BJD
British Journal of Dermatology
D ER M A T O P A T H O L O G Y
Frequent activating HRAS mutations in trichilemmoma J.-H. Tsai,1,2 W.-C. Huang,3 J.-Y. Jhuang,4 Y.-M. Jeng,1,2 M.-L. Cheng,2 H.-Y. Chiu,5,6 K.-T. Kuo1 and J.-Y. Liau1,2 1
Department of Pathology, National Taiwan University Hospital, Taipei, Taiwan Graduate Institute of Pathology, College of Medicine, National Taiwan University, Taipei, Taiwan 3 Department of Pathology, Taipei Medical University – Wan Fang Hospital, Taipei, Taiwan 4 Department of Pathology, Far Eastern Memorial Hospital, Banciao District, New Taipei City, Taiwan 5 Department of Dermatology, National Taiwan University Hospital, Hsin-Chu Branch, Hsin Chu, Taiwan 6 Institute of Biomedical Engineering, College of Medicine and College of Engineering, National Taiwan University, Taipei, Taiwan 2
Summary Correspondence Jau-Yu Liau. E-mail: [email protected] Present address: No 7, Chung-Shan South Road, Taipei 10051, Taiwan
Accepted for publication 20 May 2014
Funding sources None.
Conflicts of interest None declared. DOI 10.1111/bjd.13143
Background Trichilemmoma is a benign follicular epithelial tumour exhibiting outer root sheath differentiation. It is associated with Cowden syndrome and naevus sebaceus (NS), but the pathogenesis of sporadic tumours is poorly understood. Recently, NS was found to be caused by postzygotic HRAS or KRAS mutations. Objectives We sought to determine whether NS-related and NS-unrelated trichilemmomas harbour RAS mutations. Methods Formalin-fixed and paraffin-embedded blocks of 12 NS-related and 15 NS-unrelated trichilemmomas from 26 individuals were retrieved and analysed to determine the presence of mutations in exons 1 and 2 of the HRAS, KRAS and NRAS genes by polymerase chain reaction and direct sequencing. Mutational hotspots of the FGFR3 and PIK3CA genes were also analysed for NS-unrelated cases. Results Among the 27 cases, mutually exclusive HRAS c.37G>C and c.182A>G mutations were observed in 17 and three tumours, respectively. Of the 12 NSrelated tumours, 11 (92%) harboured the HRAS c.37G>C substitution. Of the 15 sporadic tumours, nine (60%) harboured HRAS mutations, including six c.37G>C and three c.182A>G. An HRAS c.182A>G mutation was observed only in sporadic tumours. No mutations were observed in the other genes that were tested. Conclusions The high frequency of HRAS activating mutations, including the c.182A>G substitution, which was rather rare in NS, suggests that most trichilemmomas are authentic neoplasms.
What’s already known about this topic?
• •
Virtually all cases of naevus sebaceus (NS) are caused by postzygotic HRAS or KRAS mutations. Trichilemmoma is among the most common secondary tumours associated with NS.
What does this study add?
• •
Sporadic trichilemmomas frequently harbour activating HRAS mutations, including the c.182A>G substitution, which is rather rare in NS. The high frequency of activating HRAS mutations suggests that most trichilemmomas are authentic neoplasms.
Trichilemmoma is a benign follicular epithelial tumour exhibiting outer root sheath differentiation at the bulb and stem. Its pathogenesis is poorly understood and studies have frequently debated whether it is a neoplasm, hamartoma or verruca.1–4 It is a common cutaneous manifestation of Cowden syndrome
(CS), which, in most cases, is caused by germline PTEN (phosphatase and tensin homologue) gene mutations. However, immunohistochemical analysis of sporadic trichilemmoma seldom reveals loss of PTEN expression, in contrast to syndromic cases.5 Trichilemmoma, particularly the desmoplas-
© 2014 British Association of Dermatologists
British Journal of Dermatology (2014) 171, pp1073–1077
1073
1074 HRAS mutations and trichilemmoma, J.-H. Tsai et al.
tic variant, is a common secondary tumour occurring in naevus sebaceus (NS). Recent studies have revealed that virtually all cases of NS harbour activating HRAS or KRAS mutations, which represent a postzygotic mutation and genetic mosaicism.6–8 In this study, we investigated whether trichilemmomas harbour RAS gene mutations by using polymerase chain reaction (PCR) and direct sequencing. We demonstrated that a vast majority of NS-related trichilemmomas harbour an HRAS c.37G>C mutation. Sporadic trichilemmomas, with either conventional or desmoplastic morphology, also frequently harboured activating HRAS gene mutations, particularly the HRAS c.37G>C substitution, the most prevalent mutation variant observed in NS. In addition, an HRAS c.182A>G mutation was detected in one-fifth of NS-unrelated cases. This mutation has not been observed in previous studies on NS6–8 and was identified only recently in two patients with phacomatosis pigmentokeratotica (PPK), an extremely rare condition associated with NS.9 Our findings provide molecular evidence that most trichilemmomas are neoplastic.
Materials and methods Tumour samples Cases of trichilemmomas with available archival material were retrieved from the Department of Pathology, National Taiwan University Hospital. None exhibited typical clinical features of CS. The diagnosis was confirmed through histological review. Whether each sample was NS-related was assessed by gross findings and through microscopic examination. Mutation analysis After case selection, three to five 10-lm-thick paraffin sections were cut from the block. The tumorous areas of the paraffin sections were dissected using sterilized razors under a microscope. Genomic DNA was extracted using a QIAamp DNA FFPE Tissue Kit (Qiagen, Santa Clarita, CA, U.S.A.) according to the manufacturer’s protocol. The samples were subjected to PCR, using the primer pairs of exons 1 and 2 of the HRAS,
KRAS and NRAS genes. For NS-unrelated cases, exons 7, 10 and 15 of the FGFR3 gene and exons 9 and 20 of the PIK3CA gene were also amplified and analysed. The primer sequences are listed in Table 1. After purification, direct sequencing was performed using an automated ABI 3730 sequencer (Applied BioSystems, Foster City, CA, U.S.A.). The mutational status of the adjacent NS lesion was examined in five NS-related cases that had adequate material for analysis. In one case, two independent desmoplastic trichilemmomas occurring in the same NS were separately microdissected. The study was approved by the institutional review board, and the specimens were anonymous and analysed in a blind manner.
Results In total 27 trichilemmomas from 26 individuals were analysed. Twelve tumours were NS-related and 15 were NS-unrelated. In the NS-related group, three and nine tumours exhibited conventional and desmoplastic morphologies, respectively. In the NS-unrelated group, six and nine tumours exhibited conventional and desmoplastic morphologies, respectively. One patient had two independent desmoplastic trichilemmomas occurring in the same NS. The desmoplastic variant was more common in our cases, particularly when associated with NS. Representative microscopic images of trichilemmomas are shown in Figure 1. Activating HRAS mutations were identified in 20 tumours (74%), including 17 c.37G>C (p.G13R) and three c.182A>G (p.Q61R) mutations (Fig. 1). The results of mutational analysis of the HRAS gene are listed in Table 2. HRAS c.37G>C and c.182A>G mutations were mutually exclusive. The frequency of activating HRAS mutation was higher for NS-related tumours (11 of 12, 92% vs. nine of 15, 60%). For NS-unrelated tumours, an HRAS mutation was identified in 50% (three of six) and 67% (six of nine) of conventional and desmoplastic trichilemmomas, respectively. No mutations were identified in the mutation hotspots of the KRAS, NRAS, FGFR3 and PIK3CA genes. All five cases with available NS tissue subjected to analysis exhibited a concordant HRAS c.37G>C mutation with the trichilemmomas. All three tumours with the HRAS c.182A>G mutation were
Table 1 Primer sequences of HRAS, KRAS, NRAS, FGFR3 and PIK3CA Exon
Forward primer (50 ? 30 )
Reverse primer (50 ? 30 )
HRAS exon 1 HRAS exon 2 KRAS exon 1 KRAS exon 2 NRAS exon 1 NRAS exon 2 FGFR3 exon 7 FGFR3 exon 10 FGFR3 exon 15 PIK3CA exon 9 PIK3CA exon 20
CAGGAGACCCTGTAGGAGG GTCCTCCTGCAGGATTCCTA GTGTGACATGTTCTAATATAGTCA CCAGACTGTGTTTCTCCCTT GGTGTGAAATGACTGAGTAC GGTGAAACCTGTTTGTTGGA AGTGGCGGTGGTGGTGAGGGAG CAACGCCCATGTCTTTGCAG AATGTGCTGGTGACCGAGGA AGTAACAGACTAGCTAGAGA GACCCTAGCCTTAGATAAAAC
TCGTCCACAAAATGGTTCTG GGTGGATGTCCTCAAAAGAC GAATGGTCCTGCACCAGTAA CACAAAGAAAGCCCTCCCCA GGGCCTCACCTCTATGGTG GCTCCTAGTACCTGTAGAGGT TGTGCGTCACTGTACACCTTGCAG CGGGAGATCTTGTGCACGGT GTGTGGGAAGGCGGTGTTG ATTTTAGCACTTACCTGTGAC GGAATCCAGAGTGAGCTTTC
British Journal of Dermatology (2014) 171, pp1073–1077
© 2014 British Association of Dermatologists
HRAS mutations and trichilemmoma, J.-H. Tsai et al. 1075
(a)
(b)
(c)
(d)
(e)
(f)
(g)
(h)
(i)
Fig 1. HRAS mutations in naevus sebaceus (NS)-related and sporadic trichilemmomas. (a) An NS and (b) associated conventional trichilemmoma. (c) Identical HRAS c.37G>C mutations were observed in both the trichilemmoma and the background NS. (d) Sporadic nondesmoplastic and (e) desmoplastic trichilemmomas both harboured HRAS c.37G>C mutations (f). (i) An HRAS c.182A>G mutation was observed in both sporadic nondesmoplastic (g) and desmoplastic (h) trichilemmomas. Original magnification: (a) 9 40; (b, d, e, g, h) 9 100. For all Sanger sequencing chromatographs, the upper and lower panels were read through forward and reverse sequencing, respectively.
NS-unrelated and accounted for 20% of the NS-unrelated tumours. For the HRAS mutated and NS-unrelated cases, c.37G>C and c.182A>G mutations accounted for two-thirds and one-third of cases, respectively, and the relative ratio was equal between conventional and desmoplastic tumours. No morphological differences were observed between the HRAS mutated and wild-type cases. © 2014 British Association of Dermatologists
Discussion The nature and pathogenesis of trichilemmoma have long been a matter of debate. Various authors have considered it to be a neoplasm, hamartoma or verruca.1–4 It is commonly associated with NS. Recently, it was found that virtually all cases of NS are caused by postzygotic activating mutations of British Journal of Dermatology (2014) 171, pp1073–1077
1076 HRAS mutations and trichilemmoma, J.-H. Tsai et al. Table 2 HRAS mutations in trichilemmomas Diagnosis
Number of cases
Exon 1 mutationa
Exon 2 mutationb
Mutation rate
Overall mutation rate
NS+TL NS+DTL NSTL NSDTL
3 9 6 9
2 9 2 4
0 0 1 2
2/3 9/9 3/6 6/9
11/12 (92%)
(67%) (100%) (50%) (67%)
9/15 (60%)
NS, naevus sebaceus; TL, trichilemmoma; DTL, desmoplastic TL. aAll exon 1 mutations were c.37G>C (p.G13R). bAll exon 2 mutations were c.182A>G (p.Q61R).
the HRAS or KRAS genes (or, rarely, both) and NS represents a state of genetic mosaicism.6–8 Postzygotic HRAS mutations were also recently identified as the cause of PPK, which is characterized by the co-occurrence of NS and speckled lentiginous naevus.9 In the study of Groesser et al.,9 eight secondary tumours developed in NS, including three trichilemmomas, all harbouring the same HRAS c.37G>C mutation as the NS. Because trichilemmoma is among the most common secondary tumours that develop in NS, these findings prompted us to conduct a study to investigate whether sporadic trichilemmomas also harbour RAS mutations. Our results demonstrated that HRAS activating mutations were observed in most NS-related and sporadic trichilemmomas. No mutations were observed in exons 1 and 2 of the KRAS and NRAS genes. Similarly, no mutations were observed in the hotspots of the FGFR3 and PIK3CA genes, which were reported to be mutated in other cutaneous epidermal tumours.10 Similarly to the previous study,6 all but one of the NS-related trichilemmomas in our series exhibited an HRAS c.37G>C mutation. An identical c.37G>C mutation was confirmed in the background NS in five cases. For NS-related tumours, it is conceivable that the secondary tumours occurring in NS, including trichilemmomas, harbour the same hallmark genetic alterations as the NS. However, the reason why NS can be associated with a large variety of cutaneous adnexal tumours (e.g. trichoblastoma, syringocystadenoma papilliferum and trichilemmoma) remains unknown. One possible mechanism is that the oncogenic Ras protein merely provides growth advantage, and it is the secondary genetic alterations, acquired later in life, that ultimately determine the secondary tumour types. However, in our study, an identical HRAS c.37G>C mutation was also frequently observed in NS-unrelated trichilemmomas, and approximately 20% of NS-unrelated trichilemmomas harboured an HRAS c.182A>G mutation, which has not been identified in previous studies of NS6–8 and was only recently observed in two patients diagnosed with PPK.9 Thus, the H-Ras protein and the downstream pathways activated by it likely played crucial roles in the pathogenesis of this distinct tumour. Germline HRAS mutation causes Costello syndrome (OMIM 218040), which is characterized by developmental delay, coarse facial features, loose skin folds with palmar and plantar creases, skin papillomas, musculoskeletal problems and cardiac defects.11,12 Approximately 50% of affected individuals develop skin papillomas, frequently on the face and perianal region. British Journal of Dermatology (2014) 171, pp1073–1077
However, to the best of our knowledge, features of trichilemmomas have not been described in the literature. In addition, the papillomas in patients diagnosed with Costello syndrome are most frequently observed during childhood and are not limited to the head and neck area, whereas most cases of NS-related and sporadic trichilemmomas are seen after adolescence and in the head and neck region. The reasons for these differences are largely unclear, but the mutational spectrum differs between these two disorders. Most cases of Costello syndrome and NS are caused by HRAS c.34G>A and c.37G>C mutations, respectively.13–15 HRAS c.37G>C and c.182A>G mutations seem not to have been reported in Costello syndrome. A mosaic HRAS mutation was also observed in one-third of keratinocytic epidermal naevus (KEN) cases, with the c.37G>C substitution also being the most frequent mutation observed.16 However, in contrast to NS, the underlying adnexal structures in KEN are spared, and KEN is rarely associated with secondary tumours. Thus, the development of trichilemmoma is likely to be a genotype- and cell-type-dependent process. Cowden syndrome is another syndrome associated with trichilemmoma. A recent study demonstrated that loss of PTEN expression was seen in most syndromic cases but was rare in sporadic cases, indicating that the role of PTEN differs between CS-associated and sporadic trichilemmomas.5 In a small subset of patients with CS or CS-like syndrome, the disease was recently found to be caused by germline PIK3CA or AKT1 mutations, suggesting that these mutations were associated with similar clinical phenotypes.17 No PIK3CA hotspot activating mutations were observed in our series, despite phosphatidylinositol 3-kinase (PI3K) being upstream of PTEN in the PI3K/Akt pathway. However, it has been shown that various Ras isoforms exhibit distinct binding affinities for downstream signalling pathways, and H-Ras is a more potent activator of PI3K than K-Ras.18 Functional analysis also revealed that the HRAS c.37G>C mutant protein was capable of activating both the mitogen-activated protein kinase and PI3K/Akt pathways.6 Thus, it is plausible that in CS-associated tumours, inactivation of both PTEN alleles is required for trichilemmoma development, whereas in sporadic tumours, oncogenic H-Ras provides the oncogenic stimulation required for PI3K/Akt pathway activation. This also explains why trichilemmoma is among the most common secondary tumours developing in NS, because > 90% of NS cases harbour activating HRAS mutations, particularly the HRAS c.37G>C substitution. © 2014 British Association of Dermatologists
HRAS mutations and trichilemmoma, J.-H. Tsai et al. 1077
A limitation of our study is that we did not include CS-associated tumours. Whether CS-associated tumours harbour activating RAS or PIK3CA mutations, thereby providing an alternative driving force for PI3K/Akt pathway activation, warrants investigation. However, CS-associated tumours typically exhibit conventional morphology, whereas desmoplastic features are sometimes seen in CS-unrelated tumours, particularly when associated with NS. This implies that pathways other than PI3K/Akt activated by oncogenic H-Ras account for the morphological differences, and this might lessen the probability that CS-associated trichilemmomas would also harbour HRAS mutations. In our series, most NS-unrelated tumours, including 50% of conventional trichilemmomas, harboured HRAS mutations. In addition, both conventional and desmoplastic morphologies could be associated with either c.37G>C or c.182A>G mutations. In combination with the previous PTEN immunohistochemical study,5 these findings suggest that the pathogenesis of sporadic conventional and desmoplastic trichilemmomas is similar, but is probably distinct from that of CS-associated tumours. In conclusion, we confirmed that trichilemmomas occurring in NS carried the same HRAS genotype as the NS. More importantly, we demonstrated that sporadic, NS-unrelated tumours also commonly harboured activating HRAS mutations, thus providing molecular evidence that most trichilemmomas are authentic neoplasms.
References 1 Richfield DF. Tricholemmoma. True and false types. Am J Dermatopathol 1980; 2:233–4. 2 Ackerman AB, Wade TR. Tricholemmoma. Am J Dermatopathol 1980; 2:207–24. 3 Brownstein MH. Trichilemmoma. Benign follicular tumor or viral wart? Am J Dermatopathol 1980; 2:229–31. 4 Reed RJ. Tricholemmoma. A cutaneous hamartoma. Am J Dermatopathol 1980; 2:227–8.
© 2014 British Association of Dermatologists
5 Al-Zaid T, Ditelberg JS, Prieto VG et al. Trichilemmomas show loss of PTEN in Cowden syndrome but only rarely in sporadic tumors. J Cutan Pathol 2012; 39:493–9. 6 Groesser L, Herschberger E, Ruetten A et al. Postzygotic HRAS and KRAS mutations cause nevus sebaceous and Schimmelpenning syndrome. Nat Genet 2012; 44:783–7. 7 Sun BK, Saggini A, Sarin KY et al. Mosaic activating RAS mutations in nevus sebaceus and nevus sebaceus syndrome. J Invest Dermatol 2013; 133:824–7. 8 Levinsohn JL, Tian LC, Boyden LM et al. Whole-exome sequencing reveals somatic mutations in HRAS and KRAS, which cause nevus sebaceus. J Invest Dermatol 2013; 133:827–30. 9 Groesser L, Herschberger E, Sagrera A et al. Phacomatosis pigmentokeratotica is caused by a postzygotic HRAS mutation in a multipotent progenitor cell. J Invest Dermatol 2013; 133:1998–2003. 10 Hafner C, L opez-Knowles E, Luis NM et al. Oncogenic PIK3CA mutations occur in epidermal nevi and seborrheic keratoses with a characteristic mutation pattern. Proc Natl Acad Sci USA 2007; 104:13450–4. 11 Costello JM. A new syndrome: mental subnormality and nasal papillomata. Aust Paediatr J 1977; 13:114–18. 12 Hennekam RC. Costello syndrome: an overview. Am J Med Genet C Semin Med Genet 2003; 117C:42–8. 13 Aoki Y, Niihori T, Kawame H et al. Germline mutations in HRAS proto-oncogene cause Costello syndrome. Nat Genet 2005; 37:1038–40. 14 Gripp KW, Lin AE, Stabley DL et al. HRAS mutation analysis in Costello syndrome: genotype and phenotype correlation. Am J Med Genet A 2006; 140:1–7. 15 Kerr B, Delrue MA, Sigaudy S et al. Genotype–phenotype correlation in Costello syndrome: HRAS mutation analysis in 43 cases. J Med Genet 2006; 43:401–5. 16 Hafner C, Toll A, Gantner S et al. Keratinocytic epidermal nevi are associated with mosaic RAS mutations. J Med Genet 2012; 49:249– 53. 17 Orloff MS, He X, Peterson C et al. Germline PIK3CA and AKT1 mutations in Cowden and Cowden-like syndromes. Am J Hum Genet 2013; 92:76–80. 18 Yan J, Roy S, Apolloni A et al. Ras isoforms vary in their ability to activate Raf-1 and phosphoinositide 3-kinase. J Biol Chem 1998; 273:24052–6.
British Journal of Dermatology (2014) 171, pp1073–1077
British Journal of Dermatology
D ER M A T O P A T H O L O G Y
Frequent activating HRAS mutations in trichilemmoma J.-H. Tsai,1,2 W.-C. Huang,3 J.-Y. Jhuang,4 Y.-M. Jeng,1,2 M.-L. Cheng,2 H.-Y. Chiu,5,6 K.-T. Kuo1 and J.-Y. Liau1,2 1
Department of Pathology, National Taiwan University Hospital, Taipei, Taiwan Graduate Institute of Pathology, College of Medicine, National Taiwan University, Taipei, Taiwan 3 Department of Pathology, Taipei Medical University – Wan Fang Hospital, Taipei, Taiwan 4 Department of Pathology, Far Eastern Memorial Hospital, Banciao District, New Taipei City, Taiwan 5 Department of Dermatology, National Taiwan University Hospital, Hsin-Chu Branch, Hsin Chu, Taiwan 6 Institute of Biomedical Engineering, College of Medicine and College of Engineering, National Taiwan University, Taipei, Taiwan 2
Summary Correspondence Jau-Yu Liau. E-mail: [email protected] Present address: No 7, Chung-Shan South Road, Taipei 10051, Taiwan
Accepted for publication 20 May 2014
Funding sources None.
Conflicts of interest None declared. DOI 10.1111/bjd.13143
Background Trichilemmoma is a benign follicular epithelial tumour exhibiting outer root sheath differentiation. It is associated with Cowden syndrome and naevus sebaceus (NS), but the pathogenesis of sporadic tumours is poorly understood. Recently, NS was found to be caused by postzygotic HRAS or KRAS mutations. Objectives We sought to determine whether NS-related and NS-unrelated trichilemmomas harbour RAS mutations. Methods Formalin-fixed and paraffin-embedded blocks of 12 NS-related and 15 NS-unrelated trichilemmomas from 26 individuals were retrieved and analysed to determine the presence of mutations in exons 1 and 2 of the HRAS, KRAS and NRAS genes by polymerase chain reaction and direct sequencing. Mutational hotspots of the FGFR3 and PIK3CA genes were also analysed for NS-unrelated cases. Results Among the 27 cases, mutually exclusive HRAS c.37G>C and c.182A>G mutations were observed in 17 and three tumours, respectively. Of the 12 NSrelated tumours, 11 (92%) harboured the HRAS c.37G>C substitution. Of the 15 sporadic tumours, nine (60%) harboured HRAS mutations, including six c.37G>C and three c.182A>G. An HRAS c.182A>G mutation was observed only in sporadic tumours. No mutations were observed in the other genes that were tested. Conclusions The high frequency of HRAS activating mutations, including the c.182A>G substitution, which was rather rare in NS, suggests that most trichilemmomas are authentic neoplasms.
What’s already known about this topic?
• •
Virtually all cases of naevus sebaceus (NS) are caused by postzygotic HRAS or KRAS mutations. Trichilemmoma is among the most common secondary tumours associated with NS.
What does this study add?
• •
Sporadic trichilemmomas frequently harbour activating HRAS mutations, including the c.182A>G substitution, which is rather rare in NS. The high frequency of activating HRAS mutations suggests that most trichilemmomas are authentic neoplasms.
Trichilemmoma is a benign follicular epithelial tumour exhibiting outer root sheath differentiation at the bulb and stem. Its pathogenesis is poorly understood and studies have frequently debated whether it is a neoplasm, hamartoma or verruca.1–4 It is a common cutaneous manifestation of Cowden syndrome
(CS), which, in most cases, is caused by germline PTEN (phosphatase and tensin homologue) gene mutations. However, immunohistochemical analysis of sporadic trichilemmoma seldom reveals loss of PTEN expression, in contrast to syndromic cases.5 Trichilemmoma, particularly the desmoplas-
© 2014 British Association of Dermatologists
British Journal of Dermatology (2014) 171, pp1073–1077
1073
1074 HRAS mutations and trichilemmoma, J.-H. Tsai et al.
tic variant, is a common secondary tumour occurring in naevus sebaceus (NS). Recent studies have revealed that virtually all cases of NS harbour activating HRAS or KRAS mutations, which represent a postzygotic mutation and genetic mosaicism.6–8 In this study, we investigated whether trichilemmomas harbour RAS gene mutations by using polymerase chain reaction (PCR) and direct sequencing. We demonstrated that a vast majority of NS-related trichilemmomas harbour an HRAS c.37G>C mutation. Sporadic trichilemmomas, with either conventional or desmoplastic morphology, also frequently harboured activating HRAS gene mutations, particularly the HRAS c.37G>C substitution, the most prevalent mutation variant observed in NS. In addition, an HRAS c.182A>G mutation was detected in one-fifth of NS-unrelated cases. This mutation has not been observed in previous studies on NS6–8 and was identified only recently in two patients with phacomatosis pigmentokeratotica (PPK), an extremely rare condition associated with NS.9 Our findings provide molecular evidence that most trichilemmomas are neoplastic.
Materials and methods Tumour samples Cases of trichilemmomas with available archival material were retrieved from the Department of Pathology, National Taiwan University Hospital. None exhibited typical clinical features of CS. The diagnosis was confirmed through histological review. Whether each sample was NS-related was assessed by gross findings and through microscopic examination. Mutation analysis After case selection, three to five 10-lm-thick paraffin sections were cut from the block. The tumorous areas of the paraffin sections were dissected using sterilized razors under a microscope. Genomic DNA was extracted using a QIAamp DNA FFPE Tissue Kit (Qiagen, Santa Clarita, CA, U.S.A.) according to the manufacturer’s protocol. The samples were subjected to PCR, using the primer pairs of exons 1 and 2 of the HRAS,
KRAS and NRAS genes. For NS-unrelated cases, exons 7, 10 and 15 of the FGFR3 gene and exons 9 and 20 of the PIK3CA gene were also amplified and analysed. The primer sequences are listed in Table 1. After purification, direct sequencing was performed using an automated ABI 3730 sequencer (Applied BioSystems, Foster City, CA, U.S.A.). The mutational status of the adjacent NS lesion was examined in five NS-related cases that had adequate material for analysis. In one case, two independent desmoplastic trichilemmomas occurring in the same NS were separately microdissected. The study was approved by the institutional review board, and the specimens were anonymous and analysed in a blind manner.
Results In total 27 trichilemmomas from 26 individuals were analysed. Twelve tumours were NS-related and 15 were NS-unrelated. In the NS-related group, three and nine tumours exhibited conventional and desmoplastic morphologies, respectively. In the NS-unrelated group, six and nine tumours exhibited conventional and desmoplastic morphologies, respectively. One patient had two independent desmoplastic trichilemmomas occurring in the same NS. The desmoplastic variant was more common in our cases, particularly when associated with NS. Representative microscopic images of trichilemmomas are shown in Figure 1. Activating HRAS mutations were identified in 20 tumours (74%), including 17 c.37G>C (p.G13R) and three c.182A>G (p.Q61R) mutations (Fig. 1). The results of mutational analysis of the HRAS gene are listed in Table 2. HRAS c.37G>C and c.182A>G mutations were mutually exclusive. The frequency of activating HRAS mutation was higher for NS-related tumours (11 of 12, 92% vs. nine of 15, 60%). For NS-unrelated tumours, an HRAS mutation was identified in 50% (three of six) and 67% (six of nine) of conventional and desmoplastic trichilemmomas, respectively. No mutations were identified in the mutation hotspots of the KRAS, NRAS, FGFR3 and PIK3CA genes. All five cases with available NS tissue subjected to analysis exhibited a concordant HRAS c.37G>C mutation with the trichilemmomas. All three tumours with the HRAS c.182A>G mutation were
Table 1 Primer sequences of HRAS, KRAS, NRAS, FGFR3 and PIK3CA Exon
Forward primer (50 ? 30 )
Reverse primer (50 ? 30 )
HRAS exon 1 HRAS exon 2 KRAS exon 1 KRAS exon 2 NRAS exon 1 NRAS exon 2 FGFR3 exon 7 FGFR3 exon 10 FGFR3 exon 15 PIK3CA exon 9 PIK3CA exon 20
CAGGAGACCCTGTAGGAGG GTCCTCCTGCAGGATTCCTA GTGTGACATGTTCTAATATAGTCA CCAGACTGTGTTTCTCCCTT GGTGTGAAATGACTGAGTAC GGTGAAACCTGTTTGTTGGA AGTGGCGGTGGTGGTGAGGGAG CAACGCCCATGTCTTTGCAG AATGTGCTGGTGACCGAGGA AGTAACAGACTAGCTAGAGA GACCCTAGCCTTAGATAAAAC
TCGTCCACAAAATGGTTCTG GGTGGATGTCCTCAAAAGAC GAATGGTCCTGCACCAGTAA CACAAAGAAAGCCCTCCCCA GGGCCTCACCTCTATGGTG GCTCCTAGTACCTGTAGAGGT TGTGCGTCACTGTACACCTTGCAG CGGGAGATCTTGTGCACGGT GTGTGGGAAGGCGGTGTTG ATTTTAGCACTTACCTGTGAC GGAATCCAGAGTGAGCTTTC
British Journal of Dermatology (2014) 171, pp1073–1077
© 2014 British Association of Dermatologists
HRAS mutations and trichilemmoma, J.-H. Tsai et al. 1075
(a)
(b)
(c)
(d)
(e)
(f)
(g)
(h)
(i)
Fig 1. HRAS mutations in naevus sebaceus (NS)-related and sporadic trichilemmomas. (a) An NS and (b) associated conventional trichilemmoma. (c) Identical HRAS c.37G>C mutations were observed in both the trichilemmoma and the background NS. (d) Sporadic nondesmoplastic and (e) desmoplastic trichilemmomas both harboured HRAS c.37G>C mutations (f). (i) An HRAS c.182A>G mutation was observed in both sporadic nondesmoplastic (g) and desmoplastic (h) trichilemmomas. Original magnification: (a) 9 40; (b, d, e, g, h) 9 100. For all Sanger sequencing chromatographs, the upper and lower panels were read through forward and reverse sequencing, respectively.
NS-unrelated and accounted for 20% of the NS-unrelated tumours. For the HRAS mutated and NS-unrelated cases, c.37G>C and c.182A>G mutations accounted for two-thirds and one-third of cases, respectively, and the relative ratio was equal between conventional and desmoplastic tumours. No morphological differences were observed between the HRAS mutated and wild-type cases. © 2014 British Association of Dermatologists
Discussion The nature and pathogenesis of trichilemmoma have long been a matter of debate. Various authors have considered it to be a neoplasm, hamartoma or verruca.1–4 It is commonly associated with NS. Recently, it was found that virtually all cases of NS are caused by postzygotic activating mutations of British Journal of Dermatology (2014) 171, pp1073–1077
1076 HRAS mutations and trichilemmoma, J.-H. Tsai et al. Table 2 HRAS mutations in trichilemmomas Diagnosis
Number of cases
Exon 1 mutationa
Exon 2 mutationb
Mutation rate
Overall mutation rate
NS+TL NS+DTL NSTL NSDTL
3 9 6 9
2 9 2 4
0 0 1 2
2/3 9/9 3/6 6/9
11/12 (92%)
(67%) (100%) (50%) (67%)
9/15 (60%)
NS, naevus sebaceus; TL, trichilemmoma; DTL, desmoplastic TL. aAll exon 1 mutations were c.37G>C (p.G13R). bAll exon 2 mutations were c.182A>G (p.Q61R).
the HRAS or KRAS genes (or, rarely, both) and NS represents a state of genetic mosaicism.6–8 Postzygotic HRAS mutations were also recently identified as the cause of PPK, which is characterized by the co-occurrence of NS and speckled lentiginous naevus.9 In the study of Groesser et al.,9 eight secondary tumours developed in NS, including three trichilemmomas, all harbouring the same HRAS c.37G>C mutation as the NS. Because trichilemmoma is among the most common secondary tumours that develop in NS, these findings prompted us to conduct a study to investigate whether sporadic trichilemmomas also harbour RAS mutations. Our results demonstrated that HRAS activating mutations were observed in most NS-related and sporadic trichilemmomas. No mutations were observed in exons 1 and 2 of the KRAS and NRAS genes. Similarly, no mutations were observed in the hotspots of the FGFR3 and PIK3CA genes, which were reported to be mutated in other cutaneous epidermal tumours.10 Similarly to the previous study,6 all but one of the NS-related trichilemmomas in our series exhibited an HRAS c.37G>C mutation. An identical c.37G>C mutation was confirmed in the background NS in five cases. For NS-related tumours, it is conceivable that the secondary tumours occurring in NS, including trichilemmomas, harbour the same hallmark genetic alterations as the NS. However, the reason why NS can be associated with a large variety of cutaneous adnexal tumours (e.g. trichoblastoma, syringocystadenoma papilliferum and trichilemmoma) remains unknown. One possible mechanism is that the oncogenic Ras protein merely provides growth advantage, and it is the secondary genetic alterations, acquired later in life, that ultimately determine the secondary tumour types. However, in our study, an identical HRAS c.37G>C mutation was also frequently observed in NS-unrelated trichilemmomas, and approximately 20% of NS-unrelated trichilemmomas harboured an HRAS c.182A>G mutation, which has not been identified in previous studies of NS6–8 and was only recently observed in two patients diagnosed with PPK.9 Thus, the H-Ras protein and the downstream pathways activated by it likely played crucial roles in the pathogenesis of this distinct tumour. Germline HRAS mutation causes Costello syndrome (OMIM 218040), which is characterized by developmental delay, coarse facial features, loose skin folds with palmar and plantar creases, skin papillomas, musculoskeletal problems and cardiac defects.11,12 Approximately 50% of affected individuals develop skin papillomas, frequently on the face and perianal region. British Journal of Dermatology (2014) 171, pp1073–1077
However, to the best of our knowledge, features of trichilemmomas have not been described in the literature. In addition, the papillomas in patients diagnosed with Costello syndrome are most frequently observed during childhood and are not limited to the head and neck area, whereas most cases of NS-related and sporadic trichilemmomas are seen after adolescence and in the head and neck region. The reasons for these differences are largely unclear, but the mutational spectrum differs between these two disorders. Most cases of Costello syndrome and NS are caused by HRAS c.34G>A and c.37G>C mutations, respectively.13–15 HRAS c.37G>C and c.182A>G mutations seem not to have been reported in Costello syndrome. A mosaic HRAS mutation was also observed in one-third of keratinocytic epidermal naevus (KEN) cases, with the c.37G>C substitution also being the most frequent mutation observed.16 However, in contrast to NS, the underlying adnexal structures in KEN are spared, and KEN is rarely associated with secondary tumours. Thus, the development of trichilemmoma is likely to be a genotype- and cell-type-dependent process. Cowden syndrome is another syndrome associated with trichilemmoma. A recent study demonstrated that loss of PTEN expression was seen in most syndromic cases but was rare in sporadic cases, indicating that the role of PTEN differs between CS-associated and sporadic trichilemmomas.5 In a small subset of patients with CS or CS-like syndrome, the disease was recently found to be caused by germline PIK3CA or AKT1 mutations, suggesting that these mutations were associated with similar clinical phenotypes.17 No PIK3CA hotspot activating mutations were observed in our series, despite phosphatidylinositol 3-kinase (PI3K) being upstream of PTEN in the PI3K/Akt pathway. However, it has been shown that various Ras isoforms exhibit distinct binding affinities for downstream signalling pathways, and H-Ras is a more potent activator of PI3K than K-Ras.18 Functional analysis also revealed that the HRAS c.37G>C mutant protein was capable of activating both the mitogen-activated protein kinase and PI3K/Akt pathways.6 Thus, it is plausible that in CS-associated tumours, inactivation of both PTEN alleles is required for trichilemmoma development, whereas in sporadic tumours, oncogenic H-Ras provides the oncogenic stimulation required for PI3K/Akt pathway activation. This also explains why trichilemmoma is among the most common secondary tumours developing in NS, because > 90% of NS cases harbour activating HRAS mutations, particularly the HRAS c.37G>C substitution. © 2014 British Association of Dermatologists
HRAS mutations and trichilemmoma, J.-H. Tsai et al. 1077
A limitation of our study is that we did not include CS-associated tumours. Whether CS-associated tumours harbour activating RAS or PIK3CA mutations, thereby providing an alternative driving force for PI3K/Akt pathway activation, warrants investigation. However, CS-associated tumours typically exhibit conventional morphology, whereas desmoplastic features are sometimes seen in CS-unrelated tumours, particularly when associated with NS. This implies that pathways other than PI3K/Akt activated by oncogenic H-Ras account for the morphological differences, and this might lessen the probability that CS-associated trichilemmomas would also harbour HRAS mutations. In our series, most NS-unrelated tumours, including 50% of conventional trichilemmomas, harboured HRAS mutations. In addition, both conventional and desmoplastic morphologies could be associated with either c.37G>C or c.182A>G mutations. In combination with the previous PTEN immunohistochemical study,5 these findings suggest that the pathogenesis of sporadic conventional and desmoplastic trichilemmomas is similar, but is probably distinct from that of CS-associated tumours. In conclusion, we confirmed that trichilemmomas occurring in NS carried the same HRAS genotype as the NS. More importantly, we demonstrated that sporadic, NS-unrelated tumours also commonly harboured activating HRAS mutations, thus providing molecular evidence that most trichilemmomas are authentic neoplasms.
References 1 Richfield DF. Tricholemmoma. True and false types. Am J Dermatopathol 1980; 2:233–4. 2 Ackerman AB, Wade TR. Tricholemmoma. Am J Dermatopathol 1980; 2:207–24. 3 Brownstein MH. Trichilemmoma. Benign follicular tumor or viral wart? Am J Dermatopathol 1980; 2:229–31. 4 Reed RJ. Tricholemmoma. A cutaneous hamartoma. Am J Dermatopathol 1980; 2:227–8.
© 2014 British Association of Dermatologists
5 Al-Zaid T, Ditelberg JS, Prieto VG et al. Trichilemmomas show loss of PTEN in Cowden syndrome but only rarely in sporadic tumors. J Cutan Pathol 2012; 39:493–9. 6 Groesser L, Herschberger E, Ruetten A et al. Postzygotic HRAS and KRAS mutations cause nevus sebaceous and Schimmelpenning syndrome. Nat Genet 2012; 44:783–7. 7 Sun BK, Saggini A, Sarin KY et al. Mosaic activating RAS mutations in nevus sebaceus and nevus sebaceus syndrome. J Invest Dermatol 2013; 133:824–7. 8 Levinsohn JL, Tian LC, Boyden LM et al. Whole-exome sequencing reveals somatic mutations in HRAS and KRAS, which cause nevus sebaceus. J Invest Dermatol 2013; 133:827–30. 9 Groesser L, Herschberger E, Sagrera A et al. Phacomatosis pigmentokeratotica is caused by a postzygotic HRAS mutation in a multipotent progenitor cell. J Invest Dermatol 2013; 133:1998–2003. 10 Hafner C, L opez-Knowles E, Luis NM et al. Oncogenic PIK3CA mutations occur in epidermal nevi and seborrheic keratoses with a characteristic mutation pattern. Proc Natl Acad Sci USA 2007; 104:13450–4. 11 Costello JM. A new syndrome: mental subnormality and nasal papillomata. Aust Paediatr J 1977; 13:114–18. 12 Hennekam RC. Costello syndrome: an overview. Am J Med Genet C Semin Med Genet 2003; 117C:42–8. 13 Aoki Y, Niihori T, Kawame H et al. Germline mutations in HRAS proto-oncogene cause Costello syndrome. Nat Genet 2005; 37:1038–40. 14 Gripp KW, Lin AE, Stabley DL et al. HRAS mutation analysis in Costello syndrome: genotype and phenotype correlation. Am J Med Genet A 2006; 140:1–7. 15 Kerr B, Delrue MA, Sigaudy S et al. Genotype–phenotype correlation in Costello syndrome: HRAS mutation analysis in 43 cases. J Med Genet 2006; 43:401–5. 16 Hafner C, Toll A, Gantner S et al. Keratinocytic epidermal nevi are associated with mosaic RAS mutations. J Med Genet 2012; 49:249– 53. 17 Orloff MS, He X, Peterson C et al. Germline PIK3CA and AKT1 mutations in Cowden and Cowden-like syndromes. Am J Hum Genet 2013; 92:76–80. 18 Yan J, Roy S, Apolloni A et al. Ras isoforms vary in their ability to activate Raf-1 and phosphoinositide 3-kinase. J Biol Chem 1998; 273:24052–6.
British Journal of Dermatology (2014) 171, pp1073–1077
