Molecular Microbiology (1992) 6(19), 2777-2784

Frameshifting in the expression of the Escherichia coii trpR gene Itai Benhar, Chaya Miller and Hanna EngelbergKulka* Department of Molecular Biology. Hebrew University. Hadassah Medical School, Jerusalem. 91010 Israel. Summary The trpR gene of Escherichia coli carries an open reading frame that encodes the trp repressor, 108 amino acids long. Here we show that translation of an additional (+1) reading frame of trpR occurs both in vivo and in vitro. This results in the synthesis of a stable + 1 frame polypeptide. Using site-specific mutagenesis, immunological techniques and amino acid sequencing we have found that the fV-terminus of the -1-1 frame product and that of the known 0 frame product are identical but that their C-termini differ. Our results are discussed in relation to the role of natural frameshifting as a regulatory mechanism of gene expression in general, and with respect to tryptophan biosynthesis in particular.

Introduction The genetic code is read, three bases at a time, from a fixed point of reference on the mRNA. The choice of the reading frame is believed to be determined by the proper positioning of the ribcsome relative to the initiation site. However, the genetic code, once thought to be rigid, was recently found to be quite flexible (for a review see Engelberg-Kulka and Schoulaker-Schwarz, 1988; Parker, 1989; Atkins et ai, 1990). One aspect cf this flexibility is that a normal tRNA may sometimes read an mRNA in a frame shifted forwards or backwards from the reading frame of the initiation codon (Craigen and Caskey, 1986; Varmus, 1988; Parker, 1989; Atkins ef a/., 1990). Such an event is called normal frameshifting and it seems to be programmed by the sequence of the mRNA and sometimes also by its structure (Parker, 1989; Atkins et ai, 1990). Normal frameshifting provides a mechanism of gene expression that permits the synthesis of two different proteins from two separate reading frames of a single sequence of an mRNA molecule. Most examples of normal frameshifting have been found in prokaryotic and

eukaryctic viral genes (Varmus, 1988; Parker, 1989). Until now, only two examples of a cellular gene expressed by such a mechanism have been described in detail in the literature. The first was the Escherichia ccli prfB gene coding for protein release factor 2 (RF2) (Craigen and Caskey, 1986; 1987). The second example is the £ coii dnaX gene which codes for subunits T and 7 of DNA polymerase III (Blinkowa and Walker, 1990; Flower and McHenry. 1990; Tsuchihashi and Kornberg, 1990). Here we describe a third cellular gene whose expression involvesa +1 frameshifting event, i.e. theE. co//frpftgene which codes for the trp repressor protein. The E coli trp repressor regulates the transcription initiation of four operons involved in transport and biosynthesis of tryptophan: trpEDCBA (Rose et ai, 1973), aroH(Zurawskiefa/., 1981), mfr(HeatwoleandSomerville, 1991) and frpf? (Gunsalus and Yanofsky, 1980; Bogosian etai., 1981). The repressor polypeptide is 108 amino acids long and is encoded by an open reading frame of the trpR gene, 324 nucleotides long, spanning from position 57 to position 381 of the gene (Fig, 1A and Gunsalus and Yanofsky, 1980). We noticed that there are six consecutive adenine (A) residues between positions 269 and 274 of the trpR gene. Based on early reports of Atkins et ai (1979) and Beremand and Blumenthal (1979) that such a site may be involved in frameshifting, we hypothesized that the homopolymeric run of six A residues in trpR might permit a +1 frameshift resulting in the synthesis of a +1 frameshift product (Fig. 1B). The product of the trpR frame 0, which ends at position 384, is 108 amino acids long. In contrast, the putative +1 product is likely to be shorter: we expected it to be only 88 amino acids long and to end at the UGA codon at position 324. Both polypeptides should start at the same initiation site, position 57-59, and should be identical for the length of the 71 W-terminal codons. Their C-termini should differ. Here we report that a +1 frameshifting mechanism is involved in the expression of the trpR gene. This +1 frameshifting event results in the synthesis of a polypeptide whose W-terminus is identical with that of the known 0 frame product of the gene, but their length and C-termini are different.

Results Studies o/trpR frameshifting us/ng trpR-lac'Z fusions

Received 27 April, 1992; revised 8 June, 1992; accepted 15 June, 1992. •For correspondence, Tel. (2) 428250; Fax (2) 784010.

In order to test whether frameshifting Is really involved in

2778

/. Benhar, C. Miller and H. Engelberg-Kuika

ProMter -—I—ATTATGGCC 0 57 I I

polfpeptide

(108 aaino acids).

B. »eer -ATTATGGCC 57 I I

n

Fig. 1. Schematic diagram of the trpR open reading frame showing the corresponding trame 0 product and the putative +1 frameshift product. A. trpFt and the 0 frame polypeptide (Gunsalus and Yanofsky 1980), The hatched regions here and in (B) represent the polypepfide region against which antibodies were prepared. The numbers below the sequence here and in (B) represent the position of fhe nucleotide in trpR. the first digits of the numbers are below the con-esponding nucieotide, B. trpR and the putative +1 frameshift polypeptide as suggested in this paper. The sequences of the peptides against which antibodies were prepared are as follows (in single-letter code): the first 14 amino acids of trpR frame 0: MAOOSPYSAAMAEQ; the last 16 amino acids of trpR frame + 1: MNSAQASRRLRVDLTA.

1 polrpeptide

(88 aalao

acids).

trpR gene expression, an experimentai system was constructed in which we used the E. coii lac'Z gene as a reporter gene for trpR frameshifting. We fused the trpR gene in each of its - 1 , 0, and -i-i reading frames to the 10th codon of the lac 'Z gene (Figs 2 and 3). The lac Z gene was fused at position 294 of the frpff gene. The trpR-iac'Z fusions having 0, + 1 , and - 1 reading frames were designated trpRo-lac'Z, frp/?+i-/ac'Z and trpR-^-lac'Z respectively. The ievel of gene expression due to frameshifting was determined by comparing the ievel of in vivo p-galactosidase activity of the fusion product in the appropriate frame with that of the fusion product in the 0 reading frame of trpR. Table 1 shows the level of p-galactosidase activity resulting from translation in each of the three frames of trpR, in the two E. coli strains tested. In both, the trpRo-lac'Z had the highest level of activity. We detected no activity for the frpfl-i-/ac'Z fusion product. However, we did detect some p-galactosidase activity for the trpR+^i-lac'Z fusion product: the p-galactosidase activity in the +1 frame was 2.7-6.6% relative to that of the 0 frame. The experiments reported in Table 1 were carried out with the frpf?-/ac'Zfusions illustrated in Fig. 3, where the trpR fusion point is at position 294 of the gene. Similar results were obtained with other frpfi-/ac'Zfusions where the fusion points in the three frpRframes were at positions 307 or 309. In addition, simultaneously reducing the copy number of the trpR^-lac'Z and trpR+^-lac'Z fusions did not affect the relative ratio of p-galactosidase activities directed by these fusions (data not shown). This was done by placing the frpRo-/ac'Zand frpfl+i-/ac'Zfusions (Fig. 3) on plasmids of low copy number (instead of on pBR322 derivatives), or inserting them into the bacterial chromosome in a single copy on a X prophage. We also confirmed that the strains used in this study were phenotypically frameshift suppressor-free by showing that they were unable to suppress phage T4rll frameshift mutations described by Ripley and Clark (1986) (data not shown).

The results with the ^rpR-/ac'Zfusions reported here show that the trpRqene is translated in the 0 and H-I frames and not in the - 1 frame. This suggests that H-I frameshifting occurs during the expression of the trpR gene in vivo. To verify that both frpff-/ac'Zproducts are synthesized from the same initiation site, we used plasmids plB13 and

EcoRI

SamHI Rsa\

Nru\ Rsa\ BamHl I I

SamHI pHEK

pCM64 T7 promoter

plB14 lacZ

pBR322

IrpR

T7 DNA

XDNA

iac'Z

Ftg. 2. Schematic diagram of the trpfl-carrying plasmids used in this study. The uppermost plasmid is ptrpR3 (Roeder and Somerville, 1979) which was the source of trpR ONA for subcloning. The plasmids below ptrpR3 are: pHEK with trpR under the AP^ promoter, pCM64 with trpR under the T7 promoter, and plB14, which is a f/pR^,-tec Zfusion plasmid. All these plasmids are pBR322 derivatives. The restnction sites in trpR used to subclone it into each of these plasmids are indicated above it. The bacterial and plasmid source of each region in the constructs are shown at the bottom of the figure.

trpR frameshifting

A. frame

0

i

123456

.TGAGCCAGCGTGAGTTAAAAAATGAACTCGGCGCAGGCATCGCGGATCCC

trpR

frame

10th codon GTC

+1 : 123456

CrpR

lac'2 10th codon .tEGaSCCAGCGTGAGiHSZlAAAATGAACTCGGCGCAGGCATCGGGGGATCCC GTC trpR

frame

-1

trpR 123456 .TGAGCCAGCGTGAGTTAAAAAATGAACTCGGCGCAGGCATCGCGCGGATCCC

10th codon GTC

B. 0 frame - lac'Z fusion; lar '7. Mrul a^ RamHT 10th codon . . .GCATCGICGIGATCCC f GTC IPolylinker trpR +1 frame - lac'Z fusion: lac'Z Wrul/Smal 10th codon ...GCATCGIGGGGATCCO GTC

2779

Fig. 3. Sequences of frpR-^ac'Zfusions in reading frames - 1 , 0 and +1 of the trpR gene. A. General repfesentation of the constructed f/pff-/ac'Z fusions. The Nru\ cut at position 294 of trpR is marked by a vertical arrow. The region to the left of this an'ow is part of the trpR gene (Gunsalus and Yanofsky, 1980). The region between the vertical arrow and the 10th codon of /ac'Z includes the pSKIOpotylinker. with (frames 0 and -1) or without (frame +1} OamHI linkers. —...— below the sequence represenfs the normai frame 0 of trpR. ---...— above the sequence represents the open reading frame resulting from the postulated +1 frameshifting. The six consecutive adenine residues at trpR positions 269-274 are numbers 1-6. The last two +1 frame stop codons at trpR positions 253-255 and 268-270 are boxed. B. Detailed diagram of the f/pR-/ac'Zjunctions. The polylinkers used to construct the fusions of frpW to/ac'Zin three frames are shown. The junction nucleotides which are not in the trpRo frame are circled. Other symbols are as in (A). a. 8-mer SamHI linker sequences (following SamHI cleavage) are shown. b. 12-mer SamHI linker sequences (following SamHI cleavage) are shown.

IPolylinker r.rpR -1 frame - lac. • z fusion: trpR

\,^Q ' Z

1 2 " BamHI 10th COdon . . . GCATCG I CGCG I GATCty |GTC IPolyiinker

plB14 in which we changed the trpR initiation codon at position 57-59 from ATG to ATC by oligonucleotide-directed, site-specific mutagenesis, creating piasmids plB16 and pIBI 7, respectively (Tabie 2). As shown in Table 3, the change in the initiation codon from ATG to ATC completely inhibited translation of both fusions. We also excluded the possibility that the +^ product of trpR results from an internal initiation at an ATG codon located at position 274-276 in the +1 frame of the gene. As shown in Table 3, changing this internal ATG to either CTG (on plasmids pIBI 8 and plB19) or to ATC (on plasmids plB20 and plB21) did not affect the level of trpR translation in either the 0 or the +1 reading frames. Finally, we confirmed, by direct amino acid sequencing (Yarwood, 1989) of the W-terminus of the (rpR+i-/ac'Zfusion product, that the trpR^-i-iac'Z fusion and the trpR^-iac'Z \us\ou are translated from the same initiation codon. In this expenment, the 10 W-terminal amino acids of the frpft.n-/ac'Z fusion product were found to be identical to those of the trpR frame 0 product, the known trp repressor (Fig. 4).

Identification of the trpR gene transiation produets in vivo The frpR frame 0 product is 108 amino acids long (Fig. i) and migrates as a polypeptide of 12000 daltons in

SDS-polyacrylamide gels (Gunsalus and Yanofsky, 1980; Paluh and Yanofsky, 1986). On the other hand, we predicted that the product of the putative +1 frameshift of the frpR gene would be only 88 amino acids long (Fig. 1B) and would migrate as a polypeptide of 10000 daltons. Therefore, we would expect these polypeptides to be separable by gel migration. We studied the in vivo synthesis of trpR products and their stability in a pulsechase experiment when the trpR gene was under the control of a T7 promoter on plasmid pCM64 (see Fig. 2 and

Table 1. Expression of frpff-/ac'Zfusions in three frames of trpR. p-Galactosidase Activity (Units) trpR frame: +1

Strain SP361 W3nO

3667 ± 470 3816 ± 190

244 ± 18 108+7

-1

6.6 2.7

The fusions of trpR in three frames with /ac'Z were located on plasmids plB13. plB14 and plB15 (Table 2). Experiments were done in two !i.lac trpR E. co;/strains: SP361 and W3110 (Table 2). Cells were grown at 37''C in M9 minimal medium and p-galactosidase was determined as descnbed in the Experimental procedures. Activity is according in Miller Units (Miller, 1972) ± the standard deviation. a. '%' is per cent activity of trpR. ,-lac'Z fusion product relative to the activity of the trpRa-lac 'Z fusion product.

2780

/. Benhar, C. Miller and H. Engelberg-Kulka 1 2 3 4 5 6 7 8 9 10 H A O O S P Y S A A H AUGGCCCAACAAUCACCCUAUUCAGCAGCGAUG

Table 2. Strains, bacteriophage and plasmids. Strain/Phage/ Plasmid

Ala

Gin 2,3

1,8,9

MC4100 W3110

Pro

O

Source/ Comments

Aiac M25, nalR. supF. MserB, f/pfl)37-1 MargF. lac)U169. rpsL150 tna , AtrpED24. iac~ ::Tn 10

Bogosian et al. (1981) CGSC" #6152 Berirand ef ai. (1976) PI transduction

Strain Escherichia coii SP361

Ser

Relevant genotype and characteristics

oilac ::Jn10

5

from MC4100

20

Bacteriophage

E

m3trpR

frpR in M13mp18

This work

ptrpR3

1.25kb eamHI frpflfragment in pBR322

pKC30

pBR322 wrth XPL containing DNA fragment

pHEK

pKC30 with trpR under KPL pHEK with mutation ATG->ACC in trpR initiation codon /acZ fusion vector

Roeder and Somerville (1979) Sfiimatake and Rosenberg (1981) via M. Belfort This work This work

Plasmid

Met 10

nnnn

n n n n n n

PHEKACC

Cycle Fig. 4. Predicted and determined amino acid sequence of the W-terminus of the trpR, ,-iac'Z fusion product. A. The sequence of the 10 W-terminus of the trpR. ,-iac'Z product predicted by us from the coding nucleotide sequence (Gunsalus and Yanofsky, 1980) is shown. The amino-terminal formyl-methionine (which is cleaved in vivo from the trp repressor) cannot be analysed by Edman chemistry. B, The amino acid sequence determined for the 10 W-terminal amino acids of the f ^ f l , r - / a c ' Z fusion product is shown. The trpR,^-lac'Z fusion protein was isolated and subjected to sequence analysis and data were collected from an Applied Biosystems 475A protein sequencer as described in the Experimsntai procedures. Histograms of relevant PTHamino acids through 10 cycles of Edman degradation (Yarwood, 1989) are shown with the major amino acid present in each cycle (black bars) indicated above the histogram.

PMC1403 pSKIO plB13 plB14 plB15 plB16

plB17

plB18

plB19

the Experimental procedures). As shown in Fig. 5A, expression of the trpR gene from the T7 promoter resulted in the production of two polypeptides: a major polypeptide of 12000 daltons as expected for the trpR 0 frame product, and an additional minor polypeptide of 10000 daltons (lane 1). Both polypeptides remained stable for 30 min after ohase (lane 2). The control plasmid pT7-5 (without trpR) did not direct the synthesis of either of these polypeptides (lanes 3 and 4). Identification of the trpR gene transiation products in vitro We also studied trpR translation in an £ coii in vitro transcription-translation system, when the template for the trpR gene was under the control of the strong kPi

plB20

plB21

pGP1-2

Partial .Ai/al deletion derivative of pMC1403 (iacr) trpRa-lac'Z fus\on &pR,i-/ac'Z fusion trpR i-/ac'Z fusion plB13 derivative with mutation G-^C in trpR initiation codon plB14 derivative with mutation G-^C in trpR initiation codon ptB13 derivative with mutation A—-C in trpR position 274 plB14 derivative with mutation A—C in trpR position 274 plB13 derivative with mutation G—>C in trpR position 276 plB14 derivative with mutation G—-C in trpR position 276 Expresses T7 RNA polymerase

pT7-5

17 promoter expression vector

pCM64

pT7-5 with trpR under the T7 promoter

a. E. coli Genetic Stock Center, Yale University, USA.

Oasadaban e/a/. (1982) This work This This This This

work work work work

This work

This work

This work

This work

This work

Tabor and Richardson (1985) Tabor and Richardson (1985) This work

trpR frameshifting

2781

of trpR on this plasmid. Since a change from ATG to ACC completely inhibited translation in both 0 and +1 frames, it is further confirmed that both trpR products are translated from the same initiation codon.

IIKHMI

1 2

3

4

I2II00

I

3

4

Fig, 5. In vivo and in vitro translation products of the trpR gene. A. in vivo translation products of trpR and their stability are shown. E. coii K38 cells were transformed with plasmids pGPI -2 and either pCM64 (lanes 1 and 2) or pT7-5 (lanes 3 and 4). Expression from the 17 promoter was induced and the cells were labelled with (^S]-methionine for 5 min following the addition of rifampicin (lanes 1 and 3). An excess of unlabelled methionine was added and the reaction was terminated after an additional 30 min (lanes 2 and 4). B. in vitro translation products of the trpR gene. Plasmids pHEK (lanes 1 and 2) and PHEKACC (lanes 3 and 4) were used as templates in an E. coli in vitro transcription-translation system. The synthesized proteins were labelled with p^S]-methionine and immunoprecipitated with antibodies against the first 14 amino acids of the trpR product (lanes 1 and 3) or with antibodies against the last 16 amino acids of the +1 frame C-terminus (ianes 2 and 4). The sequences of the peptides against which the antibodies were prepared are given in the legend to Fig. 1. Samples were separated by tncine/SDS-PAGE and visualized by autoradiography as described in fhe Experimentai procedures.

promoter on plasmid pHEK (Fig. 2 and Table 2). In these experiments the trpR products were separated by gel migration and identified by their immunological specificities. For this purpose we used antibodies prepared against two different domains of the polypeptides (Fig. 1): (i) the first 14 amino acids, a common domain of the two polypeptides according to our model; and (ii) the last 16 amino acids of the +1 frame which, according to our model, are not common to the two polypeptides. The first antibody should react with both 0 and -i-1 frame products, while the second should react only with the +1 frame product. The results are shown in Fig. 5B. The sample immunoprecipitated with antibodies against the common /V-termini of the polypeptides migrated as two bands: a major band of 12000 daltons, and a minor band of 10000 daltons (lane 1). On the other hand, the sample immunoprecipitated with antibodies against the C-terminus of the putative +1 frame polypeptide migrated as a single 10 000 dalton band (lane 2). In addition, when plasmid PHEKACC was added to the extracts in place of pHEK, there were no equivalent radioactive bands in the gels (lanes 3 and 4). Plasmid PHEKACC carries the trpR gene, whose initiation codon was mutated, thus preventing translation initiation

Discussion The £ coli trpR gene carries an open reading frame of 324 nucleotides that encodes the trp repressor, 108 amino acids long (Fig. 1 and Gunsalus and Yanofsky, 1980). Here we have shown that a second +1 reading frame is also translated. As a result, an additional 10000 dalton +1 product is synthesized which is shorter than the frame 0 product of 12 000 daltons (Fig. 5). We have concluded that the trpR -)-1 frameshift product has the same amino acid composition at its A/-terminus as the ^rpRframe 0 product, but differs from it in its C-terminus. We have based our conclusion on three lines of evidence, (i) We have shown that the products of trpR in the 0 and -f1 frames are translated from the same initiation site; a change from ATG to ATC (Table 3) or ACC (Fig. 5B) in the initiation codon of trpR completely inhibited translation in both 0 and -t-1 reading frames, (ii) Antibodies against the A/-terminus of the frame 0 product of trpR reacted with both the product of frame 0 (120000 daltons) and with that of frame -t-1 (10000 daltons) (Fig. 5B). (iii) Direct amino acid sequencing revealed that the A/-termini of both the 0 and the -f1 products have the same amino acid sequence (Fig. 4). Furthermore, our experiments showed that the trpR frameshift product differs from the frame 0 product at its C-terminus; antibodies against the putative C-terminus of frame +1 reacted only with the 10000 dalton product of the +1 frame and not with the 0 frame product (Fig. 5B). In addition, our results suggest that the trpR +1 product has stability similar to that of the 0 frame product (Fig. 5A). Our experiments also revealed several other characteristics of the trpR frameshifting process. The change in the reading frame occurs exclusively in the -t-i direction. No frameshifting in the - 1 direction was detected (Table 1). The level of -•-1 frameshifting was determined by comparing relative p-galactosidase activities of trpRo-iac'Z and frpft+i-/ac'Z fusions. In the two E. coli strains tested, it was found to be in the range 2.7-6.6%. Since these strains were found by us to be frameshift suppressor-free, we assume that the described +1 frameshifting is a natural mechanism of the bacteria. This is further supported by our observation that the relative level of expression of the 0 and +1 frames of trpR does not change by reducing the copy number (data not shown). Our inspection of the trpR sequence revealed that the 4-1 frame of the gene contains multiple stop codons, the last two of which are shown in Fig. 3. Thus there is no +1 open reading frame upstream from position 269 of the gene, so that no +1 frameshift can occur upstream from

2782

/, Benhar, C. Miller and H. Engelberg-Kulka

Table 3. Effects of point mutations in the trpR gene on the in vivo translation of trpR-lac'Z fusionstrpR nucleotide^ wild type

mutation

ATG^°

ATC*^

2'*ATG

"*ATC

trpR expression " if frame +1

0 0

0

100 100

100 100

E. coli SP361 cells (Table 2) were transformed with plasmids carrying trpRfj-lac 'Zf usions (pIB 13) or trpR. ,-/ac'Zfusions (pIBI 4) and with similar fusions canying point mutations in frpR{plB16, -17,-18, -19, -20, -21), The mutations were generated by site-specific mutagenesis (see the Experimental procedures and Table 2), Ceils were grown at 37°C in M9 minimal medium and ()-gaiactosidase activity was determined as described in Table 1. a. The number adjacent to the nucleotide represents its position in the trpR gene, b. The number represents the percentage of jj-galactosidasa activity of the point-mutated fipfl-tec'Z fusion relative to that ol the wild type.

the six A residues' homopolymer. In a preliminary experiment we changed the third codon of /ac'Z following the fusion point to frpR mutated to a stop codon. The (i-galactosidase activity directed by this mutated trpR^-^/ac'Z fusion was completely abolished (I, Benhar and H. Engelberg-Kulka, in preparation). This result indicates that the transit from the 0 to the +1 frame occurs upstream from that position. Thus we suggest that the described +1 frameshift takes place between trpR position 269 (the start of the six A residues' homopolymer), and the fusion point of trpR with iac'Z at position 294 of the trpR gene. Our assumption is further supported by the fact that the trpR in vitro product of 10000 daltons is specifically immunoprecipitated by the antibodies directed against a peptide corresponding to the +1 frame of this region (Fig. 5A, lane 2). Experiments designed to identify the frameshift site more precisely and to determine whether other RNA sequences or structures are also involved in the frameshift of trpR are now in progress. We assume that because of the flexibility of the genetic code, frameshifting may result from several different mechanisms and may participate in the expression of numerous genes. Among the examples of frameshifting we cite its involvement in the expression of the eukaryotic viral genes gag-pol {Varmus, 1968), the prokaryotic insertion element IS 7 (Sekine and Ohtsubo, 1989), and the cellular prokaryotic genes prfB (coding for RF2) (Craigen and Caskey, 1986; 1987) and dnaX (Blinkowa and Walker, 1990; Flower and McHenry, 1990; Tsuchihashi and Kornberg, 1990). The protein products of these genes and their functions were known before the mechanisms for their synthesis were elucidated. We took a different approach, which may be suitable for the analysis of other genes where frameshifting is also involved. Our approach is first

to identify a frameshift event and characterize its product, and only then to elucidate its function. The described trpR H-I frameshift product has an identical N-terminus but a different C-terminus from that of the 0 frame product. The Trp repressor is a homodimer whose W-terminus is responsible for dimerization and whose C-terminus contains the DNA-binding domain (Yanofsky and Crawford, 1987). Thus, the trpR +^ frame product may have the ability to form heterodimers with the 0 frame product that would lack the ability to function in trp repression. The formation of such heterodimers would be favoured under conditions in which the relative ratio of +1 to 0 frame trpR product Is increased. We have recently found that this ratio is inversely related to the level of translation initiation of trpR\ when the rate of translation initiation is low, the +1 and 0 frame products of trpR are synthesized in similar amounts (I. Benhar et ai, unpublished). Thus, trpR frameshifting which leads to the synthesis of the +1 frame product may have a significant role in the regulation of tryptophan biosynthesis under physiological conditions in which the level of (rpRtranslation initiation is reduced.

Experimental procedures Materiais and media p^S]-methionine (>800M.Cimmol"') was obtained from Amersham. All the enzymes used in the recombinant DNA experiments were purchased from New England Biolabs. Bacteria were grown in Luria-Bertani (LB) medium or in M9 medium (Miller, 1972) to which the required amino acids were added, Ampicillin (50 ^g ml ^) was added to media in which the plasmid-carrying strains were grown.

Bacterial strains, baoteriophages and plasmid derivatives All the bacterial strains, bacteriophages and plasmid derivatives used in this study are listed in Table 2. Plasmid ptrpR3 (Roeder and Somerville, 1979) is a pBR322 derivative which carries a 1.25kb SamHI fragment containing the trpR gene (Fig, 2). We used ptrpR3 to construct plasmid denvatives carrying the trpR gene, Plasmid pHEK was constructed by subcloning the 1.25 kb BamH} fragment of ptrpR3 into the Hpal site of plasmid pKC30, placing ttpR under the control of the \ P L promoter (Fig. 2), For construction of pCM64 (Fig. 2), plasmid pT7-5 was digested with EcoRI and SamHI and treated with DNA polymerase I Klenow fragment to fill in the staggered ends. A 0.9kb Rsa\ fragment which contains a promoterless trpR gene was isolated from plasmid ptrpR3 and subcloned into the linearized pT7-5, placing the trpR gene under the control of the T7 promoter. The trpR-lac'Z fusions were constructed as follows. The trpR gene was fused in each of its three frames to the 10th codon of lac 'Zon plasmid pSKIO (a /acV-deleted denvative of pMC1403). ptrpR3 was digested with fcoRI (cutting upstream from tipR) and with Nru\ {cutting trpR at position 294), The resulting 995bp DNA

trpR frameshifting fragment was subcloned into the EcoRl-Smal restriction sites of the polylinker region of plasmid pSKI 0. The resulting plasmid was designated pIBI 4 (Fig. 2). In this plasmid, the trpR +1 frame was fused to the /ac'Zopen reading frame. Extending the EcoP.\-Nru\ fragment by 2bp resulted in plasmid plB13. in which the trpRO frame was fused to the open reading frame of the /ac'Zgene (Fig. 3). When the fcoRI-A/rul fragments were extended by 4bp, the trpR , frame was fused to the open reading frame of the lac'Z gene, and the resulting plasmid was designated plB15 (Fig. 3). To verify that the proper fusions had in fact been made, we sequenced the fusions at their frpR-/ac'Zjunctions. We also used derivatives of the f/pW-/acZ fusion plasmids carrying (rpfl point mutations, the positions of which are described in Tables 2 and 3. In addition, we used a derivative of pHEK carrying a mutation in the initiation codon of trpR (PHEKACC) (Table 2). All the point mutations were generated by site-specific mutagenesis of singlestranded M13-/rpff DNA (see below). The mutagenesis was followed by substitution of the mutated trpR DNA fragments for the wild-type fragments carried by these plasmids. For site-specific mutagenesis we constructed the recombinant phage Ml 3trpR by subcloning the 1.25kb Ban) H\~trpR fragment from ptrpR3 into the SamHI site of M13mp18 (obtained from New England Biolabs).

Motecutar ctoning All the recombinant DNA manipulations were carried out using standard procedures (Maniatis e( a/., 1982). Point mutations and deletions in the trpR gene were generated using synthetic oligonucleotides in site-specific mutagenesis reactions using the Amersham Kit for Ml 3 site-specific mutagenesis. DNA sequencing was carried out using the United States Biochemical Sequenase Kit.

Preparation of peptide-directed antibodies Synthetic peptides were made corresponding to the first 14 amino acids of the 0 frame trpR product and the last 16 amino acids of the putative +1 frame trpR product (Fig. 1). A cysteine residue was added as the last amino acid. The synthetic peptides were used to prepare antibodies in rabbits according to Bittle et ai (1982). The preparation of the peptides and their corresponding antibodies was done for us by H. Alexander and Dr R. Haughten in the laboratory of Dr R. Lerner (Scripps Clinic).

Labeiting and identification of the in vivo transtation products oMrpR To Study the in vivo expression of trpR, a T7 RNA polymerase/ promoter expression system (Tabor and Richardson, 1985) was used for a pulse-chase experiment. E. coli strain K38 was transformed with plasmids pGP1-2 and either pCM64 or pT7-5 (Table 2). Cells were grown in M9 minimal medium supplemented with a 0.2% glucose, 2,5M.gml ' thiamine, 20j.Lgml ' amino acids mix with the exception of cysteine and methionine. 100 (i-g ml ^ ampicillin and 50 [LQ ml ^ kanamycin at 3O''C to mid-log phase. Cells were shifted to 42°C for 10 min. Rifampicin was added to a concentration of 200 M-gml ' and the cells were further incubated at 42''C for an additional 10 min. The cells were transferred to 3O''C for 30 min. Aliquots of 200|j-l were then

2783

labelled by the addition of 15 M,Ci of p^S]-methionine for 5 min at 30X. For the chase, unlabelled methionine was added to a final concentration of 500 |xg m l " ' , and the cells were further incubated for 30 min at 30°C. Samples were lysed and applied to Tricine/ SDS-polyacryiamide gel electrophoresis as described (Schagger and von Jagow, 1987). Labelled proteins on fixed dried gels were detected by autoradiography (Dekel-Gorodetsky et ai, 1986).

Labelling and identifioation of the in vitro translation products of trpR We studied the translation of the trpR gene using an E. coti transcription-translation kit (Amersham). As templates we used pHEK and its derivative PHEKACC carrying a point mutation in the initiation codon of trpR. The polypeptides were labelled with PS]-methionine at 37''C for 60 min and immunoprecipitated (Oliver and Beckwith, 1982) with each of the two antibodies described above. Samples were subjected to electrophoresis and autoradiography as described above.

Purification and sequenoing of trpR+i-lac'Z fusion protein E. co//strain SP361 was transformed with plasmid plB14. Cells were grown in LB medium supplemented with 0,2% glucose and 50|xgml ^ ampicillin at 37X for 20h. Five litres of culture yielded 31 g of wet cell paste. Cells were lysed and trpR,,-/ac'Zfusion protein isolated and purified as described previously by us (Benhar and Engelberg-Kulka. 1991). This procedure yielded 350ii.g of trpR^^-iac'Z fusion protein as determined by the Bradford (1976) method. A 50 ^^g aliquot of the fusion protein was electrophoresed on a 7.5% polyacrylamide-SDS gel and electroblotted onto an Immobilon-P transfer membrane (Mitlipore). The sequence ofthe 10 /\/-terminal amino acids of this protein was determined by an Applied Biosystems 475A protein sequencer at the Bletterman Macromolecular Research Lab. (The Hebrew University, Faculty of Medicine, Jerusalem, Israel).

p-gaiactosidase activity measurements Cells containing /ac'Zfusion plasmids were grown in M9 minimal medium to mid-log phase (ODeoo = 0.4-0.6). Quantitative determination of /acZexpression was done by measuring p-galactosidase activity in culture aliquots treated with SDS as described by Miller (1972). Each given value is a mean of at least three independent assays.

Acknowledgements We thank Hanna Alexander and Dr R. Houghten (Scripps Clinic, La Jolla. CA, USA) for preparing for us the antibodies against chemically synthesized peptides. We are grateful to Dr Marlene Belfort (Albany. NY, USA), Dr Lynn Ripley (Newark, NJ. USA), Dr Ronald Somen/ille (West Lafayette, IN, USA), and Dr Charles Yanofsky (Stanford. CA, USA) for kindly providing us with bacteria, bacteriophages and plasmids. We thank Dr Ariel Gaathon and Mrs Lily Zisu (The Bletterman Macromolecular Research Lab., The Hebrew University. Jerusalem, Israel) for their help in determining the amino acid sequence ofthe tq3R+ i-/ac'Z protein.

2784

/. Benhar, C. Miller and H. Engelberg-Kulka

We thank Dr Marlene Belfort (Albany, NY, USA) for helpful discussions and F. R. Warshaw-Dadon (Jerusalem, Israel) for a critical reading of the manuscript. This research was supported by the endowment fund for Basic Research Foundation in Life Sciences (Charles H. Revson Foundation) administered by the Israel Academy of Sciences and Humanities. I.B. was supported by a Levy Eshkol Fellowship from the Ministry of Sciences and the National Council for Research and Development.

References Atkins, J.F., Gesteland, R.F., Reid, B.R., and Anderson, C.W. (1979) Normal tRNAs promote ribosomal frameshifting. Cell 18: 1119-1131. Atkins, J.F., Weiss, R.B., and Gesteland, R.F. (1990) Ribosomal gymnastics-degree of difficulty 9.5, style 10.0. Cell 62: 413423. Benhar, L.andEngetberg-Kulka, H. (1991) A procedure for amino acid sequencing in internal regions of proteins. Gene 103: 79-82. Beremand, M.N., and Blumenthal. T. (1979) An overlapping gene in RNA phage for a protein implicated in lysis. Ce//18:257-286. Bertrand, K., Squires, C. and Yanofsky, C. (1976) Transcription termination in vivo in the leader peptide of the tryptophan operon of Escherichia coli. J Mol Biol 103: 319-337. Bittle, J.L., Houghten, R.A., Alexander, H., Schinnic, T.M., Sutcliffe, J.G., Lemer, R.A., Rowlands, D.J.. and Brown, F. (1982) Protection against foot-and-mouth disease by immunization with a chemically synthesized peptide predicted from the viral nucleotide sequence. Nature 298: 30-33. Blinkowa, A., and Walker, J.R. (1990) Programmed ribosomal frameshifting generates the Escherichia coli DNA polymerase III y subunit from within the T subunit reading frame. NucI Acids Res 18: 1725-1729. Bogosian, G., Bertrand, K., and Somerville, R.L (1981) Trp repressor protein controls its own structural gene. J Mol Biol 149:821-825. Bradford, M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254. Casadaban, M.J., Chou, J., and Cohen, S.N. (1982) In vitro gene fusions that join an enzymatically active galactpsidase segment to amino-terminal fragments of exogenous proteins: Escherichia coti plasmid vectors for the detection and cloning of translational initiation signals. J Bacteriol 143: 971-980. Craigen, W.J., and Caskey, C.T. (1986) Expression of peptide chain release factor 2 requires high-efficiency frameshift. A/afure 322: 273-275. Craigen, W.J., and Caskey, C.T. (1987) The function, structure and regulation of E. coli peptide chain release factors. Biochim/e69: 1031-1041. Dekel-Gorodetsky, L, Schoulaker-Schwarz, R., and EngelbergKulka, H. (1986) Escherichia coii tryptophan operon directs the in vivo synthesis of a leader peptide. J Bacteriol 165: 10461048. Engelberg-Kulka, H., and Schoulaker-Schwarz, R. (1988) A flexible genetic code, or why does selenocysteine have no unique codon? Trends Biol Sci i3: 419-421. Flower, A.M., and McHenry, C.S. (1990) The -y subunit of DNA polymerase III holoenzyme of Escherichia coli is produced by ribosomal frameshifting. Proc Natt Acad Sci USA 87: 37133717. Gunsalus, R.P., and Yanofsky, C. (1980) Nucleotide sequence

and expression of Escherichia coli trpR, the structural gene for frp aporepressor. Proc Natt Acad Sci USA 77: 7117-7121. Heatwole, V.M., and Somerville, R.L. (1991) The tryptophan-specific permease gene mtr is differentially regulated by the tryptophan and tyrosine repressors in Escherichia coli K12. J Bacteriot 173: 3601-3604. Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. Miller, J.H. (1972) Experiments in Molecutar Genetics. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. Oliver, D.B., and Beckwith, J. (1982) Regulation of a membrane component required for protein secretion in Escherichia coti. Ce//30: 311-319. Paluh, J.L., and Yanofsky, C. (1986) High level production and rapid purification of the Escherichia coli trp repressor. NucI Acids Res 14: 7851-7860. Parker, J. (1989) Errors and alternatives in reading the universal genetic code. Microbiot Rev 53: 273-298. Ripley, L.S., and Clark, A. (1986) Frameshift mutations produced by proflavin in bacteriophage T4: specificity within a hotspot. Proc Natt Acad Sci USA 83: 6954-6958. Roeder, W., and Somerville, R.L. (1979) Cloning the tipR gene. Mot Gen Genet 176: 361-368. Rose, J.K., Squires, C.L., Yanofsky, C , Yang, H.L., and Zubay, G. (1973) Regulation of in vitro transcription of the tryptophan operon by purified RNA polymerase in the presence of partially purified repressor and tryptophan. Nature New Biol 245: 133-137. Russel, M., and Model, P. (1984) Replacement of the tip gene of Escherichia coti by an inactive gene cloned on a plasmid. J Bacterioi 159: 1034-1039. Schagger, H., and von Jagow, G. (1987) Tricine-sodium dodecyl sulfate polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anat Biochem 166: 368-379. Sekine, Y., and Ohtsubo, E. (1989) Frameshifting is required for production of the transposase encoded by insertion sequence 1. Proc Natt Acad Sci USA 86: 4609-4613. Shimatake, H., and Rosenberg. M. (1981) Purified X regulatory protein dl positively activates promoters for lysogenic development. Nature 292:128-132. Tabor, S., and Richardson, C.C. (1985) A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc Natt Acad Sci USA 82:1074-1078. Tsuchihashi, Z., and Kornberg. A. (1990) Translational frameshifting generates the -y subunit of ONA polymerase HI holoenzyme. Proc NatI Acad Sci USA 87: 2516-2520. Varmus, H.E. (1988) Retrovinjses. Sc/ence 240: 1427-1435. Yanofsky, C , and Crawford, I.P. (1987) The tryptophan operon. In Escherichia coli and Salmonella typhimurium. Cellutar and Motecutar Biotogy. Neidhardt, F.C, Ingraham, J.L., BrooksLow, K., Magasanik, B., Schaechter, M.. and Umbarger, E. {eds). Washington, D.C; Amercian Society for Microbiology, pp. 1453-1472. Yarwood, A. (1989) Manual methods of protein sequencing. In Protein Sequencing. Practical Approach Series. Lindlay, J.B.C., and Geisow, M.J. (eds). Oxford: Oxford University Press, pp. 119-145. Zurawski, G., Gunsalus, R.P., Brown, K.D., and Yanofsky, C. (1981) Structure and regulation of aroi-l, the structural gene for the tryptophan-repressible 3-deoxy-D-arabino-heptulosonicacid-7-phosphate synthetase of Escherichia coli. J Mol Biot 154: 47-73.