Journal of the Neurological Sciences 351 (2015) 124–126
Contents lists available at ScienceDirect
Journal of the Neurological Sciences journal homepage: www.elsevier.com/locate/jns
Friedreich's Ataxia (FRDA) is an extremely rare cause of autosomal recessive ataxia in Chinese Han population Junsheng Zeng a, Junling Wang a,b,c, Sheng Zeng a, Miao He a, Xianfeng Zeng a, Yao Zhou a, Zhen Liu a, Hong Jiang a,b,c, Beisha Tang a,b,c,⁎ a b c
Department of Neurology, Xiangya Hospital, Central South University, Changsha, Hunan, PR China Key Laboratory of Hunan Province in Neurodegenerative Disorders, Changsha, Hunan, PR China State Key Laboratory of Medical Genetics, Changsha, Hunan, PR China
a r t i c l e
i n f o
Article history: Received 29 January 2015 Accepted 1 March 2015 Available online 6 March 2015 Keywords: Friedreich's Ataxia TP-PCR GAA repeats ARCA Molecular genetics Chinese Han population
a b s t r a c t Friedreich's Ataxia (FRDA) is a very common cause of hereditary autosomal recessive ataxia among western Europeans. We aim to define the frequency of FRDA in Chinese Han population due to the lack of reports of FRDA in China. The GAA trinucleotide repeats in the FXN gene were analyzed by triplet repeat-primed PCR (TP-PCR) in 122 unrelated hereditary ataxia (HA) and 114 unrelated hereditary spastic paraplegia (HSP) patients. The GAA copy numbers in the FXN gene of all the subjects ranged from 5 to 16. There were no FRDA patients that could be diagnosed base on the results of TP-PCR. It suggests that FRDA is a very rare cause of inheritance ataxia and FRDA genetic analysis should not be used as a routine genetic diagnosis test in China. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Friedreich's Ataxia (FRDA) is one of the most common causes of inheritance ataxia in the white population with an incidence rate of 1:30,000–1:50,000 [1]. The carrier frequency of a mutant of Frataxin (FXN) gene is approximately 1 in 100. Most typical patients of FRDA were suffering disorders like progressive ataxia (body and limbs), dysarthria, deep tendon loss, and weakness presenting in their first or second decade of life. Cardiac, skeletal and endocrinologic disorders presenting in parts of FRDA patients are considered secondary symptoms because of the deficient normal functional frataxin levels [2,3]. Furthermore, in a number of atypical cases of FRDA, tendon reflexes may be preserved (FRDA with retained reflexes [FARR]). There are also some atypical cases of mild disorders with delayed onset after 25 years of age (late-onset FRDA [LOFA]) or even 40 years of age (very late-onset FRDA [VLOFA]) [1,4]. In addition, it was also reported that some Acadians of FRDA had retained or increased deep tendon reflexes and spasticity [5]. In molecular genetics, more than 95% of FRDA individuals are homozygous GAA (TTC) repeat expansion in first intron of the FXN gene, the other affected individuals are heterozygous with one
⁎ Corresponding author at: Department of Neurology, Xiangya Hospital, Central South University, Changsha, Hunan 410008, PR China. Tel.: +86 731 84327398; fax: +86 731 84327332. E-mail address: [email protected] (B. Tang).
http://dx.doi.org/10.1016/j.jns.2015.03.002 0022-510X/© 2015 Elsevier B.V. All rights reserved.
DNA allele of expanded GAA repeats and the other allele of a point mutation or an exonic deletion [4,6–9]. Conversely, there are no confirmed FRDA cases, whether from a typical clinical diagnosis or genetic diagnosis in China. To further define the frequency of FRDA in Chinese Han population, we examined the object region in first intron of FXN gene in 236 unrelated probands diagnosed as HA or HSP by triplet repeat primed PCR (TP-PCR). 2. Materials and methods 2.1. Subjects The DNA triplet (GAA) repeats analysis of the FXN gene was carried out in 236 Chinese Han patients recruited from the outpatient neurology clinics of Xiangya Hospital of Central South University from February 1994 to December 2013. The subjects were from 20 provinces in the Chinese mainland where most Chinese Han population are from, including Hunan, Hubei, Henan, Hebei, Zhejiang, Anhui, Gansu, Beijing, and Shandong. All of the individuals had a clinical diagnosis based on the Harding diagnostic criteria. The 122 unrelated probands of SCA (recessive or sporadic) were previously excluded for mutations on SCA1, 2, 3, 6, 7, 12, 17, DRPLA and AVED, AOV1, AOV2 gene. The other patients of 114 unrelated probands of HSP (recessive or sporadic) were excluded for mutations on SPG3, 4, 6, 7, 10, 11, 15, 31, 35, 42 gene. This cohort consisted of 58 familial cases and 178 seemingly sporadic individuals, including 139 men and 97 women with a mean age of
J. Zeng et al. / Journal of the Neurological Sciences 351 (2015) 124–126 Table 1 Primers of PCR reaction. Forward primer Reverse primer Repeat primer-R Universal primer
FAM-GGGATTGGTTGCCAGTGCTTAAAAGTTAG TTGAGACGGAGTCTTGCTCTGTCG TACGCATCCCAGTTTGAGACGTTCTTCTTCTTCTTCTTCTTCTTC TACGCATCCCAGTTTGAGACG
125
shown in Table 1. For DNA fragment analysis, 1 μl of a PCR product were added to 10 μl of formamide and 0.5 μl of internal lane standard; this mixture was denatured at 95 °C for 3 min, and immediately cooled on ice. These samples were then injected into an ABI PRISM 3730 Genetic Analyzer (Applied Biosystems), and the fragments were analyzed by GeneMapper software (Applied Biosystems). 2.3. Triplet repeat-primed PCR
30.39 ± 15.04 years. Informed consent was obtained from all subjects, as approved by the Ethical Committee of Xiangya Hospital of the Central South University in China (equivalent to an Institutional Review Board). After obtaining informed consent, blood samples were obtained from the 236 patients described above. Genomic DNA was extracted from peripheral blood using standard extraction methods. 2.2. Conventional PCR To detect the GAA repeat, the conventional PCR method was first used. The target sequence covering GAA repeat was amplified with a pair of fluorescently labeled primers (forward primer & reverse primer)
For individuals apparently homozygous for small common repeat size according to the results of conventional PCR, TP-PCR was necessarily performed. Three primers were used also shown in Table 1. The forward primer was a fluorescently labeled locus-specific primer; the repeat primer-R was a GAA repeat-specific primer with a random DNA sequence at the 5′ end, whereas the universal primer contained the same 5′ sequence as repeat primer-R. PCR reactions were performed in 10 μl reaction volumes containing 50 ng of genomic DNA, 0.2 μl of FastStart Taq DNA polymerase (Roche, Switzerland), 1 μl 10 × PCR buffer, 1 μl 5 × Q-solution, 2 μM of dNTP mix, 0.36 μl 7-deaza-dGTP, 0.7 μl 100% DMSO, 6 μM of forward primer and universal primer each, 1 μM
Fig. 1. a. The normal GAA repeats of European and the detected GAA copies of Chinese subjects. b. The haploid count distribution (N = 472) GAA repeats in FXN gene of Chinese subjects. c. The peak figure of PCR.
126
J. Zeng et al. / Journal of the Neurological Sciences 351 (2015) 124–126
of repeat primer-R. The reactions were subjected to a touchdown procedure (down 1 °C/cycle) of 15 cycles of 95 °C for 1 min, 70 °C for 1 min, and 72 °C for 3 min followed by 25 cycles of 95 °C for 1 min, 56 °C for 1 min, and 72 °C for 3 min. DNA fragment analysis of TP-PCR product was the same as conventional PCR above.
FRDA genetic analysis should not be a routine genetic diagnosis test in China. Conflict of interest statement The authors declare that they have no conflict of interest.
3. Results Acknowledgments There were 70 samples apparently homozygous by conventional PCR and then no pathological expansion of GAA repeats detected by TP-PCR. The GAA copy numbers of all the subjects ranged from 5 to 16. The most common GAA repeat of the 236 individuals (haploid count of 472) was 9 copies. The details are shown below (Fig. 1). 4. Discussion FRDA has been recognized as the most common autosomal recessive neurodegenerative disorder worldwide especially among the white population. Nearly 98% of FRDA patients suffered from progressive cerebellar ataxia before 25 years old. In the atypical cases of FRDA, it seems that tendon reflexes could be retained ([FARR]) even increased (SA in Acadians) [1, 4]. Therefore, the lack of typical features does not exclude FRDA as a possible diagnosis. The AR or sporadic HA and HSP patients were selected for this study whether with representative characteristics or not. It is generally accepted that a patient with autosomal recessive ataxia with at least one allele of expansion of GAA repeat size increased to 66–N 1700 repeats can be diagnosed with FRDA [10]. Normally, the GAA repeats could be detected by Southern blot analysis or long PCR. Effectively, the triplet repeat primed PCR (TP-PCR, or called repeat primed PCR [RP-PCR]) [11] is proven to be a concise method for detecting large pathogenic trinucleotide repeats [12–15] without multistep procedures. According to the results, no expansion of GAA repeats was detected. The GAA copy number of the subjects is between 5 and 16 copies with 7 to 9 copies as the most common GAA repeats (97.2%) of the subjects. However, the epidemiological data of European showed that the normal size range of the GAA repeat is from 6 to 34 repeats, 83% of them ranges 6 to 12 repeats and the others of 14 to 34 repeats (http://neuromuscular.wustl.edu/ataxia/recatax.html). This suggests that the Chinese Han population has lower GAA repeats of FXN gene presumably based on their different genetic background and the ethnic differences between European and Chinese Han population. We may also suppose that it is one cause of the low incidence of FRDA in China. 5. Conclusion In conclusion, the results supported that FRDA is a very rare cause of inheritance ataxia in China. It is the first time there is exact data showing that no Friedreich's Ataxia can be found in Chinese Han population. The
We are grateful to the participating patients for their involvement. This study was supported by the program of the National Natural Science Foundation of China (#81130021, 81300981, 81250015), the National Department Public Benefit Research Foundation (#201302001), key projects in the National Science & Technology Pillar Program during the Twelfth Five-year Plan Period (#2012BAI09B04). Fundamental Research Funds for the Central Universities (#2012QNZT107) and a grant from the Research Fund for the Doctoral Program of Higher Education of China (#20120162120048). References [1] Collins A. Clinical neurogenetics: Friedreich ataxia. Neurol Clin 2013;31:1095–120. [2] McCabe DJ, Ryan F, Moore DP, McQuaid S, King MD, Kelly A, et al. Typical Friedreich's ataxia without GAA expansions and GAA expansion without typical Friedreich's ataxia. J Neurol 2000;247:346–55. [3] Pearce JM. Friedreich's ataxia. J Neurol Neurosurg Psychiatry 2004;75:688. [4] Parkinson MH, Boesch S, Nachbauer W, Mariotti C, Giunti P. Clinical features of Friedreich's ataxia: classical and atypical phenotypes. J Neurochem 2013; 126(Suppl. 1):103–17. [5] Richter A, Poirier J, Mercier J, Julien D, Morgan K, Roy M, et al. Friedreich ataxia in Acadian families from eastern Canada: clinical diversity with conserved haplotypes. Am J Med Genet 1996;64:594–601. [6] Gellera C, Castellotti B, Mariotti C, Mineri R, Seveso V, Didonato S, et al. Frataxin gene point mutations in Italian Friedreich ataxia patients. Neurogenetics 2007;8:289–99. [7] Zuhlke CH, Dalski A, Habeck M, Straube K, Hedrich K, Hoeltzenbein M, et al. Extension of the mutation spectrum in Friedreich's ataxia: detection of an exon deletion and novel missense mutations. Eur J Hum Genet 2004;12:979–82. [8] Anheim M, Mariani LL, Calvas P, Cheuret E, Zagnoli F, Odent S, et al. Exonic deletions of FXN and early-onset Friedreich ataxia. Arch Neurol 2012;69:912–6. [9] Pandolfo M. Friedreich ataxia: detection of GAA repeat expansions and frataxin point mutations. Methods Mol Med 2006;126:197–216. [10] Yandim C, Natisvili T, Festenstein R. Gene regulation and epigenetics in Friedreich's ataxia. J Neurochem 2013;126(Suppl. 1):21–42. [11] Warner JP, Barron LH, Goudie D, Kelly K, Dow D, Fitzpatrick DR, et al. A general method for the detection of large CAG repeat expansions by fluorescent PCR. J Med Genet 1996;33:1022–6. [12] Ciotti P, Di Maria E, Bellone E, Ajmar F, Mandich P. Triplet repeat primed PCR (TP PCR) in molecular diagnostic testing for Friedreich ataxia. J Mol Diagn 2004;6: 285–9. [13] Ishige T, Sawai S, Itoga S, Sato K, Utsuno E, Beppu M, et al. Pentanucleotide repeatprimed PCR for genetic diagnosis of spinocerebellar ataxia type 31. J Hum Genet 2012;57:807–8. [14] Cagnoli C, Michielotto C, Matsuura T, Ashizawa T, Margolis RL, Holmes SE, et al. Detection of large pathogenic expansions in FRDA1, SCA10, and SCA12 genes using a simple fluorescent repeat-primed PCR assay. J Mol Diagn 2004;6:96–100. [15] Krysa W, Rajkiewicz M, Sulek A. Rapid detection of large expansions in progressive myoclonus epilepsy type 1, myotonic dystrophy type 2 and spinocerebellar ataxia type 8. Neurol Neurochir Pol 2012;46:113–20.
Contents lists available at ScienceDirect
Journal of the Neurological Sciences journal homepage: www.elsevier.com/locate/jns
Friedreich's Ataxia (FRDA) is an extremely rare cause of autosomal recessive ataxia in Chinese Han population Junsheng Zeng a, Junling Wang a,b,c, Sheng Zeng a, Miao He a, Xianfeng Zeng a, Yao Zhou a, Zhen Liu a, Hong Jiang a,b,c, Beisha Tang a,b,c,⁎ a b c
Department of Neurology, Xiangya Hospital, Central South University, Changsha, Hunan, PR China Key Laboratory of Hunan Province in Neurodegenerative Disorders, Changsha, Hunan, PR China State Key Laboratory of Medical Genetics, Changsha, Hunan, PR China
a r t i c l e
i n f o
Article history: Received 29 January 2015 Accepted 1 March 2015 Available online 6 March 2015 Keywords: Friedreich's Ataxia TP-PCR GAA repeats ARCA Molecular genetics Chinese Han population
a b s t r a c t Friedreich's Ataxia (FRDA) is a very common cause of hereditary autosomal recessive ataxia among western Europeans. We aim to define the frequency of FRDA in Chinese Han population due to the lack of reports of FRDA in China. The GAA trinucleotide repeats in the FXN gene were analyzed by triplet repeat-primed PCR (TP-PCR) in 122 unrelated hereditary ataxia (HA) and 114 unrelated hereditary spastic paraplegia (HSP) patients. The GAA copy numbers in the FXN gene of all the subjects ranged from 5 to 16. There were no FRDA patients that could be diagnosed base on the results of TP-PCR. It suggests that FRDA is a very rare cause of inheritance ataxia and FRDA genetic analysis should not be used as a routine genetic diagnosis test in China. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Friedreich's Ataxia (FRDA) is one of the most common causes of inheritance ataxia in the white population with an incidence rate of 1:30,000–1:50,000 [1]. The carrier frequency of a mutant of Frataxin (FXN) gene is approximately 1 in 100. Most typical patients of FRDA were suffering disorders like progressive ataxia (body and limbs), dysarthria, deep tendon loss, and weakness presenting in their first or second decade of life. Cardiac, skeletal and endocrinologic disorders presenting in parts of FRDA patients are considered secondary symptoms because of the deficient normal functional frataxin levels [2,3]. Furthermore, in a number of atypical cases of FRDA, tendon reflexes may be preserved (FRDA with retained reflexes [FARR]). There are also some atypical cases of mild disorders with delayed onset after 25 years of age (late-onset FRDA [LOFA]) or even 40 years of age (very late-onset FRDA [VLOFA]) [1,4]. In addition, it was also reported that some Acadians of FRDA had retained or increased deep tendon reflexes and spasticity [5]. In molecular genetics, more than 95% of FRDA individuals are homozygous GAA (TTC) repeat expansion in first intron of the FXN gene, the other affected individuals are heterozygous with one
⁎ Corresponding author at: Department of Neurology, Xiangya Hospital, Central South University, Changsha, Hunan 410008, PR China. Tel.: +86 731 84327398; fax: +86 731 84327332. E-mail address: [email protected] (B. Tang).
http://dx.doi.org/10.1016/j.jns.2015.03.002 0022-510X/© 2015 Elsevier B.V. All rights reserved.
DNA allele of expanded GAA repeats and the other allele of a point mutation or an exonic deletion [4,6–9]. Conversely, there are no confirmed FRDA cases, whether from a typical clinical diagnosis or genetic diagnosis in China. To further define the frequency of FRDA in Chinese Han population, we examined the object region in first intron of FXN gene in 236 unrelated probands diagnosed as HA or HSP by triplet repeat primed PCR (TP-PCR). 2. Materials and methods 2.1. Subjects The DNA triplet (GAA) repeats analysis of the FXN gene was carried out in 236 Chinese Han patients recruited from the outpatient neurology clinics of Xiangya Hospital of Central South University from February 1994 to December 2013. The subjects were from 20 provinces in the Chinese mainland where most Chinese Han population are from, including Hunan, Hubei, Henan, Hebei, Zhejiang, Anhui, Gansu, Beijing, and Shandong. All of the individuals had a clinical diagnosis based on the Harding diagnostic criteria. The 122 unrelated probands of SCA (recessive or sporadic) were previously excluded for mutations on SCA1, 2, 3, 6, 7, 12, 17, DRPLA and AVED, AOV1, AOV2 gene. The other patients of 114 unrelated probands of HSP (recessive or sporadic) were excluded for mutations on SPG3, 4, 6, 7, 10, 11, 15, 31, 35, 42 gene. This cohort consisted of 58 familial cases and 178 seemingly sporadic individuals, including 139 men and 97 women with a mean age of
J. Zeng et al. / Journal of the Neurological Sciences 351 (2015) 124–126 Table 1 Primers of PCR reaction. Forward primer Reverse primer Repeat primer-R Universal primer
FAM-GGGATTGGTTGCCAGTGCTTAAAAGTTAG TTGAGACGGAGTCTTGCTCTGTCG TACGCATCCCAGTTTGAGACGTTCTTCTTCTTCTTCTTCTTCTTC TACGCATCCCAGTTTGAGACG
125
shown in Table 1. For DNA fragment analysis, 1 μl of a PCR product were added to 10 μl of formamide and 0.5 μl of internal lane standard; this mixture was denatured at 95 °C for 3 min, and immediately cooled on ice. These samples were then injected into an ABI PRISM 3730 Genetic Analyzer (Applied Biosystems), and the fragments were analyzed by GeneMapper software (Applied Biosystems). 2.3. Triplet repeat-primed PCR
30.39 ± 15.04 years. Informed consent was obtained from all subjects, as approved by the Ethical Committee of Xiangya Hospital of the Central South University in China (equivalent to an Institutional Review Board). After obtaining informed consent, blood samples were obtained from the 236 patients described above. Genomic DNA was extracted from peripheral blood using standard extraction methods. 2.2. Conventional PCR To detect the GAA repeat, the conventional PCR method was first used. The target sequence covering GAA repeat was amplified with a pair of fluorescently labeled primers (forward primer & reverse primer)
For individuals apparently homozygous for small common repeat size according to the results of conventional PCR, TP-PCR was necessarily performed. Three primers were used also shown in Table 1. The forward primer was a fluorescently labeled locus-specific primer; the repeat primer-R was a GAA repeat-specific primer with a random DNA sequence at the 5′ end, whereas the universal primer contained the same 5′ sequence as repeat primer-R. PCR reactions were performed in 10 μl reaction volumes containing 50 ng of genomic DNA, 0.2 μl of FastStart Taq DNA polymerase (Roche, Switzerland), 1 μl 10 × PCR buffer, 1 μl 5 × Q-solution, 2 μM of dNTP mix, 0.36 μl 7-deaza-dGTP, 0.7 μl 100% DMSO, 6 μM of forward primer and universal primer each, 1 μM
Fig. 1. a. The normal GAA repeats of European and the detected GAA copies of Chinese subjects. b. The haploid count distribution (N = 472) GAA repeats in FXN gene of Chinese subjects. c. The peak figure of PCR.
126
J. Zeng et al. / Journal of the Neurological Sciences 351 (2015) 124–126
of repeat primer-R. The reactions were subjected to a touchdown procedure (down 1 °C/cycle) of 15 cycles of 95 °C for 1 min, 70 °C for 1 min, and 72 °C for 3 min followed by 25 cycles of 95 °C for 1 min, 56 °C for 1 min, and 72 °C for 3 min. DNA fragment analysis of TP-PCR product was the same as conventional PCR above.
FRDA genetic analysis should not be a routine genetic diagnosis test in China. Conflict of interest statement The authors declare that they have no conflict of interest.
3. Results Acknowledgments There were 70 samples apparently homozygous by conventional PCR and then no pathological expansion of GAA repeats detected by TP-PCR. The GAA copy numbers of all the subjects ranged from 5 to 16. The most common GAA repeat of the 236 individuals (haploid count of 472) was 9 copies. The details are shown below (Fig. 1). 4. Discussion FRDA has been recognized as the most common autosomal recessive neurodegenerative disorder worldwide especially among the white population. Nearly 98% of FRDA patients suffered from progressive cerebellar ataxia before 25 years old. In the atypical cases of FRDA, it seems that tendon reflexes could be retained ([FARR]) even increased (SA in Acadians) [1, 4]. Therefore, the lack of typical features does not exclude FRDA as a possible diagnosis. The AR or sporadic HA and HSP patients were selected for this study whether with representative characteristics or not. It is generally accepted that a patient with autosomal recessive ataxia with at least one allele of expansion of GAA repeat size increased to 66–N 1700 repeats can be diagnosed with FRDA [10]. Normally, the GAA repeats could be detected by Southern blot analysis or long PCR. Effectively, the triplet repeat primed PCR (TP-PCR, or called repeat primed PCR [RP-PCR]) [11] is proven to be a concise method for detecting large pathogenic trinucleotide repeats [12–15] without multistep procedures. According to the results, no expansion of GAA repeats was detected. The GAA copy number of the subjects is between 5 and 16 copies with 7 to 9 copies as the most common GAA repeats (97.2%) of the subjects. However, the epidemiological data of European showed that the normal size range of the GAA repeat is from 6 to 34 repeats, 83% of them ranges 6 to 12 repeats and the others of 14 to 34 repeats (http://neuromuscular.wustl.edu/ataxia/recatax.html). This suggests that the Chinese Han population has lower GAA repeats of FXN gene presumably based on their different genetic background and the ethnic differences between European and Chinese Han population. We may also suppose that it is one cause of the low incidence of FRDA in China. 5. Conclusion In conclusion, the results supported that FRDA is a very rare cause of inheritance ataxia in China. It is the first time there is exact data showing that no Friedreich's Ataxia can be found in Chinese Han population. The
We are grateful to the participating patients for their involvement. This study was supported by the program of the National Natural Science Foundation of China (#81130021, 81300981, 81250015), the National Department Public Benefit Research Foundation (#201302001), key projects in the National Science & Technology Pillar Program during the Twelfth Five-year Plan Period (#2012BAI09B04). Fundamental Research Funds for the Central Universities (#2012QNZT107) and a grant from the Research Fund for the Doctoral Program of Higher Education of China (#20120162120048). References [1] Collins A. Clinical neurogenetics: Friedreich ataxia. Neurol Clin 2013;31:1095–120. [2] McCabe DJ, Ryan F, Moore DP, McQuaid S, King MD, Kelly A, et al. Typical Friedreich's ataxia without GAA expansions and GAA expansion without typical Friedreich's ataxia. J Neurol 2000;247:346–55. [3] Pearce JM. Friedreich's ataxia. J Neurol Neurosurg Psychiatry 2004;75:688. [4] Parkinson MH, Boesch S, Nachbauer W, Mariotti C, Giunti P. Clinical features of Friedreich's ataxia: classical and atypical phenotypes. J Neurochem 2013; 126(Suppl. 1):103–17. [5] Richter A, Poirier J, Mercier J, Julien D, Morgan K, Roy M, et al. Friedreich ataxia in Acadian families from eastern Canada: clinical diversity with conserved haplotypes. Am J Med Genet 1996;64:594–601. [6] Gellera C, Castellotti B, Mariotti C, Mineri R, Seveso V, Didonato S, et al. Frataxin gene point mutations in Italian Friedreich ataxia patients. Neurogenetics 2007;8:289–99. [7] Zuhlke CH, Dalski A, Habeck M, Straube K, Hedrich K, Hoeltzenbein M, et al. Extension of the mutation spectrum in Friedreich's ataxia: detection of an exon deletion and novel missense mutations. Eur J Hum Genet 2004;12:979–82. [8] Anheim M, Mariani LL, Calvas P, Cheuret E, Zagnoli F, Odent S, et al. Exonic deletions of FXN and early-onset Friedreich ataxia. Arch Neurol 2012;69:912–6. [9] Pandolfo M. Friedreich ataxia: detection of GAA repeat expansions and frataxin point mutations. Methods Mol Med 2006;126:197–216. [10] Yandim C, Natisvili T, Festenstein R. Gene regulation and epigenetics in Friedreich's ataxia. J Neurochem 2013;126(Suppl. 1):21–42. [11] Warner JP, Barron LH, Goudie D, Kelly K, Dow D, Fitzpatrick DR, et al. A general method for the detection of large CAG repeat expansions by fluorescent PCR. J Med Genet 1996;33:1022–6. [12] Ciotti P, Di Maria E, Bellone E, Ajmar F, Mandich P. Triplet repeat primed PCR (TP PCR) in molecular diagnostic testing for Friedreich ataxia. J Mol Diagn 2004;6: 285–9. [13] Ishige T, Sawai S, Itoga S, Sato K, Utsuno E, Beppu M, et al. Pentanucleotide repeatprimed PCR for genetic diagnosis of spinocerebellar ataxia type 31. J Hum Genet 2012;57:807–8. [14] Cagnoli C, Michielotto C, Matsuura T, Ashizawa T, Margolis RL, Holmes SE, et al. Detection of large pathogenic expansions in FRDA1, SCA10, and SCA12 genes using a simple fluorescent repeat-primed PCR assay. J Mol Diagn 2004;6:96–100. [15] Krysa W, Rajkiewicz M, Sulek A. Rapid detection of large expansions in progressive myoclonus epilepsy type 1, myotonic dystrophy type 2 and spinocerebellar ataxia type 8. Neurol Neurochir Pol 2012;46:113–20.
