidemic compounds. Biochem Pharmacol. 1987;36:345–351.

 2013 Lippincott Williams & Wilkins

J Cardiovasc Pharmacol   Volume 63, Number 2, February 2014 45. Elshenawy OH, Anwar-Mohamed A, Abdelhamid G, El-Kadi AO. Murine atrial HL-1 cell line is a reliable model to study drug metabolizing enzymes in the heart. Vascul Pharmacol. 2013;58:326–333. 46. Wang MH, Guan H, Nguyen X, et al. Contribution of cytochrome P-450 4A1 and 4A2 to vascular 20-hydroxyeicosatetraenoic acid synthesis in rat kidneys. Am J Physiol. 1999;276:F246–F253. 47. Aboutabl ME, Zordoky BN, Hammock BD, et al. Inhibition of soluble epoxide hydrolase confers cardioprotection and prevents cardiac cytochrome P450 induction by benzo(a)pyrene. J Cardiovasc Pharmacol. 2011;57:273–281. 48. Elshenawy OH, Anwar-Mohamed A, El-Kadi AO. 20-Hydroxyeicosatetraenoic acid is a potential therapeutic target in cardiovascular diseases. Curr Drug Metab. 2013;14:706–719. 49. Gross ER, Nithipatikom K, Hsu AK, et al. Cytochrome P450 omegahydroxylase inhibition reduces infarct size during reperfusion via the sarcolemmal KATP channel. J Mol Cell Cardiol. 2004;37: 1245–1249. 50. Aboutabl ME, Zordoky BN, El-Kadi AO. 3-methylcholanthrene and benzo(a)pyrene modulate cardiac cytochrome P450 gene expression and arachidonic acid metabolism in male Sprague Dawley rats. Br J Pharmacol. 2009;158:1808–1819. 51. Tse MM, Aboutabl ME, Althurwi HN, et al. Cytochrome P450 epoxygenase metabolite, 14,15-EET, protects against isoproterenol-induced

 2013 Lippincott Williams & Wilkins

52.

53. 54. 55. 56.

57.

Fenofibrate and CYP450 cellular hypertrophy in H9c2 rat cell line. Vascul Pharmacol. 2013;58: 363–373. Cui X, Kawashima H, Barclay TB, et al. Molecular cloning and regulation of expression of two novel mouse CYP4F genes: expression in peroxisome proliferator-activated receptor alpha-deficient mice upon lipopolysaccharide and clofibrate challenges. J Pharmacol Exp Ther. 2001;296:542–550. Kawashima H, Kusunose E, Thompson CM, et al. Protein expression, characterization, and regulation of CYP4F4 and CYP4F5 cloned from rat brain. Arch Biochem Biophys. 1997;347:148–154. Palut D, Kostka G, Strucinski P. The role of nuclear receptors in cytochrome P-450 induction by xenochemicals [in Polish]. Rocz Panstw Zakl Hig. 2002;53:321–332. Bernardo BC, Weeks KL, Pretorius L, et al. Molecular distinction between physiological and pathological cardiac hypertrophy: experimental findings and therapeutic strategies. Pharmacol Ther. 2010;128:191–227. Irukayama-Tomobe Y, Miyauchi T, Sakai S, et al. Endothelin-1-induced cardiac hypertrophy is inhibited by activation of peroxisome proliferatoractivated receptor-alpha partly via blockade of c-Jun NH2-terminal kinase pathway. Circulation. 2004;109:904–910. Lebrasseur NK, Duhaney TA, De Silva DS, et al. Effects of fenofibrate on cardiac remodeling in aldosterone-induced hypertension. Hypertension. 2007;50:489–496.

www.jcvp.org |

177

Fenofibrate modulates cytochrome P450 and arachidonic acid metabolism in the heart and protects against isoproterenol-induced cardiac hypertrophy.

It has been previously shown that the cytochrome P450 (P450) modulator, fenofibrate, protects against cardiovascular diseases. P450 and their metaboli...
781KB Sizes 0 Downloads 0 Views