Neurochem Res (2015) 40:27–35 DOI 10.1007/s11064-014-1461-5
ORIGINAL PAPER
Forsythiaside Protects Against Hydrogen Peroxide-Induced Oxidative Stress and Apoptosis in PC12 Cell ChunKang Huang • Yonglian Lin • Hong Su Dongqing Ye
•
Received: 30 May 2014 / Revised: 16 October 2014 / Accepted: 18 October 2014 / Published online: 25 October 2014 Ó Springer Science+Business Media New York 2014
Abstract Oxidative stress is a major component of harmful cascades activated in neurodegenerative disorders. We sought to elucidate possible effects of forsythiaside, an active constituent isolated from the Chinese medicinal herb Forsythia suspense, on hydrogen peroxide (H2O2)-induced cell death and to determine the underlying molecular mechanisms in neuron-like PC12 cells. We found that forsythiaside treatment effectively protected PC12 cells against H2O2-induced cell damage and apoptosis. H2O2 exposure induced oxidative stress in PC12 cells, as revealed by increased ROS and lipid peroxidation (MDA), which were inhibited by forsythiaside pretreatment. Increased Bax/Bcl-2 ratio, mitochondrial membrane potential decrease, cytochrome c release, caspase-9/-3 activation, AIF/Endo G translocation were observed in H2O2-treated cells. Interestingly, forsythiaside effectively prevented these events. These results suggested that forsythiaside prevented H2O2-induced mitochondria-dependent apoptosis. Further, increased nuclear levels of Nrf2 and up-regulation of antioxidant enzymes (Mn/SOD and CAT) were detected in forsythiaside-treated cells, indicating the anti-oxidative effects of forsythiaside might be associated with activation of Nrf2 pathway. Moreover, forsythiaside was proved to be effective to prevent LPSinduced cell death and ROS generation. In conclusion, forsythiaside effectively inhibited H2O2-induced oxidative stress and subsequent apoptosis activation. C. Huang H. Su D. Ye (&) School of Public Health, Anhui Medical University, 81 Meishan Rd., Hefei 230032, Anhui Province, China e-mail: [email protected]; [email protected] Y. Lin Fujian University of TCM, 1 Qiuyang Rd., Fuzhou 350122, Fujian Province, China
Keywords Forsythiaside Neurodegenerative disorders Oxidative stress Apoptosis
Introduction Oxidative stress-induced cell damage plays an important role in the physiological process of aging and in a variety of neurodegenerative diseases such as Alzheimer’s disease (AD) [1, 2]. Despite oxidative stress itself does not exhibit a specific clinical picture, overproduction of reactive oxygen species (ROS) is able to cause cell damage through promoting lipid peroxidation, DNA damage and regulation of apoptosis proteins. Subsequent events such as apoptosis or cell cycle arrest also contribute to cell death [3]. Many reports suggest a connection between oxidative stress and apoptosis in AD [4–6], therefore, antioxidants that prevent or delay ROS-induced apoptosis might be a reasonable therapeutic strategy against neurodegeneration. Among various antioxidants, natural substances isolated from medicinal herb showed advantages than synthetic chemicals because the latter have some severe adverse effects though strong radical scavenging abilities [7]. Recently, attention has been focused on searching for natural substances with neuroprotective potential that can scavenge free radicals and protect cells from oxidative damage. Forsythiaside (3,4-dihydroxy-b-phenethyl-O-a-L-rhamnopyranosyl-(1 ? 6)-4-O-caffeoyl-b-D-glucopyranoside, C29H36O15) is a phenylethanoid glycoside isolated from the Chinese medicinal herb Forsythia suspense that has been widely used to treat various infections, including acute nephritis, erysipelas and ulcers [8]. Forsythiaside has been reported to have anti-oxidant, anti-bacterial and antiinflammatory activities [9–11]. It’s important to note that recent studies found forsythiaside has beneficial effects on
123
28
nervous system diseases, including transient cerebral global ischemia model [12] and senescence-accelerated mouse model [8]. Forsythiaside might be a promising therapeutic agent for nervous system diseases, however, there is a lack of information about the effects of forsythiaside on neuron cell. Here in, we studied the neuroprotective effects of forsythiaside in H2O2-induced cell death in neuron-like PC12 cells and investigated the underlying mechanisms.
Neurochem Res (2015) 40:27–35
Flow Cytometric Analysis of Apoptosis Annexin V-FITC apoptosis detection kit was used to detect phosphatidylserine expression (an indicator of apoptotic cells) on the cell membrane. Briefly, the treated-cells were harvested and washed with PBS twice, gently resuspended in Annexin V binding buffer and incubated with Annexin V-FITC in dark for 10 min and subsequently incubated with PI in dark for 10 min and analyzed by flow cytometry using Cell Quest software (BD Biosciences, USA).
Materials and Methods Measurement of Intracellular ROS Materials Forsythiaside was obtained from National Institutes for Food and Drug Control (China). b-actin antibody was obtained from Sungene Biotech (China). Caspase-9, caspase-3, Bax, Bcl-2 and cytochrome c antibodies were obtained from Boster Biotechnology (China). Apoptosis inducing factor (AIF) and endonuclease G (Endo G) and NF E2-related factor 2 (Nrf2) antibodies were obtained from Santa Cruz Biotechnology (USA). 20, 70-dichlorofluorescein diacetate (DCFH-DA), N-acetyl-L-cysteine (NAC), rhodamine-123, carbobenzoxy-valyl-alanyl-aspartyl-[O-methyl]-fluoromethylketone (Z-VAD), malonaldehyde (MDA) assay kit, total superoxide dismutase (SOD) assay kit, catalase (CAT) assay kit and Annexin V-FITC apoptosis detection kit were obtained from Beyotime Biotechnology (China). All the other reagents, unless otherwise stated, were from Beyotime Biotechnology (China).
The fluorescent probe DCFH-DA was used to monitor intracellular accumulation of ROS. Briefly, 1 mL DCFHDA solution (10 lM) was added to the 24-well tissue plates, then incubated at 37 °C for 30 min. Cells were washed three times with PBS and finally, the fluorescence intensity was viewed under confocal microscopy (Olympus Fluoview-10). Measurement of Mitochondrial Membrane Potential The mitochondrial membrane potential (DWm) was measured using rhodamine 123. Rhodamine 123 can enter the mitochondrial matrix and cause photoluminescent quenching that is dependent on mitochondrial transmembrane potential. Treated-cells were incubated with 5 mg/L rhodamine 123 for 30 min at 37 °C in the dark and washed three times with PBS. Fluorescence emission intensity was viewed under fluorescence microscope (Olympus).
Cell Culture and Treatment
Assay of Oxidative Biochemical Parameters
Rat pheochromocytoma (PC12) cells obtained from Chinese Academy of Sciences were grown in RPMI1640, supplemented with 7 % fetal bovine serum, 13 % horse serum and 1 % antibiotic mixture comprising penicillin– streptomycin, in a humidified atmosphere at 37° with 5 % CO2. PC12 cells were treated with or without forsythiaside for 6 h or with or without NAC (1 Mm) for 30 min then exposed to H2O2 for 6 h or 24 h. For AIF and Eondo G assay, PC12 cells were treated with or without Z-VAD for 2 h, then with or without forsythiaside for 6 h, and exposed to H2O2 for 24 h.
Cells were homogenized in RIPA lysis buffer. The mixture was centrifuged at 12,000g for 30 min at 4 °C. The supernatant was collected and used for the experiments. The activities of SOD, CAT and the levels of MDA were determined by using commercially available colorimetric assay kits according to the manufacturer’s recommended protocol (Beyotime Biotechnology, China).
Measurement of Cell Viability Cell viability was determined by MTT reduction assay. Briefly, the dark blue formazan crystals formed in intact cells were solubilized in DMSO and the absorbance was determined at 570 nm using a microplate reader.
123
Western Blotting Analysis Total proteins, mitochondrial proteins, cytosolic proteins or nuclear proteins were extracted by using commercially available kits according to the manufacturer’s recommended protocol (Beyotime Biotechnology, China). The protein samples (30 lg) were separated by SDS-PAGE and electro-transferred onto polyvinylidene fluoride membranes. The blots were incubated with specific antibody (1:500 dilution for b-actin, AIF, Endo G and Nrf2; 1:250 dilution for cytochrome c, cleaved caspase-9/-3, Bax and
Neurochem Res (2015) 40:27–35 Table 1 Primers used for quantitative real-time PCR
29
Target gene (rattus norvegicus) Mn/SOD CAT b-actin
Gen Bank accession no.
Primer
Sequence(50 –30 )
PCR fragment length (bp) 245
NM
Forward
ACCGAGGAGAAGTACCACGA
001098153.1
Reverse
CCTGAACCTTGGACTCCCAC
NM
Forward
GGTAACTGGGACCTTGTGGG
012520.2
Reverse
TCCATCTGGAATCCCTCGGT
NM
Forward
GTGGATCAGCAAGCAGGAGT
031144.3
Reverse
AGGGTGTAAAACGCAGCTCA
204 96
Bcl-2). After rinsed in TBST, the blots were incubated with appropriate secondary antibodies conjugated to horseradish peroxidase. Immunoreactive band of proteins were detected by an enhanced chemiluminescence detection system, and the membrane was exposed to an X-ray film. Immunofluorescence Analysis Cells were plated on sterile glass coverslips in 24-well tissue plates and treated. The slips were rinsed three times in phosphate-buffered saline (PBS, pH 7.4) and fixed with 10 % neutral buffered formalin at room temperature for 20 min. After being rinsed in PBS and treated with 1 mM EDTA-Na2 (pH = 9.0) for 5 min in 95 °C. The cells were rinsed in PBS and treated with 0.1 % triton-100 for 10 min. The cells were then blocked with 5 % normal donkey serum for 30 min in a humidified box and then incubated with anti-AIF (1:50 dilution) or anti-Endo G (1:50 dilution) at 4 °C overnight. After the slides were rinsed three times in PBS and incubated with Cy3-conjugated donkey antigoat immunoglobulin G for 30 min. At last, they were rinsed with PBS, stained with Hoechst and viewed under confocal microscopy (Olympus Fluoview-10). Real-Time Fluorescent Quantitative PCR and PCR Analysis Total RNA was isolated from the cells using the TRIzol reagent according to the manufacturer’s instructions (Takara, Japan) and transcribed into cDNA using a reverse transcription kit (Takara, Japan). Primer Premier software (PREMIER Biosoft International, USA) was used to design specific primers for CAT, Mn/SOD and b-actin based on rattus norvegicus sequences (Table 1). RNA concentrations were detected by an RNA/DNA calculator produced by Pharmacia Biotech Company (Cambridge, UK). RNA concentrations were adjusted to the same level by 0.1 % sterile diethyl pyrocarbonate (DEPC). According to the measured concentrations, the volume of total RNA for reverse transcription was confirmed. Concentrations of cDNA in each group were then regulated. Relative expression contents of CAT or Mn/SOD mRNA were analyzed by 2-DDCt using the RT-PCR method.
Fig. 1 Chemical structure of forsythiaside
The computational formula was as follows: Amount of target ¼ 2DDCt DDCt ¼ ðCt CAT or Mn=SOD Ct b-actinÞ Time ðCt CAT or Mn=SOD Ct b-actinÞ Time 0: Data Analysis All data are represented as the mean ± S.E.M (Standard Error Mean). Comparison between groups was made by one-way analysis of variance (ANOVA) followed by an appropriate post hoc test to analyze the difference. The statistical significances were achieved when p \ 0.05 (*or #p \ 0.05, ** or ##p \ 0.01) (Fig. 1).
Results Effects of Forsythiaside and H2O2 on Cell Death To evaluate neuroprotective effect of forsythiaside, PC12 cells were treated with different doses of forsythiaside then exposed to H2O2 24 h. After 24 h, the cells were assayed for cell viability. As shown in Fig. 2a, pretreatment with forsythiaside dose-dependently protected PC12 cells against H2O2-induced cell damage. At these concentrations forsythiaside alone did not have any cytotoxic effect in PC12 cells. It has been reported that H2O2-induced cytotoxicity and apoptotic cell death are mediated by oxidative stress. As
123
30
Neurochem Res (2015) 40:27–35
Fig. 2 Effect of H2O2 and forsythiaside on cell damage. Cells were incubated 6 h with or without forsythiaside (1, 5, 10 lg/ml) or 30 min with or without NAC (0.5 mM, 1 mM) prior to H2O2 (150 lM) exposure for 24 h. a Protective effects of forsythiaside and NAC on H2O2-induced toxicity in PC12 cells by MTT assay. Data was expressed as a percentage of untreated controls. c Cells were incubated 6 h with or without forsythiaside (5 lg/ml) and 30 min
with NAC (1 mM) prior to H2O2 (150 lM) exposure for 24 h. Morphological evaluation by light microscopic observation (white scale bar stands for 10 lm). d Cell apoptosis was detected with Annexin V-FITC by flow cytometry. All experiments were repeated three times and one is presented. #p \ 0.05 or ##p \ 0.01, versus control group. *p \ 0.05 or **p \ 0.01, versus H2O2 treatment group
shown in Fig. 2a, H2O2-induced cytotoxicity and apoptotic cell death were also effectively suppressed by pretreatment with NAC (0.5 and 1 mM), a glutathione (GSH) precursor with strong antioxidant activity. Light microscopic observation was performed to investigate the effect of forsythiaside and H2O2 on cell death. As shown in Fig. 2b, exposure to H2O2 for 24 h caused heterogeneity in their shape. Pretreatment of cells with forsythiaside or NAC had alleviated these and prevented cell damage. Furthermore, phosphatidylserine expression (an indicator of apoptotic cells) on the cell membrane was detected by using Annexin V to confirm the effect of forsythiaside and H2O2 on cell apoptosis. H2O2 exposure increased the apoptosis rate from 4.30 to 24.52 % compared to the control, which was declined to 8.49 % by 5 lg/ml forsythiaside pretreatment and to 8.27 % by 1 mM NAC pretreatment (Fig. 2c).
Effects of Forsythiaside and H2O2 on Bax/Bcl-2 Ratio
Effects of Forsythiaside and H2O2 on ROS and MDA Generation To determine whether forsythiaside may attenuate cell death through reducing oxidative stress, the levels of ROS and MDA were measured. As shown in Fig. 3a, b, treatment of PC12 cells with H2O2 increased the levels of ROS and MDA, which both were effectively inhibited by forsythiaside pretreatment, dose-dependently.
123
Bcl-2 proteins are important regulators of cell apoptosis. Two members, Bcl-2 and Bax proteins were detected by Western blot. As shown in Fig. 4, H2O2 significantly upregulated Bax/Bcl-2 ratio compared to the control. However, forsythiaside pretreatment significantly decreased the ratio of Bax/Bcl-2. Effects of Forsythiaside and H2O2 on Mitochondrial Membrane Potential To investigate whether forsythiaside may attenuate cell death through stabilizing mitochondrial function, the mitochondrial membrane potential were measured. As shown in Fig. 3c, exposure to H2O2 depolarized the mitochondrial membrane potential (74.5 % loss of D Wm compared to control), which were effectively prevented by forsythiaside pretreatment. Effects of Forsythiaside and H2O2 on Cytochrome c Release and Caspases Activation Cytochrome c, caspase-9 and -3 are biomarkers of oxidative stress-induced cell death via mitochondrial-dependent apoptotic pathway. They were measured by Western blot. As shown in Fig. 4, compared to the control, H2O2 exposure significantly increased expression of cytosolic cytochrome
Neurochem Res (2015) 40:27–35
31
Fig. 3 Effect of H2O2 and forsythiaside on oxidative stress. Cells were incubated 6 h with or without forsythiaside (1, 5, 10 lg/ml) prior to H2O2 (150 lM) exposure for 6 h. a ROS was detected with DCFH-DA and the fluorescence intensity was calculated. b MDA was detected. c Cells were incubated 6 h with or without forsythiaside (1,
5, 10 lg/ml) prior to H2O2 (150 lM) exposure for 24 h. Mitochondrial membrane potential was detected with rhodamine 123. Data was expressed as a percentage of untreated controls. All experiments were repeated three times. #p \ 0.05 or ##p \ 0.01, versus control group. *p \ 0.05 or **p \ 0.01, versus H2O2 treatment group
c, cleaved caspase-9 and -3, namely, cytochrome c release and caspases activation. However, forsythiaside pretreatment was found to be effective to prevent H2O2-induced these events.
have been represented in Fig. 6d. Our study revealed that H2O2 treatment reduced the activities of CAT and total SOD, meanwhile, administration of forsythiaside kept the status of these enzymes nearly close to normal against H2O2 toxicity.
Effects of Forsythiaside and H2O2 on AIF and Endo G Translocation
Effects of Forsythiaside on LPS-Induced Cell Death and ROS Generation
We investigated whether the AIF and Endo G were involved in the protective effects of forsythiaside. Their translocation from mitochondria into the nucleus was detected by immunofluorescence. As shown in Fig. 5a, b, d, H2O2 exposure significantly induced AIF and Endo G translocation from the mitochondria into the nucleus, while forsythiaside pretreatment significantly prevented that. Furthermore, incubated with pan-caspase inhibitor Z-VAD, which significantly suppressed expression of cleaved caspase-3 (Fig. 5c), forsythiaside still protected against H2O2induced cell death and AIF and Endo G translocation.
LPS induces several endogenous ROS sources (NADPH oxidases, XOR, iNOS, COX-2) that are promising targets in many neurological diseases, the protective effect of forsythiaside was also tested in the LPS-treated cells. As shown in Fig. 7a, MTT assay showed that forsythiaside effectively protected against LPS-induced cell damage. Moreover, the results of ROS measurement indicated that forsythiaside had an inhibiting effect on oxidative stress caused by LPS exposure (Fig. 7b).
Effects of Forsythiaside on Nuclear Levels of Nrf2
Discussion
Nrf2 has been recognized as a key transcription factor against oxidative damage. We investigated whether forsythiaside has effects on Nrf2. The nuclear content of Nrf2 in nuclear proteins was detected by Western blot. As shown in Fig. 6a, b, forsythiaside treatment significantly increased nuclear expression of Nrf2 after 6–48 h treatment, and the highest level of Nrf2 appeared in 24 h treatment.
Forsythiaside increased PC12 cell viability and showed a significant protective effect against H2O2-induced cell damage when measured by MTT assay. In addition, treatment with forsythiaside significantly protected against H2O2-induced PC12 cell apoptosis, as detected by Flow cytometric analysis of apoptosis. The cells exposed to H2O2 exhibited a distinct increase in the percentage of apoptotic cells, which is representative of programmed cell death. However, when PC12 cells were pretreated with forsythiaside, a dramatic reduction in the amount of apoptotic cells was observed. Taken together, these results suggested that forsythiaside protected against H2O2induced apoptosis. Oxidative stress is involved in the death of neurons and leads to the apoptosis in many neurological diseases [13]. H2O2 is an inducer of oxidative stress in vitro [14]. H2O2 can induce apoptosis in many different cell types which
Effects of Forsythiaside on Antioxidative Enzymes The mRNA levels of CAT and Mn/SOD were measured by Q-PCR, as shown in Fig. 6c. Compared to the control group, forsythiaside treatment significantly increased the mRNA levels of CAT and Mn/SOD, which was consistent with Nrf2 activation. The effects of forsythiaside on activities of antioxidant enzymes, namely, SOD and CAT against H2O2 toxicity
123
32
Neurochem Res (2015) 40:27–35
Fig. 4 Effect of H2O2 and forsythiaside on Bax/Bcl-2 ratio, cytochrome C release, caspases activation. Cells were incubated 6 h with or without forsythiaside (1, 5, 10 lg/ml) prior to H2O2 (150 lM) exposure for 24 h. a Expression of Bax and Bcl-2, mitochondrial cytochrome C (Mito cyt C), cytosolic cytochrome C (Cyto cyt C), procaspase-9, caspase-9, procaspase-3, caspase-3 were measured by Western Blot, b and their ratios to b-actin were calculated. All experiments were repeated three times and one is presented. #p \ 0.05 or ##p \ 0.01, versus control group. *p \ 0.05 or **p \ 0.01, versus H2O2 treatment group
may be inhibited by antioxidants [15]. Excessive ROS and lipid peroxidation are major indicators of oxidative stress. In PC12 cells, H2O2 induces overproduction of intracellular ROS and MDA, and inhibiting them is thought to be protective against H2O2 cytotoxicity [16, 17]. From our study, forsythiaside was found to be effective in decreasing H2O2induced oxidative stress and protected PC12 cells from cytotoxicity. From our study, a significant increment of Bax/Bcl-2 ratio was detected in H2O2-treated cells, while it was reduced in forsythiaside-pretreated groups. Bax and Bcl-2 are important regulators participating in mitochondrial apoptotic pathway [18]. In addition to the induction of mitochondrial permeability transition pore (MPTP) by ROS, increased Bax/Bcl2 ratio can also directly induce MPTP, leading to the release of cytochrome c (cyt C) along with other proapoptotic proteins such as AIF and Endo G [19]. Once released, cyt C forms an oligomeric complex with dATP and Apaf-1 [20], followed by recruitment of procaspase-9 and its activation. The active caspase-9 then activates effector caspases, such as caspase-3, -6 and -7 [21]. We detected significant increased Bax/Bcl-2 ratio, mitochondrial membrane potential decrease, cyt C release, caspase-9/-3 activation in H2O2-treated groups compared to the control, indicating activation of mitochondria
123
apoptotic pathway by H2O2. However, these were all attenuated by forsythiaside pretreatment, suggesting that forsythiaside was able to inhibit mitochondria-dependent apoptosis caused by H2O2. AIF and Endo G are caspase-independent apoptosis effectors released from mitochondria induced by MPTP [22]. They released from mitochondria and translocated into the nucleus, then triggered apoptosis by condensing its chromosomes and fragmenting DNA molecules. We found significant translocation of AIF and Endo G triggered by H2O2 exposure, which was prevented by forsythiaside pretreatment. To further confirm the inhibiting effects of forsythiaside on caspase-independent apoptosis, Z-VAD (a pan-caspase inhibitor) was used. When incubated with Z-VAD, H2O2-induced caspase-3 activation was inhibited, while AIF and Endo G were not affected. Under this circumstance, forsythiaside still protected against H2O2induced cell death, indicating inhibition of AIF and Endo G was involved in the anti-apoptotic effects of forsythiaside. To further elucidate the upstream regulators for the induction of endogenous antioxidant defense enzymes against oxidative stress, we have focused on the Nrf2 signaling pathway. Nrf2 is a member of the cap ‘n’ collar family of basic leucine zipper proteins. It is known as the primary transcription factor responsible for initiating the
Neurochem Res (2015) 40:27–35
33
Fig. 5 Effect of H2O2 and forsythiaside on translocation of AIF and Endo G. Cells were pre-incubated 2 h with Z-VAD, then treated 6 h with or without forsythiaside (5 lg/ml), and later exposed to H2O2 (150 lM) for 24 h. The expression of AIF, Endo G and caspase-3 were measured by Western Blot. b and c Their ratios to b-actin were
calculated. d Intracellular localization of AIF and Endo G was detected by immunofluorescence (white scale bar stands for 10 lm). All experiments were repeated three times and one is presented. #p \ 0.05 or ##p \ 0.01, versus control group. *p \ 0.05 or **p \ 0.01, versus H2O2 treatment group
Fig. 6 Effect of forsythiaside on Nrf2 activation and anti-oxidative enzymes. Cells were incubated with forsythiaside (5 lg/ml) for 0, 1, 6, 12, 24, 36 or 48 h. a The nuclear levels of Nrf2 were measured by Western Blot, b and the ratios to b-actin were calculated. c The mRNA levels of Mn/SOD, CAT and was detected by Q-PCR. d Cells
were incubated 6 h with or without forsythiaside (1, 5, 10 lg/ml) prior to H2O2 (150 lM) exposure for 24 h. The activities of SOD and CAT were measured. All experiments were repeated three times and one is presented. *p \ 0.05 or **p \ 0.01, versus control group. #p \ 0.05 or ##p \ 0.01, versus H2O2 treatment group
response to oxidative stress [23]. Normally, Nrf2 translocates into the nucleus where it binds DNA at a consensus sequence known as the antioxidant or electrophilic
response element. In this way, Nrf2 regulates transcription of a large group of detoxification genes, among which are the subunits of glutamate cysteine ligase (GCL), the rate-
123
34
Neurochem Res (2015) 40:27–35
Fig. 7 Effects of LPS and forsythiaside on cell death and ROS generation. a Cells were incubated 6 h with or without forsythiaside (1, 5, 10 lg/ml) prior to LPS (2 lg/ml) exposure for 24 h. Cell viability was assessed by MTT assay. b Cells were incubated 6 h with
or without forsythiaside (1, 5, 10 lg/ml) prior to LPS (2 lg/ml) exposure for 6 h. ROS was detected with DCFH-DA and the fluorescence intensity was calculated. Data was expressed as a percentage of untreated controls
limiting enzyme in GSH biosynthesis. Activation of Nrf2 is thought to be neuroprotective in PC12 cells [24, 25]. From our study, forsythiaside significantly induced Nrf2 activation, as revealed by the increased nuclear Nrf2 levels. It seems that forsythiaside protects PC12 cells against oxidative stress via induction of the Nrf2 pathway. This was further confirmed by evaluating the gene expressions and activities of antioxidant enzymes (Mn/SOD, CAT), which are considered to be up-regulated through the activated Nrf2 signaling pathway to potentiate the endogenous antioxidant defense system for ROS eliminated [26]. Taken together, these data demonstrated that forsythiaside provides protective effects against H2O2-induced neuronal cell death through multiple mechanisms. Forsythiaside pretreatment not only reduced ROS overproduction and lipid peroxidation, but also attenuated subsequent activation of apoptosis. Its antioxidative effects might be associated with induction of the Nrf2 pathway. Moreover, the antioxidative properties of forsythiaside test were also tested in LPS-treated cells. Forsythiaside was proved to be effective to prevent LPS-induced cell death and ROS generation. In addition, forsythiaside was proved to have rapid distribution and slow elimination in vivo [27]. Forsythiaside might be promising therapeutic drug for the treatment of neurological diseases.
potential biomarkers for Alzheimer’s disease. J Neural Transm Suppl 72:207–215 Turunc Bayrakdar E, Uyanikgil Y, Kanit L, Koylu E, Yalcin A (2014) Nicotinamide treatment reduces the levels of oxidative stress, apoptosis, and PARP-1 activity in Abeta(1-42)-induced rat model of Alzheimer’s disease. Free Radic Res 48:146–158 Halliwell B, Aruoma OI (1991) DNA damage by oxygen-derived species. Its mechanism and measurement in mammalian systems. FEBS Lett 281:9–19 Heilmann J, Merfort I, Weiss M (1995) Radical scavenger activity of different 30 ,40 -dihydroxyflavonols and 1,5-dicaffeoylquinic acid studied by inhibition of chemiluminescence. Planta Med 61:435–438 Wang HM, Wang LW, Liu XM, Li CL, Xu SP, Farooq AD (2013) Neuroprotective effects of forsythiaside on learning and memory deficits in senescence-accelerated mouse prone (SAMP8) mice. Pharmacol Biochem Behav 105:134–141 Qu H, Zhang Y, Wang Y, Li B, Sun W (2008) Antioxidant and antibacterial activity of two compounds (forsythiaside and forsythin) isolated from Forsythia suspensa. J Pharm Pharmacol 60:261–266 Cheng G, Zhao Y, Li H, Wu Y, Li X, Han Q, Dai C, Li Y (2014) Forsythiaside attenuates lipopolysaccharide-induced inflammatory responses in the bursa of Fabricius of chickens by downregulating the NF-kappaB signaling pathway. Exp Ther Med 7:179–184 Zhou L, Yang H, Ai Y, Xie Y, Fu Y (2014) [Protective effect of forsythiaside A on acute lung injure induced by lipopolysaccharide in mice], Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi 30:151–154 Kim JM, Kim S, Kim DH, Lee CH, Park SJ, Jung JW, Ko KH, Cheong JH, Lee SH, Ryu JH (2011) Neuroprotective effect of forsythiaside against transient cerebral global ischemia in gerbil. Eur J Pharmacol 660:326–333 Naoi M, Maruyama W, Yi H, Inaba K, Akao Y, Shamoto-Nagai M (2009) Mitochondria in neurodegenerative disorders: regulation of the redox state and death signaling leading to neuronal death and survival. J Neural Transm 116:1371–1381 Satoh T, Sakai N, Enokido Y, Uchiyama Y, Hatanaka H (1996) Free radical-independent protection by nerve growth factor and Bcl-2 of PC12 cells from hydrogen peroxide-triggered apoptosis. J Biochem 120:540–546 Jang JH, Surh YJ (2001) Protective effects of resveratrol on hydrogen peroxide-induced apoptosis in rat pheochromocytoma (PC12) cells. Mutat Res 496:181–190 Benedi J, Arroyo R, Romero C, Martin-Aragon S, Villar AM (2004) Antioxidant properties and protective effects of a standardized extract of hypericum perforatum on hydrogen peroxideinduced oxidative damage in PC12 cells. Life Sci 75:1263–1276 Hong H, Liu GQ (2004) Protection against hydrogen peroxideinduced cytotoxicity in PC12 cells by scutellarin. Life Sci 74:2959–2973
Conflict of interest of interest.
The authors declare that there are no conflicts
References 1. Al-Ayadhi LY (2004) Oxidative stress and neurodegenerative disease. Neurosciences (Riyadh) 9:19–23 2. Zawia NH, Lahiri DK, Cardozo-Pelaez F (2009) Epigenetics, oxidative stress, and Alzheimer disease. Free Radic Biol Med 46:1241–1249 3. Simon HU, Haj-Yehia A, Levi-Schaffer F (2000) Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 5:415–418 4. Leuner K, Pantel J, Frey C, Schindowski K, Schulz K, Wegat T, Maurer K, Eckert A, Muller WE (2007) Enhanced apoptosis, oxidative stress and mitochondrial dysfunction in lymphocytes as
123
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Neurochem Res (2015) 40:27–35 18. Martinou JC, Youle RJ (2011) Mitochondria in apoptosis: Bcl-2 family members and mitochondrial dynamics. Dev Cell 21:92–101 19. Jacotot E, Costantini P, Laboureau E, Zamzami N, Susin SA, Kroemer G (1999) Mitochondrial membrane permeabilization during the apoptotic process. Ann NY Acad Sci 887:18–30 20. Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES, Wang X (1997) Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91:479–489 21. Earnshaw WC, Martins LM, Kaufmann SH (1999) Mammalian caspases: structure, activation, substrates, and functions during apoptosis. Annu Rev Biochem 68:383–424 22. Tu WC, Wu CC, Hsieh HL, Chen CY, Hsu SL (2008) Honeybee venom induces calcium-dependent but caspase-independent apoptotic cell death in human melanoma A2058 cells. Toxicon 52:318–329
35 23. Vomhof-Dekrey EE, Picklo MJ Sr (2012) The Nrf2-antioxidant response element pathway: a target for regulating energy metabolism. J Nutr Biochem 23:1201–1206 24. Um HC, Jang JH, Kim DH, Lee C, Surh YJ (2011) Nitric oxide activates Nrf2 through S-nitrosylation of Keap1 in PC12 cells. Nitric Oxide 25:161–168 25. Li HY, Wu SY, Shi N (2007) Transcription factor Nrf2 activation by deltamethrin in PC12 cells: involvement of ROS. Toxicol Lett 171:87–98 26. Boesch-Saadatmandi C, Loboda A, Jozkowicz A, Huebbe P, Blank R, Wolffram S, Dulak J, Rimbach G (2008) Effect of ochratoxin A on redox-regulated transcription factors, antioxidant enzymes and glutathione-S-transferase in cultured kidney tubulus cells. Food Chem Toxicol 46:2665–2671 27. Li YX, Peng C, Zhang RQ, Li X, Jiang XH (2009) Pharmacokinetics of phillyrin and forsythiaside following iv administration to Beagle dog. Eur J Drug Metab Pharmacokinet 34:79–83
123
ORIGINAL PAPER
Forsythiaside Protects Against Hydrogen Peroxide-Induced Oxidative Stress and Apoptosis in PC12 Cell ChunKang Huang • Yonglian Lin • Hong Su Dongqing Ye
•
Received: 30 May 2014 / Revised: 16 October 2014 / Accepted: 18 October 2014 / Published online: 25 October 2014 Ó Springer Science+Business Media New York 2014
Abstract Oxidative stress is a major component of harmful cascades activated in neurodegenerative disorders. We sought to elucidate possible effects of forsythiaside, an active constituent isolated from the Chinese medicinal herb Forsythia suspense, on hydrogen peroxide (H2O2)-induced cell death and to determine the underlying molecular mechanisms in neuron-like PC12 cells. We found that forsythiaside treatment effectively protected PC12 cells against H2O2-induced cell damage and apoptosis. H2O2 exposure induced oxidative stress in PC12 cells, as revealed by increased ROS and lipid peroxidation (MDA), which were inhibited by forsythiaside pretreatment. Increased Bax/Bcl-2 ratio, mitochondrial membrane potential decrease, cytochrome c release, caspase-9/-3 activation, AIF/Endo G translocation were observed in H2O2-treated cells. Interestingly, forsythiaside effectively prevented these events. These results suggested that forsythiaside prevented H2O2-induced mitochondria-dependent apoptosis. Further, increased nuclear levels of Nrf2 and up-regulation of antioxidant enzymes (Mn/SOD and CAT) were detected in forsythiaside-treated cells, indicating the anti-oxidative effects of forsythiaside might be associated with activation of Nrf2 pathway. Moreover, forsythiaside was proved to be effective to prevent LPSinduced cell death and ROS generation. In conclusion, forsythiaside effectively inhibited H2O2-induced oxidative stress and subsequent apoptosis activation. C. Huang H. Su D. Ye (&) School of Public Health, Anhui Medical University, 81 Meishan Rd., Hefei 230032, Anhui Province, China e-mail: [email protected]; [email protected] Y. Lin Fujian University of TCM, 1 Qiuyang Rd., Fuzhou 350122, Fujian Province, China
Keywords Forsythiaside Neurodegenerative disorders Oxidative stress Apoptosis
Introduction Oxidative stress-induced cell damage plays an important role in the physiological process of aging and in a variety of neurodegenerative diseases such as Alzheimer’s disease (AD) [1, 2]. Despite oxidative stress itself does not exhibit a specific clinical picture, overproduction of reactive oxygen species (ROS) is able to cause cell damage through promoting lipid peroxidation, DNA damage and regulation of apoptosis proteins. Subsequent events such as apoptosis or cell cycle arrest also contribute to cell death [3]. Many reports suggest a connection between oxidative stress and apoptosis in AD [4–6], therefore, antioxidants that prevent or delay ROS-induced apoptosis might be a reasonable therapeutic strategy against neurodegeneration. Among various antioxidants, natural substances isolated from medicinal herb showed advantages than synthetic chemicals because the latter have some severe adverse effects though strong radical scavenging abilities [7]. Recently, attention has been focused on searching for natural substances with neuroprotective potential that can scavenge free radicals and protect cells from oxidative damage. Forsythiaside (3,4-dihydroxy-b-phenethyl-O-a-L-rhamnopyranosyl-(1 ? 6)-4-O-caffeoyl-b-D-glucopyranoside, C29H36O15) is a phenylethanoid glycoside isolated from the Chinese medicinal herb Forsythia suspense that has been widely used to treat various infections, including acute nephritis, erysipelas and ulcers [8]. Forsythiaside has been reported to have anti-oxidant, anti-bacterial and antiinflammatory activities [9–11]. It’s important to note that recent studies found forsythiaside has beneficial effects on
123
28
nervous system diseases, including transient cerebral global ischemia model [12] and senescence-accelerated mouse model [8]. Forsythiaside might be a promising therapeutic agent for nervous system diseases, however, there is a lack of information about the effects of forsythiaside on neuron cell. Here in, we studied the neuroprotective effects of forsythiaside in H2O2-induced cell death in neuron-like PC12 cells and investigated the underlying mechanisms.
Neurochem Res (2015) 40:27–35
Flow Cytometric Analysis of Apoptosis Annexin V-FITC apoptosis detection kit was used to detect phosphatidylserine expression (an indicator of apoptotic cells) on the cell membrane. Briefly, the treated-cells were harvested and washed with PBS twice, gently resuspended in Annexin V binding buffer and incubated with Annexin V-FITC in dark for 10 min and subsequently incubated with PI in dark for 10 min and analyzed by flow cytometry using Cell Quest software (BD Biosciences, USA).
Materials and Methods Measurement of Intracellular ROS Materials Forsythiaside was obtained from National Institutes for Food and Drug Control (China). b-actin antibody was obtained from Sungene Biotech (China). Caspase-9, caspase-3, Bax, Bcl-2 and cytochrome c antibodies were obtained from Boster Biotechnology (China). Apoptosis inducing factor (AIF) and endonuclease G (Endo G) and NF E2-related factor 2 (Nrf2) antibodies were obtained from Santa Cruz Biotechnology (USA). 20, 70-dichlorofluorescein diacetate (DCFH-DA), N-acetyl-L-cysteine (NAC), rhodamine-123, carbobenzoxy-valyl-alanyl-aspartyl-[O-methyl]-fluoromethylketone (Z-VAD), malonaldehyde (MDA) assay kit, total superoxide dismutase (SOD) assay kit, catalase (CAT) assay kit and Annexin V-FITC apoptosis detection kit were obtained from Beyotime Biotechnology (China). All the other reagents, unless otherwise stated, were from Beyotime Biotechnology (China).
The fluorescent probe DCFH-DA was used to monitor intracellular accumulation of ROS. Briefly, 1 mL DCFHDA solution (10 lM) was added to the 24-well tissue plates, then incubated at 37 °C for 30 min. Cells were washed three times with PBS and finally, the fluorescence intensity was viewed under confocal microscopy (Olympus Fluoview-10). Measurement of Mitochondrial Membrane Potential The mitochondrial membrane potential (DWm) was measured using rhodamine 123. Rhodamine 123 can enter the mitochondrial matrix and cause photoluminescent quenching that is dependent on mitochondrial transmembrane potential. Treated-cells were incubated with 5 mg/L rhodamine 123 for 30 min at 37 °C in the dark and washed three times with PBS. Fluorescence emission intensity was viewed under fluorescence microscope (Olympus).
Cell Culture and Treatment
Assay of Oxidative Biochemical Parameters
Rat pheochromocytoma (PC12) cells obtained from Chinese Academy of Sciences were grown in RPMI1640, supplemented with 7 % fetal bovine serum, 13 % horse serum and 1 % antibiotic mixture comprising penicillin– streptomycin, in a humidified atmosphere at 37° with 5 % CO2. PC12 cells were treated with or without forsythiaside for 6 h or with or without NAC (1 Mm) for 30 min then exposed to H2O2 for 6 h or 24 h. For AIF and Eondo G assay, PC12 cells were treated with or without Z-VAD for 2 h, then with or without forsythiaside for 6 h, and exposed to H2O2 for 24 h.
Cells were homogenized in RIPA lysis buffer. The mixture was centrifuged at 12,000g for 30 min at 4 °C. The supernatant was collected and used for the experiments. The activities of SOD, CAT and the levels of MDA were determined by using commercially available colorimetric assay kits according to the manufacturer’s recommended protocol (Beyotime Biotechnology, China).
Measurement of Cell Viability Cell viability was determined by MTT reduction assay. Briefly, the dark blue formazan crystals formed in intact cells were solubilized in DMSO and the absorbance was determined at 570 nm using a microplate reader.
123
Western Blotting Analysis Total proteins, mitochondrial proteins, cytosolic proteins or nuclear proteins were extracted by using commercially available kits according to the manufacturer’s recommended protocol (Beyotime Biotechnology, China). The protein samples (30 lg) were separated by SDS-PAGE and electro-transferred onto polyvinylidene fluoride membranes. The blots were incubated with specific antibody (1:500 dilution for b-actin, AIF, Endo G and Nrf2; 1:250 dilution for cytochrome c, cleaved caspase-9/-3, Bax and
Neurochem Res (2015) 40:27–35 Table 1 Primers used for quantitative real-time PCR
29
Target gene (rattus norvegicus) Mn/SOD CAT b-actin
Gen Bank accession no.
Primer
Sequence(50 –30 )
PCR fragment length (bp) 245
NM
Forward
ACCGAGGAGAAGTACCACGA
001098153.1
Reverse
CCTGAACCTTGGACTCCCAC
NM
Forward
GGTAACTGGGACCTTGTGGG
012520.2
Reverse
TCCATCTGGAATCCCTCGGT
NM
Forward
GTGGATCAGCAAGCAGGAGT
031144.3
Reverse
AGGGTGTAAAACGCAGCTCA
204 96
Bcl-2). After rinsed in TBST, the blots were incubated with appropriate secondary antibodies conjugated to horseradish peroxidase. Immunoreactive band of proteins were detected by an enhanced chemiluminescence detection system, and the membrane was exposed to an X-ray film. Immunofluorescence Analysis Cells were plated on sterile glass coverslips in 24-well tissue plates and treated. The slips were rinsed three times in phosphate-buffered saline (PBS, pH 7.4) and fixed with 10 % neutral buffered formalin at room temperature for 20 min. After being rinsed in PBS and treated with 1 mM EDTA-Na2 (pH = 9.0) for 5 min in 95 °C. The cells were rinsed in PBS and treated with 0.1 % triton-100 for 10 min. The cells were then blocked with 5 % normal donkey serum for 30 min in a humidified box and then incubated with anti-AIF (1:50 dilution) or anti-Endo G (1:50 dilution) at 4 °C overnight. After the slides were rinsed three times in PBS and incubated with Cy3-conjugated donkey antigoat immunoglobulin G for 30 min. At last, they were rinsed with PBS, stained with Hoechst and viewed under confocal microscopy (Olympus Fluoview-10). Real-Time Fluorescent Quantitative PCR and PCR Analysis Total RNA was isolated from the cells using the TRIzol reagent according to the manufacturer’s instructions (Takara, Japan) and transcribed into cDNA using a reverse transcription kit (Takara, Japan). Primer Premier software (PREMIER Biosoft International, USA) was used to design specific primers for CAT, Mn/SOD and b-actin based on rattus norvegicus sequences (Table 1). RNA concentrations were detected by an RNA/DNA calculator produced by Pharmacia Biotech Company (Cambridge, UK). RNA concentrations were adjusted to the same level by 0.1 % sterile diethyl pyrocarbonate (DEPC). According to the measured concentrations, the volume of total RNA for reverse transcription was confirmed. Concentrations of cDNA in each group were then regulated. Relative expression contents of CAT or Mn/SOD mRNA were analyzed by 2-DDCt using the RT-PCR method.
Fig. 1 Chemical structure of forsythiaside
The computational formula was as follows: Amount of target ¼ 2DDCt DDCt ¼ ðCt CAT or Mn=SOD Ct b-actinÞ Time ðCt CAT or Mn=SOD Ct b-actinÞ Time 0: Data Analysis All data are represented as the mean ± S.E.M (Standard Error Mean). Comparison between groups was made by one-way analysis of variance (ANOVA) followed by an appropriate post hoc test to analyze the difference. The statistical significances were achieved when p \ 0.05 (*or #p \ 0.05, ** or ##p \ 0.01) (Fig. 1).
Results Effects of Forsythiaside and H2O2 on Cell Death To evaluate neuroprotective effect of forsythiaside, PC12 cells were treated with different doses of forsythiaside then exposed to H2O2 24 h. After 24 h, the cells were assayed for cell viability. As shown in Fig. 2a, pretreatment with forsythiaside dose-dependently protected PC12 cells against H2O2-induced cell damage. At these concentrations forsythiaside alone did not have any cytotoxic effect in PC12 cells. It has been reported that H2O2-induced cytotoxicity and apoptotic cell death are mediated by oxidative stress. As
123
30
Neurochem Res (2015) 40:27–35
Fig. 2 Effect of H2O2 and forsythiaside on cell damage. Cells were incubated 6 h with or without forsythiaside (1, 5, 10 lg/ml) or 30 min with or without NAC (0.5 mM, 1 mM) prior to H2O2 (150 lM) exposure for 24 h. a Protective effects of forsythiaside and NAC on H2O2-induced toxicity in PC12 cells by MTT assay. Data was expressed as a percentage of untreated controls. c Cells were incubated 6 h with or without forsythiaside (5 lg/ml) and 30 min
with NAC (1 mM) prior to H2O2 (150 lM) exposure for 24 h. Morphological evaluation by light microscopic observation (white scale bar stands for 10 lm). d Cell apoptosis was detected with Annexin V-FITC by flow cytometry. All experiments were repeated three times and one is presented. #p \ 0.05 or ##p \ 0.01, versus control group. *p \ 0.05 or **p \ 0.01, versus H2O2 treatment group
shown in Fig. 2a, H2O2-induced cytotoxicity and apoptotic cell death were also effectively suppressed by pretreatment with NAC (0.5 and 1 mM), a glutathione (GSH) precursor with strong antioxidant activity. Light microscopic observation was performed to investigate the effect of forsythiaside and H2O2 on cell death. As shown in Fig. 2b, exposure to H2O2 for 24 h caused heterogeneity in their shape. Pretreatment of cells with forsythiaside or NAC had alleviated these and prevented cell damage. Furthermore, phosphatidylserine expression (an indicator of apoptotic cells) on the cell membrane was detected by using Annexin V to confirm the effect of forsythiaside and H2O2 on cell apoptosis. H2O2 exposure increased the apoptosis rate from 4.30 to 24.52 % compared to the control, which was declined to 8.49 % by 5 lg/ml forsythiaside pretreatment and to 8.27 % by 1 mM NAC pretreatment (Fig. 2c).
Effects of Forsythiaside and H2O2 on Bax/Bcl-2 Ratio
Effects of Forsythiaside and H2O2 on ROS and MDA Generation To determine whether forsythiaside may attenuate cell death through reducing oxidative stress, the levels of ROS and MDA were measured. As shown in Fig. 3a, b, treatment of PC12 cells with H2O2 increased the levels of ROS and MDA, which both were effectively inhibited by forsythiaside pretreatment, dose-dependently.
123
Bcl-2 proteins are important regulators of cell apoptosis. Two members, Bcl-2 and Bax proteins were detected by Western blot. As shown in Fig. 4, H2O2 significantly upregulated Bax/Bcl-2 ratio compared to the control. However, forsythiaside pretreatment significantly decreased the ratio of Bax/Bcl-2. Effects of Forsythiaside and H2O2 on Mitochondrial Membrane Potential To investigate whether forsythiaside may attenuate cell death through stabilizing mitochondrial function, the mitochondrial membrane potential were measured. As shown in Fig. 3c, exposure to H2O2 depolarized the mitochondrial membrane potential (74.5 % loss of D Wm compared to control), which were effectively prevented by forsythiaside pretreatment. Effects of Forsythiaside and H2O2 on Cytochrome c Release and Caspases Activation Cytochrome c, caspase-9 and -3 are biomarkers of oxidative stress-induced cell death via mitochondrial-dependent apoptotic pathway. They were measured by Western blot. As shown in Fig. 4, compared to the control, H2O2 exposure significantly increased expression of cytosolic cytochrome
Neurochem Res (2015) 40:27–35
31
Fig. 3 Effect of H2O2 and forsythiaside on oxidative stress. Cells were incubated 6 h with or without forsythiaside (1, 5, 10 lg/ml) prior to H2O2 (150 lM) exposure for 6 h. a ROS was detected with DCFH-DA and the fluorescence intensity was calculated. b MDA was detected. c Cells were incubated 6 h with or without forsythiaside (1,
5, 10 lg/ml) prior to H2O2 (150 lM) exposure for 24 h. Mitochondrial membrane potential was detected with rhodamine 123. Data was expressed as a percentage of untreated controls. All experiments were repeated three times. #p \ 0.05 or ##p \ 0.01, versus control group. *p \ 0.05 or **p \ 0.01, versus H2O2 treatment group
c, cleaved caspase-9 and -3, namely, cytochrome c release and caspases activation. However, forsythiaside pretreatment was found to be effective to prevent H2O2-induced these events.
have been represented in Fig. 6d. Our study revealed that H2O2 treatment reduced the activities of CAT and total SOD, meanwhile, administration of forsythiaside kept the status of these enzymes nearly close to normal against H2O2 toxicity.
Effects of Forsythiaside and H2O2 on AIF and Endo G Translocation
Effects of Forsythiaside on LPS-Induced Cell Death and ROS Generation
We investigated whether the AIF and Endo G were involved in the protective effects of forsythiaside. Their translocation from mitochondria into the nucleus was detected by immunofluorescence. As shown in Fig. 5a, b, d, H2O2 exposure significantly induced AIF and Endo G translocation from the mitochondria into the nucleus, while forsythiaside pretreatment significantly prevented that. Furthermore, incubated with pan-caspase inhibitor Z-VAD, which significantly suppressed expression of cleaved caspase-3 (Fig. 5c), forsythiaside still protected against H2O2induced cell death and AIF and Endo G translocation.
LPS induces several endogenous ROS sources (NADPH oxidases, XOR, iNOS, COX-2) that are promising targets in many neurological diseases, the protective effect of forsythiaside was also tested in the LPS-treated cells. As shown in Fig. 7a, MTT assay showed that forsythiaside effectively protected against LPS-induced cell damage. Moreover, the results of ROS measurement indicated that forsythiaside had an inhibiting effect on oxidative stress caused by LPS exposure (Fig. 7b).
Effects of Forsythiaside on Nuclear Levels of Nrf2
Discussion
Nrf2 has been recognized as a key transcription factor against oxidative damage. We investigated whether forsythiaside has effects on Nrf2. The nuclear content of Nrf2 in nuclear proteins was detected by Western blot. As shown in Fig. 6a, b, forsythiaside treatment significantly increased nuclear expression of Nrf2 after 6–48 h treatment, and the highest level of Nrf2 appeared in 24 h treatment.
Forsythiaside increased PC12 cell viability and showed a significant protective effect against H2O2-induced cell damage when measured by MTT assay. In addition, treatment with forsythiaside significantly protected against H2O2-induced PC12 cell apoptosis, as detected by Flow cytometric analysis of apoptosis. The cells exposed to H2O2 exhibited a distinct increase in the percentage of apoptotic cells, which is representative of programmed cell death. However, when PC12 cells were pretreated with forsythiaside, a dramatic reduction in the amount of apoptotic cells was observed. Taken together, these results suggested that forsythiaside protected against H2O2induced apoptosis. Oxidative stress is involved in the death of neurons and leads to the apoptosis in many neurological diseases [13]. H2O2 is an inducer of oxidative stress in vitro [14]. H2O2 can induce apoptosis in many different cell types which
Effects of Forsythiaside on Antioxidative Enzymes The mRNA levels of CAT and Mn/SOD were measured by Q-PCR, as shown in Fig. 6c. Compared to the control group, forsythiaside treatment significantly increased the mRNA levels of CAT and Mn/SOD, which was consistent with Nrf2 activation. The effects of forsythiaside on activities of antioxidant enzymes, namely, SOD and CAT against H2O2 toxicity
123
32
Neurochem Res (2015) 40:27–35
Fig. 4 Effect of H2O2 and forsythiaside on Bax/Bcl-2 ratio, cytochrome C release, caspases activation. Cells were incubated 6 h with or without forsythiaside (1, 5, 10 lg/ml) prior to H2O2 (150 lM) exposure for 24 h. a Expression of Bax and Bcl-2, mitochondrial cytochrome C (Mito cyt C), cytosolic cytochrome C (Cyto cyt C), procaspase-9, caspase-9, procaspase-3, caspase-3 were measured by Western Blot, b and their ratios to b-actin were calculated. All experiments were repeated three times and one is presented. #p \ 0.05 or ##p \ 0.01, versus control group. *p \ 0.05 or **p \ 0.01, versus H2O2 treatment group
may be inhibited by antioxidants [15]. Excessive ROS and lipid peroxidation are major indicators of oxidative stress. In PC12 cells, H2O2 induces overproduction of intracellular ROS and MDA, and inhibiting them is thought to be protective against H2O2 cytotoxicity [16, 17]. From our study, forsythiaside was found to be effective in decreasing H2O2induced oxidative stress and protected PC12 cells from cytotoxicity. From our study, a significant increment of Bax/Bcl-2 ratio was detected in H2O2-treated cells, while it was reduced in forsythiaside-pretreated groups. Bax and Bcl-2 are important regulators participating in mitochondrial apoptotic pathway [18]. In addition to the induction of mitochondrial permeability transition pore (MPTP) by ROS, increased Bax/Bcl2 ratio can also directly induce MPTP, leading to the release of cytochrome c (cyt C) along with other proapoptotic proteins such as AIF and Endo G [19]. Once released, cyt C forms an oligomeric complex with dATP and Apaf-1 [20], followed by recruitment of procaspase-9 and its activation. The active caspase-9 then activates effector caspases, such as caspase-3, -6 and -7 [21]. We detected significant increased Bax/Bcl-2 ratio, mitochondrial membrane potential decrease, cyt C release, caspase-9/-3 activation in H2O2-treated groups compared to the control, indicating activation of mitochondria
123
apoptotic pathway by H2O2. However, these were all attenuated by forsythiaside pretreatment, suggesting that forsythiaside was able to inhibit mitochondria-dependent apoptosis caused by H2O2. AIF and Endo G are caspase-independent apoptosis effectors released from mitochondria induced by MPTP [22]. They released from mitochondria and translocated into the nucleus, then triggered apoptosis by condensing its chromosomes and fragmenting DNA molecules. We found significant translocation of AIF and Endo G triggered by H2O2 exposure, which was prevented by forsythiaside pretreatment. To further confirm the inhibiting effects of forsythiaside on caspase-independent apoptosis, Z-VAD (a pan-caspase inhibitor) was used. When incubated with Z-VAD, H2O2-induced caspase-3 activation was inhibited, while AIF and Endo G were not affected. Under this circumstance, forsythiaside still protected against H2O2induced cell death, indicating inhibition of AIF and Endo G was involved in the anti-apoptotic effects of forsythiaside. To further elucidate the upstream regulators for the induction of endogenous antioxidant defense enzymes against oxidative stress, we have focused on the Nrf2 signaling pathway. Nrf2 is a member of the cap ‘n’ collar family of basic leucine zipper proteins. It is known as the primary transcription factor responsible for initiating the
Neurochem Res (2015) 40:27–35
33
Fig. 5 Effect of H2O2 and forsythiaside on translocation of AIF and Endo G. Cells were pre-incubated 2 h with Z-VAD, then treated 6 h with or without forsythiaside (5 lg/ml), and later exposed to H2O2 (150 lM) for 24 h. The expression of AIF, Endo G and caspase-3 were measured by Western Blot. b and c Their ratios to b-actin were
calculated. d Intracellular localization of AIF and Endo G was detected by immunofluorescence (white scale bar stands for 10 lm). All experiments were repeated three times and one is presented. #p \ 0.05 or ##p \ 0.01, versus control group. *p \ 0.05 or **p \ 0.01, versus H2O2 treatment group
Fig. 6 Effect of forsythiaside on Nrf2 activation and anti-oxidative enzymes. Cells were incubated with forsythiaside (5 lg/ml) for 0, 1, 6, 12, 24, 36 or 48 h. a The nuclear levels of Nrf2 were measured by Western Blot, b and the ratios to b-actin were calculated. c The mRNA levels of Mn/SOD, CAT and was detected by Q-PCR. d Cells
were incubated 6 h with or without forsythiaside (1, 5, 10 lg/ml) prior to H2O2 (150 lM) exposure for 24 h. The activities of SOD and CAT were measured. All experiments were repeated three times and one is presented. *p \ 0.05 or **p \ 0.01, versus control group. #p \ 0.05 or ##p \ 0.01, versus H2O2 treatment group
response to oxidative stress [23]. Normally, Nrf2 translocates into the nucleus where it binds DNA at a consensus sequence known as the antioxidant or electrophilic
response element. In this way, Nrf2 regulates transcription of a large group of detoxification genes, among which are the subunits of glutamate cysteine ligase (GCL), the rate-
123
34
Neurochem Res (2015) 40:27–35
Fig. 7 Effects of LPS and forsythiaside on cell death and ROS generation. a Cells were incubated 6 h with or without forsythiaside (1, 5, 10 lg/ml) prior to LPS (2 lg/ml) exposure for 24 h. Cell viability was assessed by MTT assay. b Cells were incubated 6 h with
or without forsythiaside (1, 5, 10 lg/ml) prior to LPS (2 lg/ml) exposure for 6 h. ROS was detected with DCFH-DA and the fluorescence intensity was calculated. Data was expressed as a percentage of untreated controls
limiting enzyme in GSH biosynthesis. Activation of Nrf2 is thought to be neuroprotective in PC12 cells [24, 25]. From our study, forsythiaside significantly induced Nrf2 activation, as revealed by the increased nuclear Nrf2 levels. It seems that forsythiaside protects PC12 cells against oxidative stress via induction of the Nrf2 pathway. This was further confirmed by evaluating the gene expressions and activities of antioxidant enzymes (Mn/SOD, CAT), which are considered to be up-regulated through the activated Nrf2 signaling pathway to potentiate the endogenous antioxidant defense system for ROS eliminated [26]. Taken together, these data demonstrated that forsythiaside provides protective effects against H2O2-induced neuronal cell death through multiple mechanisms. Forsythiaside pretreatment not only reduced ROS overproduction and lipid peroxidation, but also attenuated subsequent activation of apoptosis. Its antioxidative effects might be associated with induction of the Nrf2 pathway. Moreover, the antioxidative properties of forsythiaside test were also tested in LPS-treated cells. Forsythiaside was proved to be effective to prevent LPS-induced cell death and ROS generation. In addition, forsythiaside was proved to have rapid distribution and slow elimination in vivo [27]. Forsythiaside might be promising therapeutic drug for the treatment of neurological diseases.
potential biomarkers for Alzheimer’s disease. J Neural Transm Suppl 72:207–215 Turunc Bayrakdar E, Uyanikgil Y, Kanit L, Koylu E, Yalcin A (2014) Nicotinamide treatment reduces the levels of oxidative stress, apoptosis, and PARP-1 activity in Abeta(1-42)-induced rat model of Alzheimer’s disease. Free Radic Res 48:146–158 Halliwell B, Aruoma OI (1991) DNA damage by oxygen-derived species. Its mechanism and measurement in mammalian systems. FEBS Lett 281:9–19 Heilmann J, Merfort I, Weiss M (1995) Radical scavenger activity of different 30 ,40 -dihydroxyflavonols and 1,5-dicaffeoylquinic acid studied by inhibition of chemiluminescence. Planta Med 61:435–438 Wang HM, Wang LW, Liu XM, Li CL, Xu SP, Farooq AD (2013) Neuroprotective effects of forsythiaside on learning and memory deficits in senescence-accelerated mouse prone (SAMP8) mice. Pharmacol Biochem Behav 105:134–141 Qu H, Zhang Y, Wang Y, Li B, Sun W (2008) Antioxidant and antibacterial activity of two compounds (forsythiaside and forsythin) isolated from Forsythia suspensa. J Pharm Pharmacol 60:261–266 Cheng G, Zhao Y, Li H, Wu Y, Li X, Han Q, Dai C, Li Y (2014) Forsythiaside attenuates lipopolysaccharide-induced inflammatory responses in the bursa of Fabricius of chickens by downregulating the NF-kappaB signaling pathway. Exp Ther Med 7:179–184 Zhou L, Yang H, Ai Y, Xie Y, Fu Y (2014) [Protective effect of forsythiaside A on acute lung injure induced by lipopolysaccharide in mice], Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi 30:151–154 Kim JM, Kim S, Kim DH, Lee CH, Park SJ, Jung JW, Ko KH, Cheong JH, Lee SH, Ryu JH (2011) Neuroprotective effect of forsythiaside against transient cerebral global ischemia in gerbil. Eur J Pharmacol 660:326–333 Naoi M, Maruyama W, Yi H, Inaba K, Akao Y, Shamoto-Nagai M (2009) Mitochondria in neurodegenerative disorders: regulation of the redox state and death signaling leading to neuronal death and survival. J Neural Transm 116:1371–1381 Satoh T, Sakai N, Enokido Y, Uchiyama Y, Hatanaka H (1996) Free radical-independent protection by nerve growth factor and Bcl-2 of PC12 cells from hydrogen peroxide-triggered apoptosis. J Biochem 120:540–546 Jang JH, Surh YJ (2001) Protective effects of resveratrol on hydrogen peroxide-induced apoptosis in rat pheochromocytoma (PC12) cells. Mutat Res 496:181–190 Benedi J, Arroyo R, Romero C, Martin-Aragon S, Villar AM (2004) Antioxidant properties and protective effects of a standardized extract of hypericum perforatum on hydrogen peroxideinduced oxidative damage in PC12 cells. Life Sci 75:1263–1276 Hong H, Liu GQ (2004) Protection against hydrogen peroxideinduced cytotoxicity in PC12 cells by scutellarin. Life Sci 74:2959–2973
Conflict of interest of interest.
The authors declare that there are no conflicts
References 1. Al-Ayadhi LY (2004) Oxidative stress and neurodegenerative disease. Neurosciences (Riyadh) 9:19–23 2. Zawia NH, Lahiri DK, Cardozo-Pelaez F (2009) Epigenetics, oxidative stress, and Alzheimer disease. Free Radic Biol Med 46:1241–1249 3. Simon HU, Haj-Yehia A, Levi-Schaffer F (2000) Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 5:415–418 4. Leuner K, Pantel J, Frey C, Schindowski K, Schulz K, Wegat T, Maurer K, Eckert A, Muller WE (2007) Enhanced apoptosis, oxidative stress and mitochondrial dysfunction in lymphocytes as
123
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Neurochem Res (2015) 40:27–35 18. Martinou JC, Youle RJ (2011) Mitochondria in apoptosis: Bcl-2 family members and mitochondrial dynamics. Dev Cell 21:92–101 19. Jacotot E, Costantini P, Laboureau E, Zamzami N, Susin SA, Kroemer G (1999) Mitochondrial membrane permeabilization during the apoptotic process. Ann NY Acad Sci 887:18–30 20. Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES, Wang X (1997) Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91:479–489 21. Earnshaw WC, Martins LM, Kaufmann SH (1999) Mammalian caspases: structure, activation, substrates, and functions during apoptosis. Annu Rev Biochem 68:383–424 22. Tu WC, Wu CC, Hsieh HL, Chen CY, Hsu SL (2008) Honeybee venom induces calcium-dependent but caspase-independent apoptotic cell death in human melanoma A2058 cells. Toxicon 52:318–329
35 23. Vomhof-Dekrey EE, Picklo MJ Sr (2012) The Nrf2-antioxidant response element pathway: a target for regulating energy metabolism. J Nutr Biochem 23:1201–1206 24. Um HC, Jang JH, Kim DH, Lee C, Surh YJ (2011) Nitric oxide activates Nrf2 through S-nitrosylation of Keap1 in PC12 cells. Nitric Oxide 25:161–168 25. Li HY, Wu SY, Shi N (2007) Transcription factor Nrf2 activation by deltamethrin in PC12 cells: involvement of ROS. Toxicol Lett 171:87–98 26. Boesch-Saadatmandi C, Loboda A, Jozkowicz A, Huebbe P, Blank R, Wolffram S, Dulak J, Rimbach G (2008) Effect of ochratoxin A on redox-regulated transcription factors, antioxidant enzymes and glutathione-S-transferase in cultured kidney tubulus cells. Food Chem Toxicol 46:2665–2671 27. Li YX, Peng C, Zhang RQ, Li X, Jiang XH (2009) Pharmacokinetics of phillyrin and forsythiaside following iv administration to Beagle dog. Eur J Drug Metab Pharmacokinet 34:79–83
123
