Fish Oil in Comparison to Folinic Acid for Protection Against Adverse Effects of Methotrexate Chemotherapy on Bone Rethi Raghu Nadhanan,1 Chia-Ming Fan,1 Yu-Wen Su,1 Peter R.C. Howe,2,3 Cory J. Xian1 1 Sansom Institute for Health Research, School of Pharmacy and Medical Sciences, University of South Australia, GPO Box 2471, Adelaide 5001, Australia, 2Nutritional Physiology Research Centre, School of Health Sciences, University of South Australia, Adelaide 5001, Australia, 3Clinical Nutrition Research Centre, University of Newcastle, Callaghan, NSW 2308, Australia

Received 24 June 2013; accepted 25 November 2013 Published online 17 December 2013 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/jor.22565

ABSTRACT: Methotrexate (MTX) chemotherapy is known to cause bone loss which lacks specific preventative treatments, although clinically folinic acid is often used to reduce MTX toxicity in soft tissues. This study investigated damaging effects of MTX injections (0.75 mg/kg/day for 5 days) in rats and potential protective benefits of fish oil (0.25, 0.5, or 0.75 ml/100 g/day) in comparison to folinic acid (0.75 mg/kg) in the tibial metaphysis. MTX treatment significantly reduced height of primary spongiosa and volume of trabecular bone while reducing density of osteoblasts. Consistently, MTX reduced osteogenic differentiation but increased adipogenesis of bone marrow stromal cells, accompanied by lower mRNA expression of osteogenic transcription factors Runx2 and Osx, but an up-regulation of adipogenesis-related genes FABP4 and PPAR-g. MTX also increased osteoclast density, bone marrow osteoclast formation, and mRNA expression of proinflammatory cytokines IL-1, IL-6, TNF-a, and RANKL/OPG ratio in bone. Fish oil (0.5 or 0.75 ml/100 g) or folinic acid supplementation preserved bone volume, osteoblast density, and osteogenic differentiation, and suppressed MTX-induced cytokine expression, osteoclastogenesis, and adipogenesis. Thus, fish oil at 0.5 ml/100 g or above is as effective as folinic acid in counteracting MTX-induced bone damage, conserving bone formation, suppressing resorption and marrow adiposity, suggesting its therapeutic potential in preventing bone loss during MTX chemotherapy. ß 2013 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 32:587–596, 2014. Keywords: cancer chemotherapy; bone loss; bone marrow adiposity; fish oil; folinic acid

Chemotherapy is widely used to treat cancers due to improvements in success rates and patient survival.1 However, chemotherapeutic agents have been shown to have adverse effects on bone, including stunted growth, low bone mass or osteoporosis, and fractures in cancer patients and survivors.1–3 Methotrexate (MTX) is an anti-metabolite commonly used to treat malignancies such as acute lymphoblastic leukemia (ALL, the major childhood cancer) and breast cancer at high doses4 and at lower doses for rheumatoid arthritis.5 High MTX doses have been shown to contribute to bone growth impairment,6 reduced bone mineral density (BMD), and fractures among children.7–10 Women given chemotherapy consisting of MTX for breast or ovarian cancer also suffer from bone loss.11,12 Due to this significant impact on skeletal health, it has become critically important to develop treatments to ensure bone health during chemotherapy. Folinic acid (FA) is readily converted to active forms of folate as this folic acid analogue does not require action of the dihydrofolate reductase (the limiting enzyme inhibited by MTX) in the folate metabolism cycle; thus folinic acid is now used clinically to reduce MTX toxicity in soft tissues.13–15 In addition, rat model studies have also shown the potential of FA in protecting bone, resulting in the preservation of bone formation and suppression of resorption and bone marrow adiposity during MTX treatment.16–18 However, high Grant sponsor: Channel-7 Children’s Research Foundation of South Australia and NHMRC Australia. Correspondence to: Cory J. Xian (T: 618-8302-1944; F: 618-83021087; E-mail: [email protected]) # 2013 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

doses of FA have been shown to reduce MTX treatment efficacy and cure rates in childhood ALL, cause cancer relapse,19,20 and/or possibly support tumor growth.21 Further studies are required to examine safety/dosage/efficacy of FA rescue in protecting both soft and bone tissues during MTX treatment.22 Thus, more safer alternative options are needed to protect bone during MTX chemotherapy. Epidemiological and clinical studies suggest that consumption of fish oil rich in omega-3 polyunsaturated fatty acids (n3 PUFAs) can attenuate ageingrelated bone loss.23 Animal studies have also shown efficacy of dietary n3 PUFAs in preventing bone loss in ovariectomized models.24 n3 PUFAs promote bone health by suppressing formation and activity of osteoclasts and enhancing those of osteoblasts, thereby inhibiting bone resorption and promoting bone formation.25–27 Although a recent study suggested that oral supplementation of fish oil at 0.5 ml/100 g body weight may protect bone during MTX treatment in rats,28 potential efficacy of fish oil and dose response in preventing chemotherapy-induced bone loss are yet to be established. It was hypothesized in the current study that the fish oil administered at different doses (0.25, 0.5, or 0.75 ml/100 g/day) may have a dosedependent response in comparison to effects of FA supplementation in suppressing bone damaging effects of MTX in rats. This study also examined mechanisms underlying these effects.

MATERIALS AND METHODS Study Design and Animal Trial This study was approved by Animal Ethics Committee of SA Pathology of South Australia. Male Sprague–Dawley rats of 6 weeks old were fed a specially made rat chow basal diet JOURNAL OF ORTHOPAEDIC RESEARCH APRIL 2014

587

588

RAGHU NADHANAN ET AL.

containing meat, trace levels of EPA and DHA, 1.87% monounsaturated fats, 1.56% polyunsaturated fats and 0.82% saturated fats (Specialty Feeds, Glen Forrest, Australia). After a week of acclimatization, rats were randomly segregated into groups receiving oral gavage of water (control), vegetable oil at 0.5 ml/100 g body weight/day, or fish oil at 0.25, 0.5, or 0.75 ml/100 g/day (equivalent to consuming 188, 375, or 563 mg of n3 PUFAs/100 g/day). Crisco vegetable oil was used as control oil containing 36.8% n9 mono-unsaturated fatty acids (MUFA) and 18.4% PUFA (Goodman Fielder, North Ryde, Australia). The fish oil used was ROPUFA1 75-EE (containing 42% EPA and 22% DHA, DSM Nutritional Products, Kaiseraugst, Switzerland). After 1 week pretreatment, rats were subcutaneously injected with MTX once daily for 5 days at 0.75 mg/kg29 (mimicking the intensive induction phase of MTX treatment for ALL30). The control groups were gavaged with water or fish oil and received saline injection. The daily oral gavage ended 1 day before specimen collection. One group of control rats (saline injection) and one group of MTX-treated rats were injected ip with folinic acid (FA; EBEWE Pharma, Unterach, Austria) at 0.75 mg/kg (a clinically used dose) 6 h after each MTX/saline injection. Thus this study had the following nine treatment groups (n ¼ 8/group): Saline (Sal) þ H2O, Sal þ Fish oil (FO) (0.5 ml/100 g BW), Sal þ Folinic Acid (FA), MTX þ H2O, MTX þ FA, MTX þ Vegetable oil (VO) (0.5 ml/100 g), MTX þ FO low dose (L) (0.25 ml/100 g), MTX þ FO mid dose (M) (0.5 ml/100 g), and MTX þ FO high dose (H) (0.75 ml/100 g). Rats were humanely killed by CO2 overdose on day 9 post the first MTX/saline injection (an optimal time point for observing MTX damage effects29). Specimen Collection and Bone Marrow Cell Culture The proximal left tibia was fixed in 10% formalin and decalcified in Immunocal (Decal Corp., Tallman, NY), processed and paraffin embedded for collection of 4 mm sections for histological analysis.31 Metaphysis from the right proximal tibia were stored at 80˚C until RNA isolation. Bone marrow cells from femurs, remaining tibias and humerus of the same rat were used to obtain mononuclear cells (BMMNCs) using LymphoprepTM (AXIS-SHIELD, Oslo, Norway)31,32 and used for cell assays described below. A portion of cells was maintained until 80% confluence and collected for RNA extraction. Histomorphometric Analysis of Growth Plate, Metaphysis Bone, and Cell Density To examine treatment effects on bone structure and volume, histomorphometric analysis was conducted at proximal metaphysis, a region shown to be significantly affected by MTX treatment.29 Sections were stained with hematoxylin and eosin (H&E) and used for measuring growth plate thickness, primary spongiosa height, metaphyseal trabecular bone volume and structure.29,33 Locations of the growth plate, primary and secondary spongiosa on a paraffin section of a Sal þ H2O treated rat are arbitrarily separated by dashed lines as shown in Figure 1A. Densities of osteoblasts (on H&E stained sections) and osteoclasts (on tartrate-resistant acid phosphatase or TRAP-stained sections) were measured on trabecular surface at both primary and secondary spongiosa.33,34 Effects on the bone marrow adipocyte density (cells/mm2 marrow area) were examined at the lower secondary spongiosa region.31 Data presented were averages from measurements of three serial sections from each rat. JOURNAL OF ORTHOPAEDIC RESEARCH APRIL 2014

Ex Vivo Bone Marrow Cell Differentiation Assays To assess treatment effects on bone marrow osteoprogenitor cell pool, an ex vivo colony forming unit fibroblast (CFU-f) assay followed by staining for alkaline phosphatase (ALP; an osteoblast differentiation marker) was performed using BMMNCs collected (1  106 cells/well in triplicates per animal).31,35 The plates were also stained with toluidine blue (Sigma) to assess total colony formation (toluidineþ colonies) and to obtain % of ALPþ colonies. In addition, to assess mineralizing capacity, BMMNCs were plated at 2  106 cells/ well in triplicates per animal in T25 filtered flasks fed with basal media for a week and then for additional 11 days in an osteogenic medium.31 After being stained with alizarin red, the plates were stained with toluidine blue for obtaining the total CFU-f colonies and % alizarin redþ mineralized nodules. Furthermore, to assess bone marrow adipogenesis potential, BMMNCs were cultured in basal media at 2  106 cells/well in triplicates per animal in T25 flasks for 1 week, followed by another week in an adipogenic media.31 Cells were stained with Nile red and toluidine blue, and adipogenesis potential was expressed as % Nile redþ colonies over total colonies. To assess treatment effects on ability of bone marrow cells to form osteoclasts, an ex vivo osteoclast formation assay was performed.34 Bone marrow plastic non-adherent cells were cultured for 1 day at 3  105 cells/well in triplicates per animal in basal medium plus 10 ng/ml M-CSF (Peprotech, Rocky Hill, NJ), followed by culturing for 8 days in a media with 10 ng/ml M-CSF and 30ng/ml RANKL (Peprotech). After fixation and TRAP staining, osteoclasts were identified by TRAPþ cells containing at least three nuclei (TRAPþ osteoclasts/mm2 culture area). Quantitative RT-PCR Analysis To examine mRNA expression of osteogenesis (Runx2, Osx, and OCN) and adipogenesis (PPAR-g and FABP4) related genes, RNA was extracted from stromal cells using RNAqueous1-Micro Kit (Ambion, Melbourne, Australia) and further purified using DNA-free kit (Ambion). For assessing expression of pro-inflammatory cytokines and osteoclastogenesis regulatory genes, RNA was extracted from metaphyseal bone using TRI Reagent1 (Sigma) and purified using DNA-free kit. cDNA was synthesized from RNA using High Capacity RNA to cDNA kit (Applied Biosystems, Melbourne, Australia). Rat PCR primers (Table 1) for the above molecules and cyclophilin-A (CycA) were designed using Primer Express (Applied Biosystems) and were obtained from Geneworks (Adelaide, Australia). Primers for IL-1 and TNF-a were designed previously.36 Real time PCR was carried out in duplicate per animal on a 7500 Fast Real-Time PCR System (Applied Biosystems).31 Relative expression was calculated using the 2DDCt method to analyze the changes in gene expression. Statistics Data are presented as mean  SEM and were analyzed by a one-way ANOVA with IBM SPSS Statistics 19 (Chicago, IL). When significance (p < 0.05) was achieved, a post hoc analysis was performed using a Tukey’s test. Histogram bars with differing letters denote mean values significantly different from each other (p < 0.05).

RESULTS Treatment Effects on Trabecular Bone Structure and Volume No significant treatment effects were observed in growth plate total thickness from the effect of MTX

FISH OIL PREVENTS METHOTREXATE BONE DAMAGE

589

Figure 1. Effects on metaphysis bone of MTX alone or together with vegetable oil (VO), fish oil (FO), or folinic acid (FA). (A) Paraffin section of a tibial metaphyseal region of a Sal þ H2O treated rat depicting growth plate, primary spongiosa and secondary spongiosa which are separated by dotted lines. (B) Primary spongiosa height (mm); (C) Primary spongiosa BV/TV (%); (D) Secondary spongiosa BV/TV (%); (E) Secondary spongiosa trabecular thickness (mm); (F) Secondary spongiosa osteoblast/mm2 trabecular area; (G) mRNA expression (relative to Cyclophilin-A) of osteocalcin (OCN) expressed in fold changes. Labeled means without a common letter differ (p < 0.05). FO(L), FO(M), and FO(H) indicate fish oil at low (0.25 ml/100 g BW), mid (0.5 ml), and high dose (0.75 ml), respectively.

although MTX þ H2O treated rats had a trend towards a reduction in comparison to the other treatment groups (p ¼ 0.0739; data not shown). The primary spongiosa height was significantly reduced in the MTX þ H2O group compared to all saline-treated rats (p < 0.05; Fig. 1B). However, only MTX þ FA supplementation preserved the primary spongiosa height (p < 0.05 vs. MTX þ H2O; Fig. 1B). Other supplemented groups did not affect primary spongiosa significantly (p > 0.05 vs. MTX þ H2O group).

MTX þ H2O treatment reduced trabecular bone volume within the primary (Fig. 1C) and secondary (Fig. 1D) spongiosa (p < 0.01 or 0.001 vs. saline groups), and this reduction was prevented by MTX þ FA or MTX þ FO(M) treatment in primary spongiosa (p < 0.001 vs. MTX þ H2O), and by MTX þ FA (p < 0.01), MTX þ FO(M) (p < 0.01) or MTX þ FO(H) (p < 0.05 vs. MTX þ H2O). Consistently, MTX þ H2O treatment yielded thinner bone trabeculae within secondary spongiosa (p < 0.05 vs. saline controls;

Table 1. List of Primers Used in RT-PCR Gene IL-1 IL-6 TNF-a RANKL OPG OCN CYC-A PPAR-g FABP 4 Osx Runx2

Forward Primer (50 -30 )

Reverse Primer (50 -30 )

GTTTCCCTCCCTGCCCTCGAC CAGCGATGATGCACTGTCAGA ATGGCCCAGACCCTCACACTCAGA CCGTGCAAAGGGAATTACAAC CACAGCTCGCAAGAGCAAACT ATTCACCACCTTACTGCCCTCCTG GAGCTGTTTGCAGACAAAGTTTC TCCTCCTGTTGACCCAGAGCAT GGAATTCGATGAAATCACCCC GCTTTTCTGTGGCAAGAGGTTC TCACAAATCCTCCCCAAGTGG

GACAATGCTGCCTCGTGA CCAGGTAGAAACGGAACTCCA CTCCGCTTGGTGGTTTGCTACGAC GAGCCACGAACCTTACATCA ATATCGCGTTGCACACTGCTT GCTGGCCCTGACTGCATTCTG CCCTGGCACATGAATCCTGG AGCTGATTCCGAAGTTGGTGG TGGTCGACTTTCCATCCCACT CTGATGTTTGCTCAAGTGGTCG GAATGCGCCCTAAATCACTGA JOURNAL OF ORTHOPAEDIC RESEARCH APRIL 2014

590

RAGHU NADHANAN ET AL.

Fig. 1E). However, only MTX þ FO(M) treatment preserved the trabecular thickness (p < 0.05 vs. MTX þ H2O). No significant differences were noted in trabecular number and spacing (p > 0.05; data not shown). Treatment Effects on Osteoblast Density and Osteogenic Differentiation Potential MTX þ H2O caused a reduction in osteoblast density within the secondary spongiosa (p < 0.05 vs. normal saline group; Fig. 1F), and MTX þ FA and MTX þ FO(M) treatments preserved it (p < 0.05). Other supplement treatments [VO, FO(L), FO(H)] showed only small effects (p ¼ 0.11 vs. MTX þ H2O; Fig. 1F). MTX þ FA group actually significantly stimulated osteocalcin (OCN) expression as compared to controls and all of the other MTX treated groups (p < 0.001 vs. all other groups; Fig. 1G). Analyses of ex vivo osteogenic potential of bone marrow stromal cells showed a lower % of ALPþ CFUf colonies in MTX þ H2O-treated rats (p < 0.01 vs.

Sal þ H2O; Fig. 2A, B, and I). MTX þ VO, MTX þ FA, MTX þ FO(M) (all p < 0.05) and MTX þ FO(H) (p < 0.01) produced more ALPþ colonies compared to MTX þ H2O group (Fig. 2C, D, and I). Mineralization potential was not reduced in the MTX þ H2O group (p > 0.05 vs. Sal þ H2O), although it was significantly lower than Sal þ FO control (p < 0.05; Fig. 2E, F, and J). MTX þ supplement groups did not have significantly more mineralizing colonies (p > 0.05 vs. MTX þ H2O; Fig. 2G, H, and J). Runx2 mRNA expression was down-regulated in MTX þ H2O group (p < 0.05 and p < 0.01 vs. Sal þ H2O and Sal þ FA, respectively; Fig. 3A). Only MTX þ VO group had higher Runx2 levels (p < 0.001 vs. MTX þ H2O group). MTX þ FA and MTX þ FO(M) treatments had no protective effect on Runx2 expression (p > 0.05 vs. MTX þ H2O). While Osx expression (Fig. 3B) was not significantly reduced in MTX þ H2O group (p > 0.05 vs. saline groups) which was partially prevented by VO or FA supplementation (p ¼ 0.0782 and

Figure 2. Effects of MTX alone or together with vegetable oil (VO), fish oil (FO), or folinic acid (FA) on osteogenic potential of bone marrow stromal cells (BMSCs) from treated or control rats. CFU-f colonies stained positive for alkaline phosphatase (ALP) (arrows) of a (A) control rat, (B) MTX alone treated rat, (C) MTX þ FA treated rat, (D) MTX þ FO(M) treated rat. Alizarin Red-stained mineralized colonies (arrows) of a (E) control rat, (F) MTX alone treated rat, (G) MTX þ FA treated rat, and (H) MTX þ FO(M) treated rat. (I) Numbers of ALPþ CFU-f colonies. (J) Ex vivo mineralization assay data with bone marrow cells of treated rats; Labeled means without a common letter differ (p < 0.05). FO(L), FO(M) and FO(H) indicate fish oil at low (0.25 ml/100 g BW), mid (0.5 ml), and high dose (0.75 ml), respectively. JOURNAL OF ORTHOPAEDIC RESEARCH APRIL 2014

FISH OIL PREVENTS METHOTREXATE BONE DAMAGE

591

more adipocytes in the MTX þ H2O group (p < 0.001 vs. control groups; Fig. 4A, B, and E), and MTX þ VO, MTX þ FA and MTX þ FO(M) treatments prevented this adipocyte increase (p < 0.001; Fig. 4C–E). An ex vivo adipogenesis assay with bone marrow stromal cells revealed slightly more adipocytes formed in cultures from MTX þ H2O treated rats than from saline controls and from MTX þ VO, FO(M), or FO(H) (p ¼ 0.13; Fig. 4F). Levels of mRNA expression of adipogenesis regulatory genes PPAR-g and FABP4 in bone marrow stromal cells were up-regulated in MTX þ H2O group (p < 0.05 vs. saline groups; Fig. 4G and H). MTX þ VO, MTX þ FA and MTX þ FO(M) attenuated PPAR-g expression (p < 0.001 vs. MTX þ H2O). However, expression of FABP4 was attenuated only by MTX þ FO(M) (p < 0.001 vs. MTX þ H2O; Fig. 4H). Interestingly, VO supplementation further increased MTX-induced FABP4 expression (p < 0.001 vs. MTX þ H2O group).

Figure 3. Effects of MTX alone or with vegetable oil (VO), fish oil (FO), or folinic acid (FA) on mRNA expression of osteogenesis related genes. RT-PCR gene expression (relative to Cyclophilin-A and expressed as fold changes of untreated control group) of (A) Runx2, (B) Osx, and (C) OCN. Labeled means without a common letter differ (p < 0.05). FO(L), FO(M), and FO(H) indicate fish oil at low (0.25 ml/100 g BW), mid (0.5 ml), and high dose (0.75 ml), respectively.

p ¼ 0.0525 vs. MTX þ H2O, respectively), MTX þ FO(M) was the only group that had a significantly higher Osx level (p < 0.01 vs. MTX þ H2O). OCN mRNA expression was not affected in the metaphysis bone in the MTX-treated group when compared to the normal control group. However, it was significantly higher in the MTX þ FA treated group than that of the MTX þ H2O group (p < 0.05; Fig. 3C). None of the other treatment groups affected levels of OCN gene expression (p > 0.05).

Effects on Osteoclast Density, Formation, and Expression of Osteoclastogenic Molecules Density measurements of TRAP-stained osteoclasts within the primary and secondary spongiosa showed similar patterns of changes (data for primary spongiosa not shown). MTX þ H2O group had a higher osteoclast density (p < 0.01 vs. saline groups; Fig. 5A– E). Although all supplementations in MTX-treated rats reduced or tended to reduce osteoclast density, MTX þ FA, MTX þ FO(M) and MTX þ FO(H) groups had significantly fewer osteoclasts (p < 0.001 vs. MTX þ H2O; Fig. 5E). Consistently, ex vivo osteoclastogenesis assay with bone marrow cells of treated rats showed formation of more TRAPþ multinucleated cells in MTX þ H2O group (p < 0.001 vs. Sal þ H2O; p < 0.01 vs. Sal þ FA; Fig. 5F); and MTX þ FA and MTX þ FO(H) suppressed the osteoclastogenic potential (p < 0.001 vs. MTX þ H2O; Fig. 5F). Up-regulation in ratio of RANKL/OPG mRNA expression in bone was observed in MTX þ H2O group (p < 0.05 vs. saline groups), which was attenuated by all MTX þ supplement groups (p < 0.05 vs. MTX þ H2O; Fig. 6A). Expression of TNF-a (Fig. 6B) and IL-1 (Fig. 6C) was also increased in MTX þ H2O group (p < 0.001 or 0.001 vs. saline groups). All MTX þ supplement groups attenuated TNF-a (p < 0.001 vs. MTX þ H2O); and MTX þ FA, MTX þ FO(L), MTX þ FO(M) and MTX þ FO(H) suppressed IL-1 induction (p < 0.001 vs. MTX þ H2O). MTX þ H2O significantly increased IL-6 levels (p < 0.05 vs. Sal þ FO) (Fig. 6D); and MTX þ FO(M) and MTX þ FO(H) groups showed a significantly lower IL-6 level (p < 0.01 and p < 0.001 vs. MTX þ H2O, respectively; Fig. 6D).

DISCUSSION Treatment Effects on Adipocyte Density and Adipogenic Differentiation Histological assessment of bone marrow adipocyte density at the lower secondary spongiosa revealed

MTX has been long recognized to cause bone defects,5,22,37 for which there are no specific preventative treatments. Although recent studies have shown that the antidote folinic acid (FA; currently used to JOURNAL OF ORTHOPAEDIC RESEARCH APRIL 2014

592

RAGHU NADHANAN ET AL.

Figure 4. Effects of MTX alone or with vegetable oil (VO), fish oil (FO), or folinic acid (FA) on bone marrow adiposity. H&E stained sections of tibial lower secondary spongiosa in a (A) control rat, (B) MTX alone treated rat, (C) MTX þ FA treated rat, and (D) MTX þ FO(M) treated rat. (E) Adipocyte density at lower secondary spongiosa. (F) Nile redþ cells in an ex vivo adipogenesis assay. mRNA expression (relative to Cyclophilin-A and expressed as fold changes compared to untreated control group) of (G) PPARg and (H) FABP4 in bone marrow stromal cells. Labeled means without a common letter differ (p < 0.05). Scale bar in A ¼ 200 mm, applying to B– D. FO(L), FO(M) and FO(H) indicate fish oil at low (0.25), mid (0.5), and high dose (0.75 ml/100 g BW).

reduce MTX toxicity in soft tissues) prevents bone loss during MTX chemotherapy,16–18 further studies are required to investigate usage of FA in protecting bone as there have been clinical concerns regarding its JOURNAL OF ORTHOPAEDIC RESEARCH APRIL 2014

safety and dosage in protecting soft tissues.15,38 Since MTX-induced bone defects have been recently shown to involve inflammatory and osteoclastic bone loss mechanisms18,28,34 and n3 PUFAs have an anti-

FISH OIL PREVENTS METHOTREXATE BONE DAMAGE

593

Figure 5. Effects of MTX alone or with vegetable oil (VO), fish oil (FO), or folinic acid (FA) on osteoclastogenesis. Images of TRAPstained secondary spongiosa region (showing multinucleated osteoclasts) of (A) a control rat, (B) a MTX alone treated rat, (C) a MTX þ FA treated rat, and (D) a MTX þ FO(M) treated rat. (E) Osteoclast density at secondary spongiosa. (F) Ex vivo osteoclast formation (TRAP-positive multinuclear cells/mm2 culture area). Labeled means without a common letter differ (p < 0.05). Scale bar in A ¼ 100 mm, applying to B–D. FO(L), FO(M), and FO(H) indicate fish oil at low (0.25), mid (0.5), and high dose (0.75 ml/100 g BW).

inflammatory property and can reduce osteoclastic bone loss in animals and humans,26–28,39 the current study investigated therapeutic potential and potential dose-dependent response of n3 PUFA-rich fish oil in preventing MTX-induced bone loss. Supplementation with fish oil (at 0.5 or 0.75 ml/100 g) was found to be as effective as FA supplementation in conserving bone formation, suppressing bone resorption and marrow adiposity and preventing bone loss during MTX treatment. Only FA supplementation significantly maintained primary spongiosa height that was reduced by MTX treatment, although other supplementary treatment

groups had trends of preserving the primary spongiosa height. However, both FO and FA supplementations significantly prevented MTX-induced reduction in the trabecular bone volume, where they were also found to preserve osteoblast density and to suppress MTX-induced osteoclast presence. While FA supplementation was previously shown to preserve osteoblast density and prevent MTX-induced osteoclast increase on trabecular bone,17,18 the current work demonstrated that fish oil (at mid or high dose) can similarly protect osteoblasts and prevent osteoclast induction during MTX chemotherapy, preserving bone formation and preventing osteoclastic bone loss, JOURNAL OF ORTHOPAEDIC RESEARCH APRIL 2014

594

RAGHU NADHANAN ET AL.

Figure 6. Effects of MTX alone or together with vegetable oil (VO), fish oil (FO), or folinic acid (FA) on expression of osteoclastogenesis-regulatory genes. Levels of mRNA expression in metaphysis bone: (A) RANKL/OPG ratio, (B) TNF-a, (C) IL-1, and (D) IL-6 expressed relative to Cyclophilin-A and expressed as fold changes compared to untreated control group. Labeled means without a common letter differ (p < 0.05). FO(L) on graphs indicates fish oil at low dose (0.25 ml/100 g BW), FO(M) at mid dose (0.5 ml/ 100 g BW), and FO (H) at high dose (0.75 ml/100 g BW).

resulting in maintenance of trabecular bone structure and volume. Consistent with the increased bone osteoclast density and marrow osteoclast precursor content observed here, as well as MTX-induced increased expression of IL-1, IL-6, and TNF-a in bone seen previously,18,28,34 the current study found an increase in RANKL/OPG mRNA expression ratio and upregulated expression of IL-1, IL-6, and TNF-a in bone of MTX-treated rats. Osteoclast formation is mainly controlled by the RANKL/OPG signal ratio,40,41 and inflammatory cytokines have been shown to stimulate bone resorption.42,43 Thus MTX treatment resulted in an inflammatory and osteoclastogenic condition in the bone. Furthermore, the current study showed that fish oil (at mid or high dose) or folinic acid supplementation can counter MTX-induced increased IL-1, IL-6, and TNF-a expression and RANKL/OPG ratio, which may have contributed to the suppressed osteoclast density seen. Previous studies demonstrated that MTX treatment suppresses osteogenesis potential while favoring adipogenesis in bone marrow stromal cells, which may have contributed to bone loss observed.28,31 The current study found that, accompanying the decline in osteoblast density and a decrease in trabecular bone volume, decreased osteogenesis was observed in bone JOURNAL OF ORTHOPAEDIC RESEARCH APRIL 2014

marrow stromal cells as revealed by CFU-f-ALP assay despite not by Alizarin Red mineralization data. In addition, MTX treatment was found to decrease expression of early osteogenic transcription factor Runx2 and to a less extent the late osteogenic transcription factor Osx in the bone marrow stromal cells. The discrepancy between CFU-f-ALP data and mineralization data as well as between Runx2 and Osx expression data may indicate that MTX affects the early osteogenic differentiation more than later stage. On the other hand, there was an increase in bone marrow adipocyte density in MTX-treated rats, an increase in adipogenic potential and up-regulation in expression of adipogenesis transcription factor PPAR-g and related gene FABP4 in bone marrow stromal cells. This indicates that MTX treatment causes a switch in differentiation potential towards adipogenesis at the expense of osteogenesis, resulting in bone marrow adiposity. This phenomenon is similar to those caused by some other chemotherapeutic agents such as 5fluorouracil, cyclophosphamide, epirubicin, and etoposide whose usage was shown to cause an osteogenesis to adipogenesis switch within bone marrow of cancer patients.44,45 In the current study, fish oil (mid or high dose) or FA supplementation was found to not only preserve bone marrow cell osteogenesis (as revealed by CFU-f-ALP

FISH OIL PREVENTS METHOTREXATE BONE DAMAGE

assay) and expression of osteogenesis-related genes, but suppress MTX-induced adipogenesis and expression of PPAR-g and FABP4. Previous studies have shown that dietary n3 PUFAs can help in the preservation of bone mass by enhancing osteogenic differentiation of MSC through induction of Runx2 and Osx,46,47 and also inhibiting expression of PPAR-g and adipocyte differentiation.23,48 In the current study, while FO alone did not increase Osx expression in normal rats, it did increase Osx levels in MTX-treated rats. The lack of change in FO alone group could be related to the relatively shortterm in treatment; however, the significant induction of Osx in the MTX þ FO group could be related to FO effect in promoting bone regeneration after MTX treatment. Furthermore, FO alone appears to cause an increase in OCN expression (observable but insignificant when compared to saline-treated normal rats), and the OCN induction was also statistically insignificant in the MTX þ FO(M) group compared to MTX group. On the other hand, while FA alone appears to cause no changes in OCN expression (when compared to salinetreated normal group), there was a significant induction of OCN in MTX þ FA group when compared to MTX group. Previously, FA supplementation during MTX treatment was found to increase osteoblast differentiation16 and to block bone marrow adiposity.18 Overall, the current study indicates that fish oil supplementation, similar to FA adjunct treatment, can inhibit MTXinduced osteogenesis/adipogenesis switch in the bone marrow, preserving bone formation and preventing marrow adiposity. Overall, protective effects of fish oil at 0.5 ml/100 g were better than at 0.25 ml/100 g. However, effects at 0.75 ml/100 g were not consistently seen being better than at 0.5 ml/100 g, which could be related to the potential presence of a threshold dosage of fish oil given. It is possible that once the doses given have exceeded the threshold level, the effects at the higher doses may not be consistent in dosage-response across all analyses. More studies with different doses of fish oil are required to fully investigate the dose response effects of this supplement in preventing chemotherapyinduced bone loss. In addition, although it is generally believed that consumption of fish oil is relatively safe, future studies are required to investigate potential side effects of its ingestion at high doses. Furthermore, it is often debated which oil should be used as the control oil because other fatty acids such as oleic acid (n9 MUFA) can have independent health benefits.49 The vegetable oil (containing around 36% of n9 MUFA and 18% of PUFA) was used as the control oil in the current study. It is possible that the relatively high content of n9 MUFA and additional n3 PUFAs present may have partially offset the beneficial bone effects of fish oil compared to this control oil in some parameters analyzed. In summary, fish oil supplementation at 0.5 ml/ 100 g or above was as effective as FA supplementation in preserving bone formation and preventing

595

MTX chemotherapy-induced bone loss in rats. It preserved osteoblast density and bone formation, inhibited bone marrow adipogenesis, and suppressed pro-inflammatory cytokine expression and osteoclast recruitment during MTX treatment. While further studies are required to allow us to identify which supplement works better than the other, considering the differences in action mechanisms and the potential risk of over-rescuing with folinic acid during MTX treatment as discussed above, the comparative bone health protective outcomes were achieved by supplementary treatment with fish oil at 0.5 ml/100 g or above and by the folinic acid rescue at the clinically used dosage. Further studies are required to evaluate whether fish oil can preserve bone during longer-term chemotherapy with MTX or chemotherapy with other agents.

ACKNOWLEDGMENTS This project was funded by grants from Channel-7 Children’s Research Foundation of South Australia and NHMRC Australia. R.R.N. was a recipient of University of South Australia PhD scholarship, and C.J.X. is a senior research fellow of the NHMRC. Fish oil was provided by DSM Nutritional Products (Switzerland).

REFERENCES 1. Pfeilschifter J, Diel IJ. 2000. Osteoporosis due to cancer treatment: pathogenesis and management. J Clin Oncol 18:1570–1593. 2. Shapiro CL, Manola J, Leboff M. 2001. Ovarian failure after adjuvant chemotherapy is associated with rapid bone loss in women with early-stage breast cancer. J Clin Oncol 19:3306–3311. 3. Smith MR. 2003. Management of treatment-related osteoporosis in men with prostate cancer. Cancer Treat Rev 29:211– 218. 4. Jolivet J, Cowan KH, Curt GA, et al. 1983. The pharmacology and clinical use of methotrexate. N Engl J Med 309:1094– 1104. 5. Weinblatt ME. 1996. Methotrexate in rheumatoid arthritis: toxicity issues. Br J Rheumatol 35:403–405. 6. van Leeuwen BL, Kamps WA, Jansen HW, et al. 2000. The effect of chemotherapy on the growing skeleton. Cancer Treat Rev 26:363–376. 7. Fischer GS, Neira LL, Ferreiro MM, et al. 2005. [Bone mineral density in leukemic children after completing one month of chemotherapy]. Rev Med Chil 133:71–76. 8. Arikoski P, Komulainen J, Riikonen P, et al. 1999. Alterations in bone turnover and impaired development of bone mineral density in newly diagnosed children with cancer: a 1-year prospective study. J Clin Endocrinol Metab 84:3174– 3181. 9. Stanisavljevic S, Babcock AL. 1977. Fractures in children treated with methotrexate for leukemia. Clin Orthop Relat Res 125:139–144. 10. Ecklund K, Laor T, Goorin AM, et al. 1997. Methotrexate osteopathy in patients with osteosarcoma. Radiology 202: 543–547. 11. Cameron DA, Douglas S, Brown JE, et al. 2010. Bone mineral density loss during adjuvant chemotherapy in premenopausal women with early breast cancer: is it dependent on oestrogen deficiency? Breast Cancer Res Treat 123: 805–814. JOURNAL OF ORTHOPAEDIC RESEARCH APRIL 2014

596

RAGHU NADHANAN ET AL.

12. Henderson IC. 1987. Adjuvant systemic therapy for early breast cancer. Curr Probl Cancer 11:125–207. 13. Cohen IJ. 2004. Defining the appropriate dosage of folinic acid after high-dose methotrexate for childhood acute lymphatic leukemia that will prevent neurotoxicity without rescuing malignant cells in the central nervous system. J Pediatr Hematol Oncol 26:156–163. 14. Bhurani D, Schifter M, Kerridge I. 2008. Folinic acid administration following MTX as prophylaxis for GVHD in allogeneic HSCT centres in Australia and New Zealand. Bone Marrow Transplant 42:547–550. 15. Ortiz Z, Shea B, Suarez-Almazor ME, et al. 1998. The efficacy of folic acid and folinic acid in reducing methotrexate gastrointestinal toxicity in rheumatoid arthritis. A metaanalysis of randomized controlled trials. J Rheumatol 25:36– 43. 16. Fan C, Cool JC, Scherer MA, et al. 2009. Damaging effects of chronic low-dose methotrexate usage on primary bone formation in young rats and potential protective effects of folinic acid supplementary treatment. Bone 44:61–70. 17. Xian CJ, Cool JC, Scherer MA, et al. 2008. Folinic acid attenuates methotrexate chemotherapy-induced damages on bone growth mechanisms and pools of bone marrow stromal cells. J Cell Physiol 214:777–785. 18. Fan CM, Foster BK, Hui SK, et al. 2012. Prevention of bone growth defects, increased bone resorption and marrow adiposity with folinic acid in rats receiving long-term methotrexate. PLoS ONE 7:e46915. 19. Wolfrom C, Hartmann R, Fengler R, et al. 1993. Randomized comparison of 36-hour intermediate-dose versus 4-hour high-dose methotrexate infusions for remission induction in relapsed childhood acute lymphoblastic leukemia. J Clin Oncol 11:827–833. 20. Skarby TV, Anderson H, Heldrup J, et al. 2006. High leucovorin doses during high-dose methotrexate treatment may reduce the cure rate in childhood acute lymphoblastic leukemia. Leukemia 20:1955–1962. 21. Robien K. 2005. Folate during antifolate chemotherapy: what we know … and do not know. Nutr Clin Pract 20:411– 422. 22. Fan C, Georgiou KR, King TJ, et al. 2011. Methotrexate toxicity in growing long bones of young rats: a model for studying cancer chemotherapy-induced bone growth defects in children. J Biomed Biotechnol 2011:903097. 23. Vanek C, Connor WE. 2007. Do n3 fatty acids prevent osteoporosis? Am J Clin Nutr 85:647–648. 24. Kruger MC, Horrobin DF. 1997. Calcium metabolism, osteoporosis and essential fatty acids: a review. Prog Lipid Res 36:131–151. 25. Watkins BA, Li Y, Allen KG, et al. 2000. Dietary ratio of (n6)/(n3) polyunsaturated fatty acids alters the fatty acid composition of bone compartments and biomarkers of bone formation in rats. J Nutr 130:2274–2284. 26. Sun D, Krishnan A, Zaman K, et al. 2003. Dietary n3 fatty acids decrease osteoclastogenesis and loss of bone mass in ovariectomized mice. J Bone Miner Res 18:1206–1216. 27. Fong L, Muhlhausler BS, Gibson RA, et al. 2012. Perinatal maternal dietary supplementation of omega3-fatty acids transiently affects bone marrow microenvironment, osteoblast and osteoclast formation, and bone mass in male offspring. Endocrinology 153:2455–2465. 28. Raghu Nadhanan R, Skinner J, Chung R, et al. 2013. Supplementation with Fish oil and genistein, individually or in combination, protects bone against the adverse effects of methotrexate chemotherapy in rats. PLoS ONE 8:e71592. 29. Xian CJ, Cool JC, Scherer MA, et al. 2007. Cellular mechanisms for methotrexate chemotherapy-induced bone growth defects. Bone 41:842–850. JOURNAL OF ORTHOPAEDIC RESEARCH APRIL 2014

30. Veerman AJ, Kamps WA, van den Berg H, et al. 2009. Dexamethasone-based therapy for childhood acute lymphoblastic leukaemia: results of the prospective Dutch Childhood Oncology Group (DCOG) protocol ALL-9 (1997–2004). Lancet Oncol 10:957–966. 31. Georgiou KR, Scherer MA, Fan CM, et al. 2012. Methotrexate chemotherapy reduces osteogenesis but increases adipogenic potential in the bone marrow. J Cell Physiol 227:909– 918. 32. Georgiou KR, King TJ, Scherer MA, et al. 2012. Attenuated Wnt/beta-catenin signalling mediates methotrexate chemotherapy-induced bone loss and marrow adiposity in rats. Bone 50:1223–1233. 33. Xian CJ, Cool JC, Pyragius T, et al. 2006. Damage and recovery of the bone growth mechanism in young rats following 5-fluorouracil acute chemotherapy. J Cell Biochem 99:1688–1704. 34. King TJ, Georgiou KR, Cool JC, et al. 2012. Methotrexate chemotherapy promotes osteoclast formation in the long bone of rats via increased pro-inflammatory cytokines and enhanced NF-kappaB activation. Am J Pathol 181:121–129. 35. McCarty RC, Gronthos S, Zannettino AC, et al. 2009. Characterisation and developmental potential of ovine bone marrow derived mesenchymal stem cells. J Cell Physiol 219:324–333. 36. Zhou FH, Foster BK, Sander G, et al. 2004. Expression of proinflammatory cytokines and growth factors at the injured growth plate cartilage in young rats. Bone 35:1307–1315. 37. Wheeler DL, Vander Griend RA, Wronski TJ, et al. 1995. The short- and long-term effects of methotrexate on the rat skeleton. Bone 16:215–221. 38. Matherly LH, Goldman DI. 2003. Membrane transport of folates. Vitam Horm 66:403–456. 39. Griel AE, Kris-Etherton PM, Hilpert KF, et al. 2007. An increase in dietary n3 fatty acids decreases a marker of bone resorption in humans. Nutr J 6:2. 40. Grimaud E, Soubigou L, Couillaud S, et al. 2003. Receptor activator of nuclear factor kappaB ligand (RANKL)/osteoprotegerin (OPG) ratio is increased in severe osteolysis. Am J Pathol 163:2021–2031. 41. Trouvin AP, Goeb V. 2010. Receptor activator of nuclear factor-kappaB ligand and osteoprotegerin: maintaining the balance to prevent bone loss. Clin Interv Aging 5:345–354. 42. Boyce BF, Li P, Yao Z, et al. 2005. TNF-alpha and pathologic bone resorption. Keio J Med 54:127–131. 43. Nguyen L, Dewhirst FE, Hauschka PV, et al. 1991. Interleukin-1 beta stimulates bone resorption and inhibits bone formation in vivo. Lymphokine Cytokine Res 10:15–21. 44. Davies JH, Evans BA, Jenney ME, et al. 2002. In vitro effects of combination chemotherapy on osteoblasts: implications for osteopenia in childhood malignancy. Bone 31:319– 326. 45. Ben-Ishay Z, Barak V. 2001. Bone marrow stromal dysfunction in mice administered cytosine arabinoside. Eur J Haematol 66:230–237. 46. Atkinson TG, Barker HJ, Meckling-Gill KA. 1997. Incorporation of long-chain n3 fatty acids in tissues and enhanced bone marrow cellularity with docosahexaenoic acid feeding in post-weanling Fischer 344 rats. Lipids 32:293–302. 47. Jilka RL. 2002. Osteoblast progenitor fate and age-related bone loss. J Musculoskelet Neuronal Interact 2:581–583. 48. Okuno M, Kajiwara K, Imai S, et al. 1997. Perilla oil prevents the excessive growth of visceral adipose tissue in rats by down-regulating adipocyte differentiation. J Nutr 127:1752–1757. 49. Rennie KL, Hughes J, Lang R, et al. 2003. Nutritional management of rheumatoid arthritis: a review of the evidence. J Hum Nutr Diet 16:97–109.

Fish oil in comparison to folinic acid for protection against adverse effects of methotrexate chemotherapy on bone.

Methotrexate (MTX) chemotherapy is known to cause bone loss which lacks specific preventative treatments, although clinically folinic acid is often us...
8MB Sizes 0 Downloads 0 Views