Proc. Nati. Acad. Sci. USA Vol. 88, pp. 4245-4249, May 1991 Biochemistry
Footprinting analysis of mammalian RNA polymerase II along its transcript: An alternative view of transcription elongation (gene regulation/enzyme structure/DNA RNA hybrid)
GRETCHEN A. RICE, CAROLINE M. KANE, AND MICHAEL J. CHAMBERLIN* Division of Biochemistry and Molecular Biology, 401 Barker Hall, University of California at Berkeley, Berkeley, CA 94720
Contributed by Michael J. Chamberlin, January 23, 1991
ABSTRACT Ternary complexes of RNA polymerase II, bearing the nascent RNA transcript, are intermediates in the synthesis of all eukaryotic mRNAs and are implicated as regulatory targets of factors that control RNA chain elongation and termination. Information as to the structure of such complexes is essential in understanding the catalytic and regulatory properties of the RNA polymerase. We have prepared complexes of purified RNA polymerase II halted at defined positions along a DNA template and used RNase footprinting to map interactions of the polymerase with the nascent RNA. Unexpectedly, the transcript is sensitive to cleavage by RNases A and T1 at positions as close as 3 nucleotides from the 3'-terminal growing point. Ternary complexes in which the transcript has been cleaved to give a short fragment can retain that fragment and remain active and able to continue elongation. Since DNA-RNA hybrid structures are completely resistant to cleavage under our reaction conditions, the results suggest that any DNARNA hybrid intermediate can extend for no more than 3 base pairs, in dramatic contrast to recent models for transcription elongation. At lower RNase concentrations, the transcript is protected from cleavage out to about 24 nucleotides from the 3' terminus. We interpret this partial protection as due to the presence of an RNA binding site on the polymerase that binds the nascent transcript during elongation, a model proposed earlier by several workers in preference to the hybrid model. The properties of this RNA binding site are likely to play a central role in the processes of transcription elongation and termination and in their regulation.
Transcription in eukaryotic cells is a complex process involving multiple steps and a variety of transcription factors. RNA polymerase initiates transcription by binding to a promoter with the help of multiple accessory transcription factors in a complex series of reactions (1-6). Elongation across the gene can also require accessory factors to prevent premature pausing or termination (7-10). Ultimately, RNA polymerase terminates and releases both the newly synthesized transcript and the DNA template; the details of this process are not yet understood. Prior studies of transcription have focused primarily on factors needed for promoter binding and transcription initiation. Structural studies of promoter complexes have demonstrated that RNA polymerase II and its accessory factors assemble at the promoter region in a stepwise manner (4, 5, 11, 12). These intermediates are targets of regulatory factors that activate or suppress specific transcription. The regulation of transcription during elongation and termination also is a significant element in eukaryotic cells (13-18). Understanding the structure and properties of the intermediates in elongation is of central importance in understanding their function and regulation.
Studies on the structural transitions of prokaryotic RNA polymerase during transcription have used specific transcriptional complexes halted at different stages of transcription along a transcription unit (19-21). Such complexes undergo several distinct structural transitions as transcription initiation and elongation begin (19, 22), and these transitions have been implicated as sites of regulatory factor action (23-26). To elucidate important features of transcription elongation by mammalian RNA polymerase II, we have applied these techniques to the isolation and study of its elongation intermediates.
MATERIALS AND METHODS RNA polymerase II was purified from calf thymus (27, 28). The preparation was >90% pure and contained 30-50% active molecules (29). The following reagents were purchased from the sources indicated: RNase T1 (Sankyo); RNase A (Sigma); Inhibit-Ace (5 Prime-*3 Prime, Inc.) The template pCpGR220, bearing a 3'-terminal deoxycytidine tail, was prepared as described by Kadesch and Chamberlin (ref. 29; see also legend to Fig. 1). Stable ternary complexes with a transcript of 135 nucleotides (nt) (G135) were prepared by incubating RNA polymerase II with pCpGR220 for 5 min at 370C in transcription buffer [70 mM Tris-OAc, pH 8.0/20% (vol/vol) glycerol/60 mM NH4CI/6 mM Mg(OAc)2/5 mM spermidine/0.15 mM dithiothreitol] with 800 ,uM ATP and GTP and 100 .M CTP. This complex was blocked from further elongation by the lack of UTP. Unincorporated NTPs were removed by passage of the ternary complexes through three consecutive G-50 gelfiltration columns (30). [a-32P]UTP was added to the purified G135 complex and incubation at 370C for 1 min allowed RNA polymerase II to walk to position 138 (U138 complex). Longer incubations resulted in unacceptable levels of readthrough. Unincorporated NTPs were removed by a single G-50 gel-filtration column. U138 complexes and free U138 RNA (phenol/chloroform extracted), with 0.15 mg of carrier RNA per ml, were digested by RNases for 10 min at 37°C. A titration of each RNase was done for both ternary complexes and free RNA transcripts. Digestions were stopped by the addition of 4/5th vol of urea load buffer (7 M urea/10 mM EDTA/0.5% SDS/0.05% xylene cyanol and bromophenol blue) and samples were placed on ice. Digestion of complexes used for further elongation was stopped with 3 units of Inhibit-Ace and NTPs were added to 800 ,uM. Elongation proceeded for 3 min at 370C.
RESULTS Rationale. The goal of our studies was to obtain structural information about purified mammalian RNA polymerase II
The publication costs of this article were defrayed in part by page charge
payment. This article must therefore be hereby marked "advertisement"
Abbreviation: nt, nucleotide(s). *To whom reprint requests should be addressed.
in accordance with 18 U.S.C. §1734 solely to indicate this fact.
4245
4246
Biochemistry: Rice et al.
Proc. Natl. Acad. Sci. USA 88 (1991)
and its contacts with the nascent transcript in a normal elongation complex. We have used a synthetic DNA template on which purified RNA polymerase II initiates efficiently and then can be halted at specific sites for lack of a particular NTP substrate. This approach assumes that these halted complexes represent actual intermediates in the elongation process that have transient existence in the normal elongation process. The verity of this assumption cannot be proved in any simple manner. As minimal requirements, we demand that halted elongation complexes be homogeneous and remain active for the duration of the analysis (19). Formation and Analysis of Elongation Complexes. To implement this approach, we designed the template pCpGR220 to allow transcription elongation to be halted at several defined sites. The entire sequence of the transcript is given in the legend to Fig. 1. The 3'-terminal portion of the transcript directly relevant to our experiments has the sequence . .. ACGACAAGCACAACACCAGCGAGCAAGGCG'35UUUCGGGGAA .... In the presence of ATP, CTP, and GTP, transcription can proceed only to position 135. The substrate UTP is required at positions 136, 137, and 138 (Fig. 1, lane 2). This intermediate is termed a G135 complex; after removal of unincorporated NTPs, it can be elongated to give a U138 complex by adding UTP (lane 3). Analysis of the RNAs in the G135 and U138 complexes shows that these complexes are 1
2
3
4
5
711 ~ 489 404~
_
364
_
242
-
190
_
147
X
118
X
110
_
_
67
FIG. 1. Preparation and analysis of halted elongation complexes G135 and U138. The terminal sequence of pGR220 used for complex formation is as follows (nontemplate strand): 5'-p-GGGAAGAAAA AGCAAACCGC AGAGAGGAAG CCAACCCCAG AAGAGAGGAA50 CCAGAAGCGG CAAGCCCAGG AGCGAGACGC AACAGGCGAC GAGGCACCCG'00 CUGGCACGAC AAGCACAACA CCAGCGAGCA AGGCG135 TTTCGGGGAA145 GAAAAAGCAA155. Halted elongation complexes were formed on pCpGR220 by using calf thymus RNA polymerase 11, and transcripts were analyzed on a denaturing polyacrylamide gel (30:0.8 acrylamide/bisacrylamide, 7 M urea; 0.8 mm thick, 25 cm long) in 1 x TBE (89 mM Tris base/89 mM boric acid/2.5 mM EDTA). The activity of the halted complexes was determined by addition of NTPs to allow elongation to resume. Lanes: 1, DNA size markers (lengths in nt are given on left); 2, G135 complex labeled with [a-32P]CTP; 3, U138 complex formed by elongating the isolated G135 complex upon addition of UTP; 4, U138 complex 3'-end-labeled with [a-32P]UTP; 5, chase of the 3'-end-labeled U138 complex by addition of NTPs.
quite pure, and the majority of complexes are active as shown by their ability to be chased (lane 5). However, the U138 complexes often contain significant amounts of U136 and U137 complexes as we discuss below. Structural Analysis of an Elongation Intermediate by RNase Footprinting. To study the contacts between RNA polymerase II and its transcript in the U138 complex, the 3'-endlabeled U138 complexes were treated with RNase T1 or RNase A. Free U138 RNA was treated in the same way and the digestion products were compared by gel electrophoresis (Fig. 2). For each experiment, the numbers on the left show the sizes of expected RNase cleavage products, and those on the right show the position of the corresponding cleavage site along the 138-nt transcript as read from the RNA ladder. RNase T1 cleaves on the 3' side of single-stranded G residues; RNase A cleaves on the 3' side of single-stranded C and U residues. Sensitivity of the U138 transcript to RNase T1 differs dramatically depending on whether the ternary complex or free RNA is treated with the nuclease (Fig. 2A). At low nuclease concentrations (0.005-0.05 unit/ml), there are no cleavage products from the ternary complex shorter than 25 nt (lanes 3 and 4), although digestion products of 25, 30, and 34 nt do appear. Only at higher RNase T1 concentrations (0.5-5 units/ml) do smaller cleavage products of 3-14 nt appear (lanes 1 and 2). Thus, RNA polymerase II can protect -24 nt at the 3'-OH end of the U138 transcript from RNase T1 digestion; this protection is lost as the nuclease concentration is increased. RNase A treatment of the U138 complex also reveals major differences in the cleavage pattern of the RNA in the complex versus free RNA (Fig. 2B). In this case, only -9 nt of transcript is protected from RNase A cleavage at low RNase concentrations. Cleavage products of 4 and 9 nt are less abundant at lower RNase A concentrations (lanes 4, 3, and 2; RNase A concentrations of 0.01, 0.1, and 1 ug/ml, respectively), while cleavage products of 17 and 19 nt are represented about equally in digests of either the ternary complex or the free RNA. Increasing the concentration of RNase A further, to 10 ,ug/ml, gives increased amounts of cleavage products of 4, 9, and 13 nt. In addition to the specific protection of a region at the 3'-OH end of the transcript, the nascent RNA in U138 complexes was generally protected from RNase T1 and A cleavage compared to free RNA. That is, even at the highest nuclease concentrations used here, which digest free RNA to limit products, a substantial amount of full-length RNA remains in complexes. We do not know the explanation for this difference. This is not seen in Fig. 2 because the upper part of the autoradiogram showing the full-length U138 RNA has been cut off. In contrast, for free RNA, full-length transcripts are only seen at the lowest nuclease concentrations. In both experiments, there are RNA products that do not correspond in size to expected RNase cleavage products. Some of these (marked with double asterisks) are minor contaminants in the original untreated RNA sample; these do not interfere with the analysis. Other bands (marked with single asterisks) are due to the failure to obtain quantitative elongation of the original G135 complexes to U138, giving shorter transcripts U136 and U137 as contaminants. An example of this is seen for the digest of the U138 RNA preparation by RNase A, which gives three bands (Fig. 3, lane 2). These bands were sequenced by nearest-neighbor analysis to confirm their identity. Stability and Activity of RNase-Digested Elongation Complexes. Although the halted U138 complexes were stable for the time required to complete our analyses, a critical question was whether RNase-treated complexes remained active. If complexes were dissociated during or after RNase cleavage,
Biochemistry: Rice et al.
Proc. Natl. Acad. Sci. USA 88 (1991)
1 2 3 4 5 6 7 8 L 9
A
1 2 3 4 5 6 7 8 L 9
B 33
35-_ 34-
105
'
31-
_
_I|*
28-
4 115
2422-
.
..
_A _ -_ _ _~--%
,-_ .
ra
110
m
110 25--
105
.-
...
I.
,
30-
4247
-_NW
a%
115 _-
19-
120
120
*
167.
da --
14-'
all
w
-
-~~~TA
mve
125
125
13-'
126
12-'
126
127 127
_oo
10--
128
_ 43
oiw'
>
130
*
131
40.
132
w
9-'
d*:
129
130 131
lb
.. 5
128
129
132 133
, ii Amok-AdIL.-Aft MW
.
3-o
I*
134
133
i
135
4-
0F
-
134
135
FIG. 2. Analysis of RNase sensitivity of 3'-end-labeled transcripts in U138 elongation complexes and 3'-end-labeled free U138 RNA. (A and B) Digestion products from RNase T1 and RNase A treatment, respectively. The sizes (nt) of the expected 3'-terminal cleavage products are indicated on the left and are marked with arrows. On the right are shown the corresponding sites of cleavage along the original U138 RNA; for example, cleavage at position 132 gives a 6-nt product. Asterisks denote cleavage products from ternary complexes containing 136- and 137-nt transcripts, and double asterisks mark transcripts present in the original RNA sample before digestion. (A) Digestion of complexes and free RNA with several concentrations of RNase T1. Lanes: 1-4, cleavage products of transcripts in U138 complexes digested with RNase T1 at 5, 0.5, 0.05, and 0.005 units/ml, respectively; 5-8, cleavage products of free U138 RNA, digested with RNase T1 at 5, 0.5, 0.05, and 0.005 units/ml, respectively; 9, untreated RNA transcripts from U138 complexes. Lane L contains a ladder of U138 RNA alkaline hydrolysis products prepared by treating gel-purified 3'-end-labeled U138 RNA with 1% piperidine for 2 min at 930C. (B) Digestion of complexes and free RNA with several concentrations of RNase A. Lanes: 1-4, cleavage products of transcripts in U138 complexes, digested with RNase A at 10, 1, 0. 1, and 0.01 gg/ml, respectively; 5-8, cleavage products of free U138 RNA digested with RNase A at 10, 1, 0.1, and 0.01 ,ug/ml, respectively; 9, untreated RNA transcripts from U138 complexes. Lane L contains an RNA ladder as in A. Transcripts were analyzed by denaturing 20% PAGE (20% acrylamide/3% bisacrylamide/7 M urea; 0.3 mm thick, 40 mm long) in ix TBE.
it would be difficult to draw plausible conclusions as to complex structure from the cleavage products, since RNA products might arise from cleavage of RNAs only after release from the ternary complex. We tested for complex stability by adding NTPs to the digested U138 complexes so that elongation could resume for any complexes that remained active and stable (Fig. 3). U138 complexes digested with RNase A give RNA products with lengths of 4, 9, 13, 16, 22, 24 nt, and longer (lanes 2 and 4). A substantial fraction of each is still present in RNA polymerase complexes that are intact and active, as demonstrated by the disappearance of the appropriate band from the elongation lanes (lanes 3 and 5). U138 complexes digested with RNase T1 also remain stable and active; complexes containing transcripts of 5, 6, 10, 12, 25 nt, and longer are all elongated in a similar experiment (lanes 6-9). One exception is the potential complex cleaved by RNase T1 to give a 3-nt transcript. Since the amount of the 3-nt product does not decrease detectably during the elongation, the experiment does not reveal
whether this RNA is part of an inactive complex or whether it has been released after cleavage. A second way of testing stability and activity of elongation complexes uses isolation by centrifugal gel filtration (19). Released transcripts are retained by the gel filtration column while intact complexes pass through. NTPs can then be added to these purified complexes to assess which ones remain active during the isolation. U138 complexes were digested with either RNase T1 or RNase A to give complexes containing transcripts of each possible length between 3, 24 nt, and longer. The complexes were then isolated by centrifugal gel filtration. An examination of complexes excluded from the column revealed that those with transcripts
Footprinting analysis of mammalian RNA polymerase II along its transcript: An alternative view of transcription elongation (gene regulation/enzyme structure/DNA RNA hybrid)
GRETCHEN A. RICE, CAROLINE M. KANE, AND MICHAEL J. CHAMBERLIN* Division of Biochemistry and Molecular Biology, 401 Barker Hall, University of California at Berkeley, Berkeley, CA 94720
Contributed by Michael J. Chamberlin, January 23, 1991
ABSTRACT Ternary complexes of RNA polymerase II, bearing the nascent RNA transcript, are intermediates in the synthesis of all eukaryotic mRNAs and are implicated as regulatory targets of factors that control RNA chain elongation and termination. Information as to the structure of such complexes is essential in understanding the catalytic and regulatory properties of the RNA polymerase. We have prepared complexes of purified RNA polymerase II halted at defined positions along a DNA template and used RNase footprinting to map interactions of the polymerase with the nascent RNA. Unexpectedly, the transcript is sensitive to cleavage by RNases A and T1 at positions as close as 3 nucleotides from the 3'-terminal growing point. Ternary complexes in which the transcript has been cleaved to give a short fragment can retain that fragment and remain active and able to continue elongation. Since DNA-RNA hybrid structures are completely resistant to cleavage under our reaction conditions, the results suggest that any DNARNA hybrid intermediate can extend for no more than 3 base pairs, in dramatic contrast to recent models for transcription elongation. At lower RNase concentrations, the transcript is protected from cleavage out to about 24 nucleotides from the 3' terminus. We interpret this partial protection as due to the presence of an RNA binding site on the polymerase that binds the nascent transcript during elongation, a model proposed earlier by several workers in preference to the hybrid model. The properties of this RNA binding site are likely to play a central role in the processes of transcription elongation and termination and in their regulation.
Transcription in eukaryotic cells is a complex process involving multiple steps and a variety of transcription factors. RNA polymerase initiates transcription by binding to a promoter with the help of multiple accessory transcription factors in a complex series of reactions (1-6). Elongation across the gene can also require accessory factors to prevent premature pausing or termination (7-10). Ultimately, RNA polymerase terminates and releases both the newly synthesized transcript and the DNA template; the details of this process are not yet understood. Prior studies of transcription have focused primarily on factors needed for promoter binding and transcription initiation. Structural studies of promoter complexes have demonstrated that RNA polymerase II and its accessory factors assemble at the promoter region in a stepwise manner (4, 5, 11, 12). These intermediates are targets of regulatory factors that activate or suppress specific transcription. The regulation of transcription during elongation and termination also is a significant element in eukaryotic cells (13-18). Understanding the structure and properties of the intermediates in elongation is of central importance in understanding their function and regulation.
Studies on the structural transitions of prokaryotic RNA polymerase during transcription have used specific transcriptional complexes halted at different stages of transcription along a transcription unit (19-21). Such complexes undergo several distinct structural transitions as transcription initiation and elongation begin (19, 22), and these transitions have been implicated as sites of regulatory factor action (23-26). To elucidate important features of transcription elongation by mammalian RNA polymerase II, we have applied these techniques to the isolation and study of its elongation intermediates.
MATERIALS AND METHODS RNA polymerase II was purified from calf thymus (27, 28). The preparation was >90% pure and contained 30-50% active molecules (29). The following reagents were purchased from the sources indicated: RNase T1 (Sankyo); RNase A (Sigma); Inhibit-Ace (5 Prime-*3 Prime, Inc.) The template pCpGR220, bearing a 3'-terminal deoxycytidine tail, was prepared as described by Kadesch and Chamberlin (ref. 29; see also legend to Fig. 1). Stable ternary complexes with a transcript of 135 nucleotides (nt) (G135) were prepared by incubating RNA polymerase II with pCpGR220 for 5 min at 370C in transcription buffer [70 mM Tris-OAc, pH 8.0/20% (vol/vol) glycerol/60 mM NH4CI/6 mM Mg(OAc)2/5 mM spermidine/0.15 mM dithiothreitol] with 800 ,uM ATP and GTP and 100 .M CTP. This complex was blocked from further elongation by the lack of UTP. Unincorporated NTPs were removed by passage of the ternary complexes through three consecutive G-50 gelfiltration columns (30). [a-32P]UTP was added to the purified G135 complex and incubation at 370C for 1 min allowed RNA polymerase II to walk to position 138 (U138 complex). Longer incubations resulted in unacceptable levels of readthrough. Unincorporated NTPs were removed by a single G-50 gel-filtration column. U138 complexes and free U138 RNA (phenol/chloroform extracted), with 0.15 mg of carrier RNA per ml, were digested by RNases for 10 min at 37°C. A titration of each RNase was done for both ternary complexes and free RNA transcripts. Digestions were stopped by the addition of 4/5th vol of urea load buffer (7 M urea/10 mM EDTA/0.5% SDS/0.05% xylene cyanol and bromophenol blue) and samples were placed on ice. Digestion of complexes used for further elongation was stopped with 3 units of Inhibit-Ace and NTPs were added to 800 ,uM. Elongation proceeded for 3 min at 370C.
RESULTS Rationale. The goal of our studies was to obtain structural information about purified mammalian RNA polymerase II
The publication costs of this article were defrayed in part by page charge
payment. This article must therefore be hereby marked "advertisement"
Abbreviation: nt, nucleotide(s). *To whom reprint requests should be addressed.
in accordance with 18 U.S.C. §1734 solely to indicate this fact.
4245
4246
Biochemistry: Rice et al.
Proc. Natl. Acad. Sci. USA 88 (1991)
and its contacts with the nascent transcript in a normal elongation complex. We have used a synthetic DNA template on which purified RNA polymerase II initiates efficiently and then can be halted at specific sites for lack of a particular NTP substrate. This approach assumes that these halted complexes represent actual intermediates in the elongation process that have transient existence in the normal elongation process. The verity of this assumption cannot be proved in any simple manner. As minimal requirements, we demand that halted elongation complexes be homogeneous and remain active for the duration of the analysis (19). Formation and Analysis of Elongation Complexes. To implement this approach, we designed the template pCpGR220 to allow transcription elongation to be halted at several defined sites. The entire sequence of the transcript is given in the legend to Fig. 1. The 3'-terminal portion of the transcript directly relevant to our experiments has the sequence . .. ACGACAAGCACAACACCAGCGAGCAAGGCG'35UUUCGGGGAA .... In the presence of ATP, CTP, and GTP, transcription can proceed only to position 135. The substrate UTP is required at positions 136, 137, and 138 (Fig. 1, lane 2). This intermediate is termed a G135 complex; after removal of unincorporated NTPs, it can be elongated to give a U138 complex by adding UTP (lane 3). Analysis of the RNAs in the G135 and U138 complexes shows that these complexes are 1
2
3
4
5
711 ~ 489 404~
_
364
_
242
-
190
_
147
X
118
X
110
_
_
67
FIG. 1. Preparation and analysis of halted elongation complexes G135 and U138. The terminal sequence of pGR220 used for complex formation is as follows (nontemplate strand): 5'-p-GGGAAGAAAA AGCAAACCGC AGAGAGGAAG CCAACCCCAG AAGAGAGGAA50 CCAGAAGCGG CAAGCCCAGG AGCGAGACGC AACAGGCGAC GAGGCACCCG'00 CUGGCACGAC AAGCACAACA CCAGCGAGCA AGGCG135 TTTCGGGGAA145 GAAAAAGCAA155. Halted elongation complexes were formed on pCpGR220 by using calf thymus RNA polymerase 11, and transcripts were analyzed on a denaturing polyacrylamide gel (30:0.8 acrylamide/bisacrylamide, 7 M urea; 0.8 mm thick, 25 cm long) in 1 x TBE (89 mM Tris base/89 mM boric acid/2.5 mM EDTA). The activity of the halted complexes was determined by addition of NTPs to allow elongation to resume. Lanes: 1, DNA size markers (lengths in nt are given on left); 2, G135 complex labeled with [a-32P]CTP; 3, U138 complex formed by elongating the isolated G135 complex upon addition of UTP; 4, U138 complex 3'-end-labeled with [a-32P]UTP; 5, chase of the 3'-end-labeled U138 complex by addition of NTPs.
quite pure, and the majority of complexes are active as shown by their ability to be chased (lane 5). However, the U138 complexes often contain significant amounts of U136 and U137 complexes as we discuss below. Structural Analysis of an Elongation Intermediate by RNase Footprinting. To study the contacts between RNA polymerase II and its transcript in the U138 complex, the 3'-endlabeled U138 complexes were treated with RNase T1 or RNase A. Free U138 RNA was treated in the same way and the digestion products were compared by gel electrophoresis (Fig. 2). For each experiment, the numbers on the left show the sizes of expected RNase cleavage products, and those on the right show the position of the corresponding cleavage site along the 138-nt transcript as read from the RNA ladder. RNase T1 cleaves on the 3' side of single-stranded G residues; RNase A cleaves on the 3' side of single-stranded C and U residues. Sensitivity of the U138 transcript to RNase T1 differs dramatically depending on whether the ternary complex or free RNA is treated with the nuclease (Fig. 2A). At low nuclease concentrations (0.005-0.05 unit/ml), there are no cleavage products from the ternary complex shorter than 25 nt (lanes 3 and 4), although digestion products of 25, 30, and 34 nt do appear. Only at higher RNase T1 concentrations (0.5-5 units/ml) do smaller cleavage products of 3-14 nt appear (lanes 1 and 2). Thus, RNA polymerase II can protect -24 nt at the 3'-OH end of the U138 transcript from RNase T1 digestion; this protection is lost as the nuclease concentration is increased. RNase A treatment of the U138 complex also reveals major differences in the cleavage pattern of the RNA in the complex versus free RNA (Fig. 2B). In this case, only -9 nt of transcript is protected from RNase A cleavage at low RNase concentrations. Cleavage products of 4 and 9 nt are less abundant at lower RNase A concentrations (lanes 4, 3, and 2; RNase A concentrations of 0.01, 0.1, and 1 ug/ml, respectively), while cleavage products of 17 and 19 nt are represented about equally in digests of either the ternary complex or the free RNA. Increasing the concentration of RNase A further, to 10 ,ug/ml, gives increased amounts of cleavage products of 4, 9, and 13 nt. In addition to the specific protection of a region at the 3'-OH end of the transcript, the nascent RNA in U138 complexes was generally protected from RNase T1 and A cleavage compared to free RNA. That is, even at the highest nuclease concentrations used here, which digest free RNA to limit products, a substantial amount of full-length RNA remains in complexes. We do not know the explanation for this difference. This is not seen in Fig. 2 because the upper part of the autoradiogram showing the full-length U138 RNA has been cut off. In contrast, for free RNA, full-length transcripts are only seen at the lowest nuclease concentrations. In both experiments, there are RNA products that do not correspond in size to expected RNase cleavage products. Some of these (marked with double asterisks) are minor contaminants in the original untreated RNA sample; these do not interfere with the analysis. Other bands (marked with single asterisks) are due to the failure to obtain quantitative elongation of the original G135 complexes to U138, giving shorter transcripts U136 and U137 as contaminants. An example of this is seen for the digest of the U138 RNA preparation by RNase A, which gives three bands (Fig. 3, lane 2). These bands were sequenced by nearest-neighbor analysis to confirm their identity. Stability and Activity of RNase-Digested Elongation Complexes. Although the halted U138 complexes were stable for the time required to complete our analyses, a critical question was whether RNase-treated complexes remained active. If complexes were dissociated during or after RNase cleavage,
Biochemistry: Rice et al.
Proc. Natl. Acad. Sci. USA 88 (1991)
1 2 3 4 5 6 7 8 L 9
A
1 2 3 4 5 6 7 8 L 9
B 33
35-_ 34-
105
'
31-
_
_I|*
28-
4 115
2422-
.
..
_A _ -_ _ _~--%
,-_ .
ra
110
m
110 25--
105
.-
...
I.
,
30-
4247
-_NW
a%
115 _-
19-
120
120
*
167.
da --
14-'
all
w
-
-~~~TA
mve
125
125
13-'
126
12-'
126
127 127
_oo
10--
128
_ 43
oiw'
>
130
*
131
40.
132
w
9-'
d*:
129
130 131
lb
.. 5
128
129
132 133
, ii Amok-AdIL.-Aft MW
.
3-o
I*
134
133
i
135
4-
0F
-
134
135
FIG. 2. Analysis of RNase sensitivity of 3'-end-labeled transcripts in U138 elongation complexes and 3'-end-labeled free U138 RNA. (A and B) Digestion products from RNase T1 and RNase A treatment, respectively. The sizes (nt) of the expected 3'-terminal cleavage products are indicated on the left and are marked with arrows. On the right are shown the corresponding sites of cleavage along the original U138 RNA; for example, cleavage at position 132 gives a 6-nt product. Asterisks denote cleavage products from ternary complexes containing 136- and 137-nt transcripts, and double asterisks mark transcripts present in the original RNA sample before digestion. (A) Digestion of complexes and free RNA with several concentrations of RNase T1. Lanes: 1-4, cleavage products of transcripts in U138 complexes digested with RNase T1 at 5, 0.5, 0.05, and 0.005 units/ml, respectively; 5-8, cleavage products of free U138 RNA, digested with RNase T1 at 5, 0.5, 0.05, and 0.005 units/ml, respectively; 9, untreated RNA transcripts from U138 complexes. Lane L contains a ladder of U138 RNA alkaline hydrolysis products prepared by treating gel-purified 3'-end-labeled U138 RNA with 1% piperidine for 2 min at 930C. (B) Digestion of complexes and free RNA with several concentrations of RNase A. Lanes: 1-4, cleavage products of transcripts in U138 complexes, digested with RNase A at 10, 1, 0. 1, and 0.01 gg/ml, respectively; 5-8, cleavage products of free U138 RNA digested with RNase A at 10, 1, 0.1, and 0.01 ,ug/ml, respectively; 9, untreated RNA transcripts from U138 complexes. Lane L contains an RNA ladder as in A. Transcripts were analyzed by denaturing 20% PAGE (20% acrylamide/3% bisacrylamide/7 M urea; 0.3 mm thick, 40 mm long) in ix TBE.
it would be difficult to draw plausible conclusions as to complex structure from the cleavage products, since RNA products might arise from cleavage of RNAs only after release from the ternary complex. We tested for complex stability by adding NTPs to the digested U138 complexes so that elongation could resume for any complexes that remained active and stable (Fig. 3). U138 complexes digested with RNase A give RNA products with lengths of 4, 9, 13, 16, 22, 24 nt, and longer (lanes 2 and 4). A substantial fraction of each is still present in RNA polymerase complexes that are intact and active, as demonstrated by the disappearance of the appropriate band from the elongation lanes (lanes 3 and 5). U138 complexes digested with RNase T1 also remain stable and active; complexes containing transcripts of 5, 6, 10, 12, 25 nt, and longer are all elongated in a similar experiment (lanes 6-9). One exception is the potential complex cleaved by RNase T1 to give a 3-nt transcript. Since the amount of the 3-nt product does not decrease detectably during the elongation, the experiment does not reveal
whether this RNA is part of an inactive complex or whether it has been released after cleavage. A second way of testing stability and activity of elongation complexes uses isolation by centrifugal gel filtration (19). Released transcripts are retained by the gel filtration column while intact complexes pass through. NTPs can then be added to these purified complexes to assess which ones remain active during the isolation. U138 complexes were digested with either RNase T1 or RNase A to give complexes containing transcripts of each possible length between 3, 24 nt, and longer. The complexes were then isolated by centrifugal gel filtration. An examination of complexes excluded from the column revealed that those with transcripts
