The International Journal of Biochemistry & Cell Biology 54 (2014) 236–244

Contents lists available at ScienceDirect

The International Journal of Biochemistry & Cell Biology journal homepage: www.elsevier.com/locate/biocel

Fluoxetine suppresses AMP-activated protein kinase signaling pathway to promote hepatic lipid accumulation in primary mouse hepatocytes Jing Xiong a , Huan Yang b , Lili Wu a , Wei Shang a , Enfang Shan a , Wei Liu a , Gang Hu a , Tao Xi b , Jian Yang a,∗ a

Department of Pharmacology, Nanjing Medical University, Nanjing, Jiangsu 210029, China Research Center of Biotechnology, School of Life Science and Technology, China Pharmaceutical University, 24 Tongjiaxiang, Nanjing, Jiangsu 210009, China b

a r t i c l e

i n f o

Article history: Received 28 April 2014 Received in revised form 7 July 2014 Accepted 25 July 2014 Available online 5 August 2014 Keywords: Fluoxetine AMPK Carboxylesterases Hepatic lipid accumulation SREBP

a b s t r a c t In the previous study, we demonstrated that fluoxetine (FLX) regulated lipogenic and lipolytic genes to promote hepatic lipid accumulation. On this basis, underlying mechanisms were investigated by focusing on the intracellular signaling transduction in the present study using primary mouse hepatocytes. The expression of lipogenesis- and lipolysis-related genes was evaluated with the application of specific activators and inhibitors. Activation status of respective signaling pathway and the lipid accumulation in hepatocytes were analyzed. We provided evidence that AMP-activated protein kinase (AMPK) activator AICAR (5-aminoimidazole-4-carboxamide-1-␤-d-ribofuranoside) significantly suppressed the increased expression of representative lipogenesis-related genes, acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) by FLX, while increased the repressed expression of lipolysis-related genes, carboxylesterases. In the meanwhile, FLX regulated the above genes in the same way as AMPK inhibitor Compound C did. Furthermore, AICAR inhibited the proteolytic activation of SREBP1c induced by FLX, resulting in the decreased level of nuclear SREBP1c. Further studies demonstrated that FLX significantly suppressed the phosphorylation of AMPK and subsequent phosphorylation of ACC, following the inhibited phosphorylation and nuclear export of liver kinase B1 (LKB1). As a functional analysis, FLX-induced lipid accumulation in hepatocytes was repeatedly abolished by AICAR. In conclusion, FLX-induced hepatic lipid accumulation is mediated by the suppression of AMPK signaling pathway. The findings not only provide new insight into the understanding of the mechanisms for selective serotonin reuptake inhibitors-mediated dyslipidemia effects, but also suggest a novel therapeutic target to interfere. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction Fluoxetine (FLX) is the most widely prescribed psychoactive drug in the market. It acts as a selective serotonin reuptake inhibitor

Abbreviations: FLX, fluoxetine; SSRI, selective serotonin reuptake inhibitors; AMPK, AMP-activated protein kinase; LKB1, liver kinase B1; AICAR, 5-aminoimidazole-4-carboxamide-1-␤-d-ribofuranoside; Compound C, 6-[4-(2PDTC, piperidin-1-ylethoxy)phenyl]-3-pyridin-4-ylpyrazolo[1,5-a]pyrimidine; pyrrolidine dithiocarbamate; SREBP, sterol regulatory element-binding protein; ACC, acetyl-CoA carboxylase; FAS, fatty acid synthase; Ces (mouse) or CES (human), carboxylesterase; PXR, pregnane X receptor; CAR, constitutive androstane receptor; RXR, retinoid X receptor; DMEM, Dulbecco’s modified Eagle’s medium. ∗ Corresponding author. Tel.: +86 25 86863159; fax: +86 25 86863159. E-mail address: [email protected] (J. Yang). http://dx.doi.org/10.1016/j.biocel.2014.07.019 1357-2725/© 2014 Elsevier Ltd. All rights reserved.

(SSRI) in the treatment of depression and other mood disorders by increasing the serotonin levels in synaptic cleft (Desmarais et al., 2011; Severus et al., 2012; Wong et al., 2005). Among the most important determinants for antidepressant therapy discontinuation is the involvement of drug adverse reactions (Penas-Lledo et al., 2013; Uher et al., 2009). The key adverse reactions induced by FLX include high possibility of weight gain and dyslipidemia (Jazayeri et al., 2008; Mastronardi et al., 2011). Therefore, better understanding the mechanisms underlying fluoxetine-induced metabolic disorders makes a great contribution to enhance the adherence and tolerance of FLX treatment. Accumulation of triglycerides (TG) in hepatocytes is an important manifestation for obesity and other related metabolic disorders (Nassir et al., 2013; Richard and Lingvay, 2011). The liver is a major organ in maintaining metabolic homeostasis by

J. Xiong et al. / The International Journal of Biochemistry & Cell Biology 54 (2014) 236–244

expressing high levels of lipogenesis- and lipolysis-related enzymes. Fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC) are important enzymes in the de novo fatty acid and TG synthesis in the liver (Cheng et al., 2007; Menendez et al., 2009). Both enzymes are target genes of sterol regulatory element-binding protein (SREBP), a key lipogenic transcription factor (Ferre and Foufelle, 2010). Precursors of the SREBPs (p-SREBP) are synthesized inactive and then undergoes sequential proteolytic cleavage to release the transcriptionally active N-terminal domain (n-SREBP). Once the mature nuclear form of SREBP is translocated into the nucleus, it binds to sterol regulatory element (SRE) and activates the transcription of target genes, thereby promoting the lipogenic process in the liver (Eberle et al., 2004). SREBP1c, one of the two splice variants of SREBP1, is by far the most abundant isoform in the liver and plays an important role in the regulation of lipogenic gene expression and lipid storage in liver (Horton et al., 2002). The dysregulation of SREBP1c has been indicated in the pathogenesis of fatty liver and dyslipidemia (Browning and Horton, 2004; Raghow et al., 2008). In the contrast, liver lipases that degrade TG in hepatocytes also contribute to hepatic lipid metabolism. Expression of hormone-sensitive lipase (HSL) and adipose triglyceride lipase (ATGL) is found to be very low in the liver, therefore, some members of carboxylesterases are more important to contribute to hepatic TG metabolism (Quiroga and Lehner, 2012). Mouse carboxylesterase (Ces) 1d, an ortholog of human CES1, is also named TG hydrolyase. It is highly expressed in the liver and plays a critical role in hepatic TG mobilization and by extension TG storage (Lehner and Vance, 1999). Mouse Ces1e (esterase-x), a close homolog of human CES2, is also highly expressed in the liver. Its conserved esterase/lipase active site motif indicates a role in hepatic TG metabolism as Ces1d does. In addition, Ces1e also prevents TG accumulation in hepatocytes by promoting ␤-oxidation (Ko et al., 2009). As an energy sensor, AMP-activated protein kinase (AMPK) is a serine/threonine kinase that is activated by an elevated AMP/ATP ratio due to cellular energy depletion (Rutter et al., 2003). In mammals, the activation of AMPK occurs primarily through the phosphorylation of its catalytic ␣-subunit by liver kinase B1 (LKB1) or by Ca2+ /calmodulin-dependent protein kinase kinase ␤ (CaMKK␤) (Hawley et al., 2003; Woods et al., 2005). The AMPK activation causes an increase in compensatory catabolism and inactivation of anabolic pathways. A decrease in cellular energy increases glucose uptake, glycolysis and fatty acid oxidation via AMPK-dependent pathways (Kahn et al., 2005). Inhibition of AMPK leads to the activation of lipogenesis mediated by SREBP1 and as a central event causing the development of chemical-induced fatty liver (Porstmann et al., 2008; You et al., 2004). Conversely, AMPK phosphorylation leads to suppressed SREBP1 expression and activation, as well as reduced lipogenesis and lipid accumulation (Quan et al., 2013). In addition, activated AMPK phosphorylates ACC at Ser79 and leads to the inactivation of ACC, further supporting its role in reducing lipogenesis (Hardie and Pan, 2002). Thus, inhibition of AMPK by chemicals or physiological state possibly contributes to the intracellular accumulation of lipids in liver cells. Previously, we demonstrated that FLX significantly increased the expression of ACC and FAS, and decreased the expression of Ces1d and Ces1e. The altered expression of these lipid metabolismrelated genes was translated into the obvious lipid accumulation in hepatocytes (Feng et al., 2012). However, the mechanisms are still scarcely known. Based on the information above, it is hypothesized that FLX-induced lipid accumulation is through suppressing AMP-activated protein kinase signaling pathway in hepatocytes. The study contributes to further clarify the mechanisms of metabolic side effects resulting from FLX and other antidepressants.

237

2. Materials and methods 2.1. Materials Fluoxetine, Oil Red O, NF␬B inhibitor ammonium pyrrolidine dithiocarbamate (PDTC), AMPK activator 5-aminoimidazole-4carboxamide-1-␤-d-ribofuranoside (AICAR) and AMPK inhibitor 6[4-(2-piperidin-1-ylethoxy)phenyl]-3-pyridin-4-ylpyrazolo [1,5a]pyrimidine (Compound C) were purchased from Sigma (St. Louis, MO, USA). TRIzol, high-fidelity platinum Taq DNA polymerase and Dulbecco’s modified Eagle’s medium (DMEM) were from Invitrogen (Carlsbad, CA, USA). MLV reverses transcriptase and RNase inhibitors were from Promega (Madison, WI, USA). Fetal bovine serum was from Sijiqing (Hangzhou, China). Polyvinylidene difluoride membranes were from Bio-Rad Laboratories (Hercules, CA, USA). Mouse Ces1d or Ces1e were detected by antibodies against human CES 1 or human CES 2, kindly provided by Dr. Bingfang Yan, because mouse Ces1d or Ces1e can be detected by human CES1 or CES2 antibodies as reported previously (Xiao et al., 2012). Other primary antibodies used in this study were as follows: Anti-ACC (Abcam, Cambridge, UK), anti-SREBP1c and anti-pAMPK(Thr172 ) (Anbo, Changzhou, China), anti-pLKB1(S428 ), anti-pACC(S79 ) (Cell Signaling Technology, USA), anti-LKB1, anti-FAS, anti-AMPK, antiGAPDH, and anti-␤-actin (Bioworld, St. Louis Park, USA). The goat anti-rabbit IgG conjugated with horseradish peroxidase were from Pierce Chemical (Pierce, Rockford, IL, USA). All other reagents were of analytical grade and commercially available. 2.2. Primary mouse hepatocytes culture Male ICR mice, 18–22 g, were obtained from the experimental animal center of Nanjing (Nanjing, China). The use of animals was approved by IACUC (Institutional Animal Care and Use Committee) of Nanjing Medical University. Every effort was made to minimize animal suffering and to reduce the number of animals used for experiments. Hepatocytes were isolated from livers of male ICR mice referred to a modification of the two-step perfusion method as we described previously (Feng et al., 2012). Following, cells were suspended in the DMEM supplemented with 10% FBS and seeded into collagen-coated six-well plates and were maintained at 37 ◦ C, in a humidified atmosphere of 5% CO2 for 4 h to allow attachment. Cells were then washed with PBS, changed with fetal bovine serum free medium and allowed culture for two days before any treatment. 2.3. Neutral oil staining Primary mouse hepatocytes were treated with FLX (10 ␮M) or 0.1% DMSO for 24 h following the pretreatment of PDTC (10 ␮M), AICAR (50 ␮M) or saline for 30 min. Primary mouse hepatocytes were washed extensively with D-Hank’s solution and fixed with 4% paraformaldehyde for 20 min at room temperature. The fixed cells were stained with freshly diluted Oil Red O solution (0.5% Oil Red O in isopropanol: H2 O = 3:2) for 1 h at 37 ◦ C and rinsed with D-Hank’s solution. The primary mouse hepatocytes were visualized for microphotographs microscopically using a Leica DM6000B digital light microscope (Leica Microsystems, Wetzlar, Germany). 2.4. Reverse transcription-polymerase chain reaction Total RNA was isolated by using TRIzol and checked by 1.5% agarose gel electrophoresis for quality control. The first-strand cDNA was synthesized using total RNA (1 ␮g) at 25 ◦ C for 10 min, 42 ◦ C for 50 min, and 70 ◦ C for 10 min using oligo(dT) and M-MLV reverse transcriptase. The primers used for mouse Ces1d, Ces1e

238

J. Xiong et al. / The International Journal of Biochemistry & Cell Biology 54 (2014) 236–244

and GAPDH were as follows: Ces1d forward, GGCATCAACAAGCAAGAGTTTGGC and reverse, CTTTTTGGTGAGGTGATCTGTCCC; CES1e forward, TTCAAGGATGTCAGACCACC and reverse, AACACATTTTTTTTGATACAGGGTA; mouse GAPDH forward, GTATGTC GTGGAGTCTACTGGTGTC and reverse, GGTGCAGGATGCATTGCTGACATTC. The thermal cycling conditions of the PCR were 94 ◦ C for 5 min, followed by 23–35 cycles for 20 s at 94 ◦ C, 20 s at 64 ◦ C, 1 min at 72 ◦ C, and a final extension at 72 ◦ C for 7 min. The amplified products were separated by electrophoresis in 0.59 Tris–acetate EDTA buffer with a 1.5% agarose gel containing 0.1 ␮g/mL of ethidium bromide (6 ␮L). The DNA bands were visualized and analyzed by Biosens sc 810 Gel Electrophoresis Image analytic system (Shanghai, China). The ratios of Ces1d, Ces1e mRNA, and GAPDH mRNA were calculated.

2.8. Statistical analysis

2.5. Preparation of cytoplasmic and nuclear extracts

ACC and FAS are key enzymes in the de novo hepatic fatty acid synthesis. Therefore, in order to investigate the mechanisms of FLX-induced hepatic lipid accumulation, we investigated whether the effect of FLX on the endogenous expression of ACC and FAS was mediated by AMPK signaling pathway. AMPK activator AICAR (50 ␮M) and NF␬B inhibitor PDTC (10 ␮M) were added and incubated with hepatocytes for 30 min, followed by the treatment of FLX (10 ␮M) for 24 h. As shown in Fig. 1A, the expression of ACC and FAS was repeatedly increased by FLX (10 ␮M), which was related to the promoted lipid accumulation caused by FLX. The upregulated expression of both enzymes was potently repressed by AMPK activator AICAR (50 ␮M). The results indicate that FLX suppresses AMPK signaling, and then increases the expression of key enzymes in hepatic fatty acid synthesis, leading to the promoted lipogenesis and lipid accumulation in hepatocytes. Following, lipolysis, a process leading to the degradation of TG into fatty acids and glycerol in primary hepatocytes was investigated to move a step further in enlightening the mechanisms of FLX-induced hepatic lipid accumulation. The mRNA and protein expression of mouse Ces1d and Ces1e, two major lipolytic enzymes in hepatic TG degradation, were assayed. As shown in Fig. 1B, FLX significantly decreased the CES1d and CES1e expression at both mRNA level and protein level, which were repeatedly abolished by AMPK activator AICAR (Fig. 1B). The data implied that the downregulation of CES1d and CES1e by FLX was also mediated by AMPK signaling pathway, which played an important role in FLX-induced hepatic lipid accumulation. In contrast, NF␬B inhibitor PDTC (10 ␮M) consistently had no effect on the expression of lipogenesis- and lipolysis-related enzymes, revealing the irrelevant role of NF␬B in FLX-induced hepatic lipid accumulation. As a reference, the treatment of AICAR or PDTC alone in the indicated concentration had no influence on the expression of both lipogenic and lipolytic enzymes.

Cytoplasmic and nuclear extracts were prepared as described (Sfikas et al., 2012). Briefly, cells were scraped from dishes in PBS, pelleted, washed in hypotonic buffer (10 mM HEPES buffer, pH 7.9, 1.5 mM MgCl2 , 5 mM KCl, 1 mM PMSF, 1 mM dithiothreitol, 1 mM Na3 VO4 , 1 mM NaF), and lysed by resuspension in the same buffer with 0.1% Nonidet P-40. Cytoplasmic extracts were isolated by centrifugation at 10,000 × g for 10 min. Nuclear pellets were washed in hypotonic buffer and resuspended in cold extraction buffer (20 mM HEPES, 25% glycerol, 450 mM KCl, 1 mM EDTA, 1 mM PMSF, 1 mM Na3 VO4 , 1 mM NaF), gently agitated at 4 ◦ C for 45 min, and spun at 13,000 × g for 30 min at 4 ◦ C. Supernatants were collected, and protein concentrations were determined with BCA protein assay based on the albumin standard (Pears, Rockford, IL, USA). Isolated subcellular fractions were then checked for purity by Western analysis of the respective marker for cytoplasmic or nuclear compartment.

2.6. Western blotting The cells used for phospho-lysates were lysed with lysis buffer enriched with protease and phosphatase inhibitors cocktail. Protein concentrations were determined with BCA protein assay based on the albumin standard (Pears, Rockford, IL, USA). Equal amounts of protein were separated on a 10% SDS-polyacrylamide gel and transferred electrophoretically onto polyvinylidene difluoride membranes. The membranes were blocked with 5% non-fat milk in Tris-buffered saline/0.1% Tween 20 for 2 h, subsequently blotted with respective primary antibodies overnight, and then blotted with horseradish peroxidase-conjugated secondary antibody for 1 h. The protein bands were visualized with enhanced chemiluminescence detection system. Protein levels were quantified by density analysis using Image J software (NIH), and expressed as interest protein/internal control.

2.7. Immunofluorescence microscopy analysis of ACC phosphorylation and LKB1 localization Cells were seeded at 2 × 105 cells/well on glasses bottom dishes. After treatment with saline or FLX (10 ␮M), cells were rinsed with PBS and fixed with 4% paraformaldehyde for 10 min. Permeabilization was performed in PBS with 0.3% Triton X-100 for 10 min. After blocking for 30 min with 5% bovine serum albumin, the cells were incubated with anti-LKB1 or anti-pACC Ser79 primary antibody at 4 ◦ C overnight. After washing with PBS, FITC-conjugated secondary antibody (Bioworld, St. Louis Park, USA) was added for 1 h in the dark. Nuclei were stained with 4 ,6 -diamidino-2-phenylindole (DAPI; Bioworld, St. Louis Park, USA), and the cells were visualized under LSM 710 laser confocal microscope (Carl Zeiss, Germany).

The experimental results were expressed as the mean ± SEM of at least three separate experiments. Statistical analysis was performed with a one-way ANOVA, followed by Duncan’s multiple comparison test. The differences were considered statistically significant when p < 0.05. All statistical analyses were performed using SPSS17.0 analysis software.

3. Results 3.1. AMPK activator AICAR abolishes the upregulation of lipogenesis-related enzymes and downregulation of lipolysis-related genes by FLX

3.2. FLX regulates the expression of lipogenic and lipolytic genes in a similar way as AMPK inhibitor Compound C does To confirm that FLX regulated the expression of lipogenesisand lipolysis-related genes by suppressing AMPK signaling pathway, AMPK inhibitor Compound C (20 ␮M) was incubated with hepatocytes for 30 min followed by the treatment of FLX (10 ␮M) for 24 h. In concert, the expression of ACC and FAS was significantly increased by FLX, while Ces1d and Ces1e were repeatedly decreased by the treatment of FLX (Fig. 2). The effect of FLX was exactly consistent with the application of Compound C. The combination of FLX and Compound C did not achieve synergistic or additive consequences. Instead, the altered expression resulting from the simultaneous incubation of FLX and Compound C was similar with or ever less than the treatment of single chemical

J. Xiong et al. / The International Journal of Biochemistry & Cell Biology 54 (2014) 236–244

239

Fig. 1. AMPK activator AICAR abolished the upregulation of lipogenic genes, ACC and FAS (A), and the downregulation of lipolytic genes, Ces1d and Ces1e (B), induced by FLX in the primary mouse hepatocytes. Primary hepatocytes were cultured and treated with FLX (10 ␮M) or 0.1% DMSO for 24 h following the pretreatment of AICAR (50 ␮M), PDTC (10 ␮M) or saline for 30 min. Total RNA or whole cell lysates were prepared and analyzed with RT-PCR or Western blot. All experiments described in this figure were repeated independently at least three times, and data are expressed as mean ± SEM. *p < 0.05 vs. DMSO-treated group; # p < 0.05 vs. saline-treated group.

alone. The results implied that FLX acted in a similar way as AMPK inhibitor Compound C did.

3.3. The promotion of SREBP-1c proteolytic cleavage is the downstream of AMPK signaling suppression by FLX In order to further elucidate how FLX promoted lipogenesis and reduced lipolysis in mouse hepatocytes, SREBP1c, an important transcriptional factor playing an established role in hepatic TG synthesis, was then examined in the following study. As show in Fig. 3, both precursor SREBP1c (p-SREBP1c, 125 kDa) and truncated nuclear (active) form of SREBP1c (n-SREBP1c, 68 kDa) were significantly increased by FLX in primary mouse hepatocytes. Furthermore, the increased truncated SREBP1c (n-SREBP1c) by FLX, instead of precursor SREBP1c (p-SREBP1c), was significantly repressed by AMPK activator AICAR (Fig. 3). The protein levels of p-SREBP1c with the treatment of AICAR and FLX were even higher than that with the treatment of FLX alone, indicating increased expression of SREBP1c by FLX was possibly not dependent upon AMPK signaling. Again, the treatment of AICAR alone had no

influence on the expression and proteolytic cleavage of SREBP1c. The data suggested that FLX suppressed AMPK signaling, and subsequently promoted the proteolytic cleavage of p-SREBP1c, resulting in the increasing of active form n-SREBP1c to translocate into nucleus and to regulate the genes in TG synthesis and degradation. These findings indicated that AMPK-SREBP1c pathway was highly involved in FLX-induced hepatic lipid accumulation.

3.4. FLX inhibits the phosphorylation of AMPK and ACC in mouse hepatocytes To further confirm the role of AMPK signaling pathway in FLXcaused hepatic lipid accumulation, primary mouse hepatocytes were treated with FLX (10 ␮M) and incubated for an indicated period. Following, cell phospho-lysates were prepared and AMPK phosphorylation was detected by Western blotting assays. As shown in Fig. 4A, FLX significantly suppressed AMPK phosphorylation in hepatocytes after the incubation lasting for 1 min and the suppression were extended to 30 min without any obvious

240

J. Xiong et al. / The International Journal of Biochemistry & Cell Biology 54 (2014) 236–244

Fig. 2. FLX regulated the expression of lipogenesis- and lipolysis-related genes as potent as AMPK inhibitor Compound C did. Primary hepatocytes were cultured and treated with FLX (10 ␮M) or 0.1% DMSO for 24 h following the pretreatment of Compound C (20 ␮M) or saline for 30 min. Whole cell lysates were prepared and equal amount of protein were used for the Western analysis of interest proteins. All experiments described in this figure were repeated independently at least three times, and data are expressed as mean ± SEM. *p < 0.05 vs. DMSO-treated group; #p < 0.05 vs. saline-treated group.

attenuation. It was indicated that FLX possessed a potent inhibitory capability on AMPK signaling pathway in primary hepatocytes. In addition, as a best-characterized downstream enzyme of AMPK, the phosphorylation of ACC at Ser79 was detected by using

a specific antibody. As shown in Fig. 4B, FLX potently inhibited ACC phosphorylation at Ser79 in hepatocytes after the incubation lasting for 3 min and the obvious suppression were extended to 90 min. It was shown that in addition to the elevated activation of SREBP1c and the subsequent altered expression of lipid-related enzymes, the suppression of AMPK signaling also resulted in the decreased inactivation of ACC, further supporting the role of FLX in promoting lipid accumulation in hepatocytes. The suppressed phosphorylation of ACC was further confirmed using immunofluorescence assays after staining with a specific antibody and detected by a laser confocal microscope (Fig. 4C).

3.5. The suppressed phosphorylation of AMPK by FLX is mediated by the inhibition of LKB1 activation

Fig. 3. Effects of AMPK activator AICAR on the expression and proteolytic activation of SREBP-1c increased by FLX Primary hepatocytes were cultured and treated with FLX (10 ␮M) or 0.1% DMSO for 24 h following the pretreatment of AICAR (50 ␮M), PDTC (10 ␮M) or saline for 30 min. Whole cell lysates were prepared and equal amount of protein were used for the Western analysis. Precursor SREBP-1c (pSREBP1c) and mature SREBP-1c (nSREBP-1c) were detected. All experiments described in this figure were repeated independently at least three times, and data are expressed as mean ± SEM. *p < 0.05 vs. DMSO-treated group; # p < 0.05 vs. saline-treated group.

As a major upstream kinase of AMPK, LKB1 must be exported from the nucleus into cytosols where AMPK is located (Vu et al., 2013; Xie et al., 2008). Therefore, we next established that FLX inhibited the translocation of LKB1 from the nucleus to the cytosol. In untreated primary mouse hepatocytes, LKB1 was localized in both cytosols and nuclei. With the treatment of FLX, the amount of cytosolic LKB1 was reduced while the nuclear fraction was increased slightly after 30 min incubation and significantly after the exposure lasted for 60 min. It was confirmed with Western analysis of LKB1 using subcellular fractions (Fig. 5A), as well as the detection by a laser scanning microscope (Fig. 5B). The subcellular location of LKB1 was obviously affected by the treatment of FLX. Since the phosphorylation of LKB1 at Ser428 is required for its activity (Xie et al., 2008), we further determined its phosphorylation status with the treatment of FLX. As depicted in Fig. 5C, the signals corresponding to LKB1-Ser428 phosphorylation were significantly decreased by the treatment of FLX for a period from 1 min to 10 min. The data suggested that the LKB1 activation was potently suppressed by FLX and probably the first event after the treatment by FLX on the hepatocytes.

J. Xiong et al. / The International Journal of Biochemistry & Cell Biology 54 (2014) 236–244

241

Fig. 4. FLX inhibited the phosphorylation of AMPK and ACC in the primary mouse hepatocytes. After continued culture for two days, primary hepatocytes were treated with FLX (10 ␮M) for indicated time points. (A, B) Phospho-lysates were prepared and equal amount of protein were used for the Western analysis of the phosphorylation of AMPK (A) or ACC (B). Experiments described in this figure were repeated independently at least three times, and data are expressed as mean ± SEM. *p < 0.05 vs. no FLX-treated group. (C) Confocal fluorescence micrographs of hepatocytes treated with DMSO (control) or FLX (10 ␮M) for 60 min were obtained after staining with FITC for pACC and DAPI for nuclear staining. Images shown in this figure (400×) were representative of three independent experiments.

3.6. The hepatic lipid accumulation induced by fluoxetine is dependent upon the suppression of AMPK signaling in primary mouse hepatocytes To investigate whether the suppressed intracellular signaling pathways and regulated genes expression would be translated into functional alteration, primary hepatocytes were incubated with activators or inhibitors of some signaling pathways. Neutral oil droplets were visualized by Oil Red O staining. AICAR (50 ␮M) and PDTC (10 ␮M) were added and incubated with hepatocytes for 30 min, followed by the treatment of FLX (10 ␮M) for 24 h. As show in Fig. 6, FLX significantly increased the number and size of lipid droplets in the cytoplasm of hepatocytes, which was potently abolished by AMPK activator AICAR. It implied that neutral lipid accumulation in hepatocytes induced by FLX was dependent upon AMPK signaling pathway. In agreement with the analysis of genes expression, NF␬B inhibitor PDTC did not decrease the increased number and size of lipid droplets by FLX. It repeatedly indicated that NF␬B was possibly not related to FLX-caused hepatic lipid accumulation. 4. Discussion As a widely used antidepressant by selectively inhibiting serotonin reuptake into nerve endings of brain, FLX was first

documented in 1974 (Wong et al., 1974) and started to get marketed in 1987. Despite the emerging of novel agents, FLX remains highly popular in clinic to date (Raeder et al., 2006). Among the common adverse effects associated with FLX, weight gain was frequently reported. As shown by a patient drug safety monitoring service in 2009, 49% of the patients having experienced a side effect as a result of taking an SSRI antidepressant mentioned about weight gain (Cascade et al., 2009). Side effects as increase in body weight and dyslipidemia puts the patient at risk for conditions including coronary heart disease, hypertension and Type 2 diabetes and, importantly, for the discontinuation of the treatment (Kivimaki et al., 2010; Olfson and Marcus, 2009; Warden et al., 2010). Results of the study from our group represent the first to examine the role of peripheral metabolic organs in the mechanisms of the weight gain side effect induced by FLX or other SSRI. Different with other studies on the central effects of SSRI (Raeder et al., 2006; Rahmadi et al., 2011), our findings suggest a novel approach that possibly breaks the linkage between FLX and weight gain side effect. In our previous study, we report that FLX increases hepatic lipid accumulation in vivo and in vitro, through the promotion of lipogenesis and reduction of lipolysis. The effect on lipid metabolism of FLX is closely associated with the altered expression of lipogenesisrelated genes and lipolysis-related genes. In this circumstances, SREBP1c, ACC1, FAS and carboxylesterases all play important roles in FLX-caused hepatic lipid accumulation (Feng et al., 2012). But

242

J. Xiong et al. / The International Journal of Biochemistry & Cell Biology 54 (2014) 236–244

Fig. 5. FLX inhibited LKB1 activation in primary mouse hepatocytes. After continued culture for two days, primary hepatocytes were treated with FLX (10 ␮M) for indicated time points. (A) Subcellular fractions were prepared and were checked for purity. Equal amount of protein were used for the Western analysis of LKB1 subcellular location. (B) Confocal fluorescence micrographs of hepatocytes treated with DMSO (control) or FLX (10 ␮M) for 60 min were obtained after staining with FITC for LKB1 and DAPI for nuclear staining. Arrows indicate hepatocyte nuclei. Images shown in this figure (400×) were representative of three independent experiments. (C) Phospho-lysates were prepared and equal amount of protein were used for the Western analysis of the phosphorylation of LKB1. All experiments described in this figure were repeated independently at least three times, and data are expressed as mean ± SEM. *p < 0.05 vs. no FLX-treated group.

Fig. 6. AMPK activator AICAR abolished lipid accumulation induced by FLX in the primary mouse hepatocytes. Primary hepatocytes were cultured and treated with FLX (10 ␮M) or 0.1% DMSO for 24 h following the pretreatment of AICAR (50 ␮M), PDTC (10 ␮M) or saline for 30 min. Then, cells were fixed and stained with Oil Red O to observe the accumulation of neutral lipids (red). Cell nuclei were stained with hematoxylin (blue). (A) Control group; (B) FLX-treated group; (C) FLX and AICAR-treated group; (D) FLX and PDTC-treated group; (E) AICAR-treated group; (F) PDTC-treated group. Images were taken under bright field (400×). The data are representative of images obtained from at least three independent experiments. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

J. Xiong et al. / The International Journal of Biochemistry & Cell Biology 54 (2014) 236–244

how FLX regulates the genes expression is still scarcely known. On this basis, we dig into the intracellular signaling transduction provoked by FLX in primary hepatocytes and provide evidence that the activation of AMPK signaling pathway potently abolishes the hepatic lipid accumulation induced by FLX. The results not only contributes to better understand the mechanisms of antidepressant related metabolic disorders, but also suggests a novel therapeutic target to interfere with those adverse drug reactions. AMP-activated protein kinase (AMPK) is a conserved serine/threonine protein kinase that has been reported to act as a “metabolic master switch” that modulates hepatic lipid metabolism to adapt to environmental or nutritional stress factors (Chang et al., 2013; Chen et al., 2013). AMPK modulates several key lipid metabolism-related transcription factors, including SREBP1c (Li et al., 2011). The activation of AMPK not only suppresses the expression of SREBP1c (Zhou et al., 2001), but also leads to the inhibition of proteolytic processing and transcriptional activity of SREBP1c (Li et al., 2011). After cleavage, SREBP-1c enters the nucleus and activates the transcription of lipogenic genes in the liver, including ACC and FAS (Cheng et al., 2007; Menendez et al., 2009). In the present study, the results suggest that FLX suppresses AMPK activation and inhibits AMPK-mediated signaling (Fig. 4A), which markedly increased the activation of SREBP1c (Fig. 3), resulting in the significant upregulation of TG synthesis genes (Fig. 1A), thereby promoting lipid synthesis in mouse hepatocytes (Fig. 6). Once the suppression of AMPK signaling induced by FLX was compensated, the increased lipid accumulation was obviously abolished (Fig. 6). However, it is worth noting that AMPK activator AICAR only abolished the increasing of active form of SREBP1c (n-SREBP1c), while precursor SREBP1c (p-SREBP1c) levels were even higher with the treatment of AICAR (Fig. 3), indicating that other intracellular signaling pathways participate in the increasing of SREBP1c expression caused by FLX. Simultaneously, AMPK signaling directly modulates lipogenesis-related enzyme ACC by phosphorylating the enzyme protein and inactivating its activity (Fig. 4B), which is comparable with previous reports (Kim et al., 2011). Therefore, it is obvious that FLX suppresses AMPK pathway and subsequently activates lipogenic enzymes either through a direct way by phosphorylation or an indirect way via the activation of SREBP1c. Whether SREBP1c is indispensable for FLX-induced hepatic lipid accumulation needs further elucidation by the SREBP1c-ablation studies. The expression of lipolytic enzymes in the liver, mouse Ces1d and its homologue Ces1e, is also investigated in the present study. Carboxylesterases are initially known to be important to metabolize xenobiotics, like some pesticides and drugs (Mao et al., 2011). Whereas, endobiotics like TG, cholesteryl esters, and 2arachidonoylglycerol are also substrates for carboxylesterases. It is now proposed that carboxylesterases highly involve in hepatic lipid metabolism and are potential therapeutical target for the treatment of such metabolic disorders as diabetes and atherosclerosis (Dolinsky et al., 2004; Quiroga and Lehner, 2011). However, by now, no enough evidence has been provided to fully address the role of carboxylesterases in dyslipidemia. In the present study, FLX significantly inhibits the mRNA and protein expression of Ces1d and Ces1e in mouse hepatocytes, which is markedly abolished by AMPK activator (Figure 1B). The results indicate that a decreased lipolytic process in the liver after treated with FLX is also dependent upon the suppression of AMPK signaling. It is implied that FLX inhibits the activation of AMPK pathway and subsequently decreases the expression of carboxylesterases, leading to decreased TG degradation and increased lipid accumulation in hepatocytes. To date, the regulation of carboxylesterases is still mostly unclear. Transactivation by nuclear receptors such as the pregnane X receptor (PXR) and constitutive androstane receptor (CAR) is possibly responsible for the increased expression of carboxylesterases (Poso and

243

Honkakoski, 2006; Staudinger et al., 2010). AMPK has been reported to be involved in the pathway leading to the activation of CAR by phenobarbital (Shindo et al., 2007). On the contrary, SREBP1c has been proposed to inactivate PXR and CAR by direct interaction (Roth et al., 2008). The information above is supportive to the results of the present study with a speculation that Ces might be positively regulated by AMPK pathway and negatively by transcriptional factor SREBP1c. Recently, AICAR has been found to have some effect to regulate lipid metabolism through a way apart from its activation on AMPK (Bumpus and Johnson, 2011), therefore, AMPK classical inhibitor Compound C were applied to provide a clearer proof of AMPK involvement in the regulation of lipid accumulation caused by FLX. FLX regulates the expression of lipid-metabolizing enzymes as potent as AMPK inhibitor Compound C does, and the simultaneous combination of the two treatments have a similar effect or behave even less potently than the single treatment alone (Fig. 2). The data indicate that FLX acts in the same way as Compound C does, by inhibiting AMPK signaling pathway. As a major upstream kinase of AMPK, it has been reported that cytoplasmic localization of LKB1 is critical for its normal function (Tiainen et al., 2002). In the present study, we have provided evidence that FLX inhibits AMPK activation by inhibiting the translocation of LKB1 from the nucleus to the cytosol and the phosphorylation of LKB1 at Ser428 (Fig. 5). The results are in agreement with previous findings that Ser428 phosphorylation located in the C-terminus of LKB1 plays a crucial role in regulating AMPK activation (Xie et al., 2008). Our data indicate that LKB1 is localized in both cytosols and nuclei in untreated primary hepatocytes, with strong signal responses in either subcellular fraction (Fig. 5). It is previously reported that LKB1 mainly localized in nuclei in resting cells (Tiainen et al., 2002; Vu et al., 2013; Xie et al., 2008). The reasons for the discrepancy are unknown and might be related to the different cell types. In conclusion, the present study demonstrated that fluoxetine promotes lipid accumulation in primary hepatocytes, which is mediated by the suppression of AMPK signaling. The decreased activation of AMPK leads to the increased activation of SREBP1c and subsequently, promotes the expression of TG synthesis enzymes and decreases the expression of carboxylesterases. The altered expression of those enzymes leads to an increase of lipid accumulation in the hepatocytes. Furthermore, we also demonstrated that the repressed activation of AMPK signaling by FLX is mediated by LKB1. The findings are of great importance in understanding the mechanisms of metabolic adverse reactions during antidepressant drug treatment. Conflict of interest statement The authors declare that there are no conflicts of interest. Acknowledgements The study was supported by the Natural Science Foundation of Jiangsu Province, China (No. BK2012446), the Natural Science Foundation of China (No. 81302855, 81173128) and the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. References Browning JD, Horton JD. Molecular mediators of hepatic steatosis and liver injury. J Clin Invest 2004;114:147–52.

244

J. Xiong et al. / The International Journal of Biochemistry & Cell Biology 54 (2014) 236–244

Bumpus NN, Johnson EF. 5-Aminoimidazole-4-carboxyamide-ribonucleoside (AICAR)-stimulated hepatic expression of Cyp4a10, Cyp4a14, Cyp4a31, and other peroxisome proliferator-activated receptor alpha-responsive mouse genes is AICAR 5’-monophosphate-dependent and AMP-activated protein kinase-independent. J Pharmacol Exp Ther 2011;339:886–95. Cascade E, Kalali AH, Kennedy SH. Real-world data on SSRI antidepressant side effects. Psychiatry (Edgmont) 2009;6:16–8. Chang JJ, Hsu MJ, Huang HP, Chung DJ, Chang YC, Wang CJ. Mulberry anthocyanins inhibit oleic acid induced lipid accumulation by reduction of lipogenesis and promotion of hepatic lipid clearance. J Agric Food Chem 2013;61(25):6069–76. Chen H, Zhang L, Li X, Sun GQ, Yuan X, Lei L, et al. Adiponectin activates the AMPK signaling pathway to regulate lipid metabolism in bovine hepatocytes. J Steroid Biochem Mol Biol 2013;138:445–54. Cheng D, Chu CH, Chen L, Feder JN, Mintier GA, Wu Y, et al. Expression, purification, and characterization of human and rat acetyl coenzyme A carboxylase (ACC) isozymes. Protein Expr Purif 2007;51:11–21. Desmarais JE, Beauclair L, Margolese HC. Switching from brand-name to generic psychotropic medications: a literature review. CNS Neurosci Ther 2011;17:750–60. Dolinsky VW, Gilham D, Alam M, Vance DE, Lehner R. Triacylglycerol hydrolase: role in intracellular lipid metabolism. Cell Mol Life Sci 2004;61:1633–51. Eberle D, Hegarty B, Bossard P, Ferre P, Foufelle F. SREBP transcription factors: master regulators of lipid homeostasis. Biochimie 2004;86:839–48. Feng XM, Xiong J, Qin H, Liu W, Chen RN, Shang W, et al. Fluoxetine induces hepatic lipid accumulation via both promotion of the SREBP1c-related lipogenesis and reduction of lipolysis in primary mouse hepatocytes. CNS Neurosci Ther 2012;18:974–80. Ferre P, Foufelle F. Hepatic steatosis: a role for de novo lipogenesis and the transcription factor SREBP-1c. Diabetes Obes Metab 2010;12(Suppl. 2):83–92. Hardie DG, Pan DA. Regulation of fatty acid synthesis and oxidation by the AMPactivated protein kinase. Biochem Soc Trans 2002;30:1064–70. Hawley SA, Boudeau J, Reid JL, Mustard KJ, Udd L, Makela TP, et al. Complexes between the LKB1 tumor suppressor, STRAD alpha/beta and MO25 alpha/beta are upstream kinases in the AMP-activated protein kinase cascade. J Biol 2003;2:28. Horton JD, Goldstein JL, Brown MS. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest 2002;109:1125–31. Jazayeri S, Tehrani-Doost M, Keshavarz SA, Hosseini M, Djazayery A, Amini H, et al. Comparison of therapeutic effects of omega-3 fatty acid eicosapentaenoic acid and fluoxetine, separately and in combination, in major depressive disorder. Aust N Z J Psychiatry 2008;42:192–8. Kahn BB, Alquier T, Carling D, Hardie DG. AMP-activated protein kinase: ancient energy gauge provides clues to modern understanding of metabolism. Cell Metab 2005;1:15–25. Kim MK, Kim SH, Yu HS, Park HG, Kang UG, Ahn YM, et al. The effect of clozapine on the AMPK-ACC-CPT1 pathway in the rat frontal cortex. Int J Neuropsychopharmacol 2011:1–11. Kivimaki M, Hamer M, Batty GD, Geddes JR, Tabak AG, Pentti J, et al. Antidepressant medication use, weight gain, and risk of type 2 diabetes: a population-based study. Diabetes Care 2010;33:2611–6. Ko KW, Erickson B, Lehner R. Es-x/Ces1 prevents triacylglycerol accumulation in McArdle-RH7777 hepatocytes. Biochim Biophys Acta 2009;1791:1133–43. Lehner R, Vance DE. Cloning and expression of a cDNA encoding a hepatic microsomal lipase that mobilizes stored triacylglycerol. Biochem J 1999;343(Pt. 1):1–10. Li Y, Xu S, Mihaylova MM, Zheng B, Hou X, Jiang B, et al. AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metab 2011;13:376–88. Mao Z, Li Y, Peng Y, Luan X, Gui H, Feng X, et al. Lipopolysaccharide down-regulates carbolesterases 1 and 2 and reduces hydrolysis activity in vitro and in vivo via p38MAPK-NF-kappaB pathway. Toxicol Lett 2011;201:213–20. Mastronardi C, Paz-Filho GJ, Valdez E, Maestre-Mesa J, Licinio J, Wong ML. Longterm body weight outcomes of antidepressant-environment interactions. Mol Psychiatry 2011;16:265–72. Menendez JA, Vazquez-Martin A, Ortega FJ, Fernandez-Real JM. Fatty acid synthase: association with insulin resistance, type 2 diabetes, and cancer. Clin Chem 2009;55:425–38. Nassir F, Adewole OL, Brunt EM, Abumrad NA. CD36 deletion reduces VLDL secretion, modulates liver prostaglandins, and exacerbates hepatic steatosis in ob/ob mice. J Lipid Res 2013;54(11):2988–97. Olfson M, Marcus SC. National patterns in antidepressant medication treatment. Arch Gen Psychiatry 2009;66:848–56. Penas-Lledo EM, Trejo HD, Dorado P, Ortega A, Jung H, Alonso E, et al. CYP2D6 ultrarapid metabolism and early dropout from fluoxetine or amitriptyline monotherapy treatment in major depressive patients. Mol Psychiatry 2013;18:8–9.

Porstmann T, Santos CR, Griffiths B, Cully M, Wu M, Leevers S, et al. SREBP activity is regulated by mTORC1 and contributes to Akt-dependent cell growth. Cell Metab 2008;8:224–36. Poso A, Honkakoski P. Ligand recognition by drug-activated nuclear receptors PXR and CAR: structural, site-directed mutagenesis and molecular modeling studies. Mini Rev Med Chem 2006;6:937–47. Quan HY, Kim do Y, Kim SJ, Jo HK, Kim GW, Chung SH. Betulinic acid alleviates nonalcoholic fatty liver by inhibiting SREBP1 activity via the AMPK-mTOR-SREBP signaling pathway. Biochem Pharmacol 2013;85:1330–40. Quiroga AD, Lehner R. Liver triacylglycerol lipases. Biochim Biophys Acta 2012;1821(5):762–9. Quiroga AD, Lehner R. Role of endoplasmic reticulum neutral lipid hydrolases. Trends Endocrinol Metab 2011;22:218–25. Raeder MB, Ferno J, Glambek M, Stansberg C, Steen VM. Antidepressant drugs activate SREBP and up-regulate cholesterol and fatty acid biosynthesis in human glial cells. Neurosci Lett 2006;395:185–90. Raghow R, Yellaturu C, Deng X, Park EA, Elam MB. SREBPs: the crossroads of physiological and pathological lipid homeostasis. Trends Endocrinol Metab 2008;19:65–73. Rahmadi M, Narita M, Yamashita A, Imai S, Kuzumaki N, Suzuki T. Sleep disturbance associated with an enhanced orexinergic system induced by chronic treatment with paroxetine and milnacipran. Synapse 2011;65:652–7. Richard J, Lingvay I. Hepatic steatosis and Type 2 diabetes: current and future treatment considerations. Expert Rev Cardiovasc Ther 2011;9:321–8. Roth A, Looser R, Kaufmann M, Meyer UA. Sterol regulatory element binding protein 1 interacts with pregnane X receptor and constitutive androstane receptor and represses their target genes. Pharmacogenet Genomics 2008;18: 325–37. Rutter GA, Da Silva Xavier G, Leclerc I. Roles of 5’-AMP-activated protein kinase (AMPK) in mammalian glucose homoeostasis. Biochem J 2003;375:1–16. Severus E, Schaaff N, Moller HJ. State of the art: treatment of bipolar disorders. CNS Neurosci Ther 2012;18:214–8. Sfikas A, Batsi C, Tselikou E, Vartholomatos G, Monokrousos N, Pappas P, et al. The canonical NF-kappaB pathway differentially protects normal and human tumor cells from ROS-induced DNA damage. Cell Signal 2012;24(11): 2007–23. Shindo S, Numazawa S, Yoshida T. A physiological role of AMP-activated protein kinase in phenobarbital-mediated constitutive androstane receptor activation and CYP2B induction. Biochem J 2007;401:735–41. Staudinger JL, Xu C, Cui YJ, Klaassen CD. Nuclear receptor-mediated regulation of carboxylesterase expression and activity. Expert Opin Drug Metab Toxicol 2010;6:261–71. Tiainen M, Vaahtomeri K, Ylikorkala A, Makela TP. Growth arrest by the LKB1 tumor suppressor: induction of p21(WAF1/CIP1). Hum Mol Genet 2002;11: 1497–504. Uher R, Farmer A, Henigsberg N, Rietschel M, Mors O, Maier W, et al. Adverse reactions to antidepressants. Br J Psychiatry 2009;195:202–10. Vu V, Bui P, Eguchi M, Xu A, Sweeney G. Globular adiponectin induces LKB1/AMPKdependent glucose uptake via actin cytoskeleton remodeling. J Mol Endocrinol 2013;51:155–65. Warden D, Trivedi MH, Wisniewski SR, Kurian B, Zisook S, Kornstein SG, et al. Early adverse events and attrition in selective serotonin reuptake inhibitor treatment: a suicide assessment methodology study report. J Clin Psychopharmacol 2010;30:259–66. Wong DT, Horng JS, Bymaster FP, Hauser KL, Molloy BB. A selective inhibitor of serotonin uptake: Lilly 110140, 3-(p-trifluoromethylphenoxy)-N-methyl-3phenylpropylamine. Life Sci 1974;15:471–9. Wong DT, Perry KW, Bymaster FP. Case history: the discovery of fluoxetine hydrochloride (Prozac). Nat Rev Drug Discov 2005;4:764–74. Woods A, Dickerson K, Heath R, Hong SP, Momcilovic M, Johnstone SR, et al. Ca2+ /calmodulin-dependent protein kinase kinase-beta acts upstream of AMPactivated protein kinase in mammalian cells. Cell Metab 2005;2:21–33. Xiao D, Chen YT, Yang D, Yan B. Age-related inducibility of carboxylesterases by the antiepileptic agent phenobarbital and implications in drug metabolism and lipid accumulation. Biochem Pharmacol 2012;84:232–9. Xie Z, Dong Y, Scholz R, Neumann D, Zou MH. Phosphorylation of LKB1 at serine 428 by protein kinase C-zeta is required for metformin-enhanced activation of the AMP-activated protein kinase in endothelial cells. Circulation 2008;117: 952–62. You M, Matsumoto M, Pacold CM, Cho WK, Crabb DW. The role of AMPactivated protein kinase in the action of ethanol in the liver. Gastroenterology 2004;127:1798–808. Zhou J, Shi MX, Mitchell TD, Smagin GN, Thomas SR, Ryan DH, et al. Changes in rat adipocyte and liver glucose metabolism following repeated restraint stress. Exp Biol Med (Maywood) 2001;226:312–9.