Research
Functional analysis of the Arabidopsis thaliana CHLOROPLAST BIOGENESIS 19 pentatricopeptide repeat editing protein Maricela Ramos-Vega1, Arturo Guevara-Garcıa1, Ernesto Llamas1, Nidia Sa nchez-Le on2, Vianey Olmedo-Monfil2, Jean Philippe Vielle-Calzada2 and Patricia Le on1 1
Departamento de Biologıa Molecular de Plantas, Instituto de Biotecnologıa, Universidad Nacional Autonoma de Mexico, Av. Universidad 2001, Col. Chamilpa, Cuernavaca 62210, Mexico;
2
Grupo de Desarrollo Reproductivo y Apomixis, Laboratorio Nacional de Genomica para la Biodiversidad, CINVESTAV, Irapuato 36821, Mexico
Summary Author for correspondence: n Patricia Leo Tel: +52 55 5622 7856 Email: [email protected] Received: 8 January 2015 Accepted: 16 April 2015
New Phytologist (2015) 208: 430–441 doi: 10.1111/nph.13468
Key words: chloroplast, CLB19, ClpP protease, female gametogenesis, pentatricopeptide repeat (PPR) proteins, plastid-encoded RNA polymerase, RNA editing, RNA-binding proteins.
The Arabidopsis thaliana pentatricopeptide repeat (PPR) family of proteins contains several degenerate 35-aa motifs named PPR repeats. These proteins control diverse post-transcriptional regulatory mechanisms, including RNA editing. CLB19 belongs to the PLS subfamily of PPR proteins and is essential for the editing and functionality of the subunit A of plastidencoded RNA polymerase (RpoA) and the catalytic subunit of the Clp protease (ClpP1). We demonstrate in vitro that CLB19 has a specific interaction with these two targets, in spite of their modest sequence similarity. Using site-directed mutagenesis of the rpoA target, we analyzed the essential nucleotides required for CLB19–rpoA interactions. We verified that, similar to other editing proteins, the C-terminal E domain of CLB19 is essential for editing but not for RNA binding. Using biomolecular fluorescence complementation, we demonstrated that the E domain of CLB19 interacts with the RNA-interacting protein MORF2/RIP2 but not with MORF9/RIP9. An interesting finding from this analysis was that overexpression of a truncated CLB19 protein lacking the E domain interferes with cell fate during megasporogenesis and the subsequent establishment of a female gametophyte, supporting an important role of plastids in female gametogenesis. Together these analyses provide important clues about the particularities of the CLB19 editing protein.
Introduction One of the most representative classes of proteins involved in the regulation of different aspects of plastid and mitochondria functions is the pentatricopeptide repeat (PPR) protein family (Small & Peeters, 2000). These proteins are found in most eukaryotes but have expanded in terrestrial plants and represent one of the largest families in these lineages, with > 400 members in Arabidopsis thaliana and 600 in rice genomes (SchmitzLinneweber & Small, 2008). Structurally, PPR proteins are characterized by the presence of tandem arrays of a degenerate 35-amino acid motif, known as PPR (Lurin et al., 2004). Crystal structure analysis has shown that this PPR motif folds into a pair of antiparallel a-helices (Ban et al., 2013; Ke et al., 2013; Yin et al., 2013; Gully et al., 2015). The structure of the PPR motif is related to the tetratricopeptide repeat (TPR), which makes both proteins members of the alpha-solenoid superfamily (Kobe & Kajava, 2000). In some cases the PPR motifs constitute the entire PPR protein (i.e. the so-called P subfamily), whereas in others additional domains unrelated to PPR (E or DYW) are present (i.e. the so-called PLS subfamily). These non-PPR motifs in the PLS subfamily are always localized at the carboxy-termini of the proteins (O’Toole et al., 2008). 430 New Phytologist (2015) 208: 430–441 www.newphytologist.com
The PPR proteins in plants are nuclear-encoded and with few exceptions are targeted to mitochondria or plastids. In these organelles, PPR proteins are known to participate in diverse posttranscriptional processes, including RNA processing, splicing, RNA stability, editing and translation (Delannoy et al., 2007; Schmitz-Linneweber & Small, 2008; Pfalz et al., 2009). As a consequence, the majority of mutations in these proteins result in defects in either plastids or mitochondrial functions (Fisk et al., 1999; Gutierrez-Marcos et al., 2007). In spite of their structural similarity, PPR functional redundancy is limited. Molecular and biochemical evidence has shown that most PPR proteins target specific RNAs (Nakamura et al., 2012). RNA editing is a post-transcriptional modification that alters the sequence of a transcript by insertion, deletion or conversion of specific bases, changing the RNA sequence encoded by the DNA (Shikanai, 2006; Chateigner-Boutin & Small, 2010). Editing is a prevalent modification in plant organelles with > 600 sites in the mitochondria and 43 sites in the plastids of Arabidopsis thaliana (Bentolila et al., 2008). RNA editing in plant mitochondria and plastids involves the conversion of cytidine (C) to uridine (U) as a result of a deamination reaction (ChateignerBoutin & Small, 2010; Takenaka et al., 2013b; Yagi et al., 2013b). Thus, RNA editing defects could result in amino acid Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
New Phytologist substitutions in the nonedited protein that causes either premature protein termination or affects protein activity or stability. Almost all PPR proteins that participate in RNA editing described so far belong to the PLS subfamily, containing E or DYW domains at their carboxy terminal ends (Fujii & Small, 2011). One of these proteins is CLB19 required for editing the plastid transcripts encoding the subunit A of the chloroplastencoded RNA polymerase (rpoA) and the catalytic subunit of the Clp protease complex (clpP1). Mutations in CLB19 result in plants with a pale yellow phenotype that is lethal during early seedling development due to the lack of photosynthesis (Chateigner-Boutin et al., 2008). The cis-acting elements required for C recognition during the editing process have been widely analyzed (Chateigner-Boutin et al., 2008; Okuda & Shikanai, 2012). Biochemical data shows that the sequences essential for recognition are located within 20 to 10 nucleotides surrounding the editing site (Chaudhuri & Maliga, 1996; Farre et al., 2001). In vivo and in vitro evidence has further demonstrated that direct binding of the PPR protein to the single-stranded RNA near the editing site is essential (Miyamoto et al., 2004; Kobayashi et al., 2008; Okuda & Shikanai, 2012). However, in several examples the sequences recognized by the same PPR protein lack a consensus sequence; this demonstrates that the recognition mechanism is complex (Chateigner-Boutin et al., 2008; Okuda & Shikanai, 2012). Recent analyses using bioinformatics have provided insights into the general mechanism of RNA recognition by the PPR proteins. These studies imply that two or three independent amino acids at specific positions in each PPR repeat (3, 6 and 1ʹ of the following PPR repeat) are responsible for nucleotide specificity following a one-PPR motif to one-nucleotide recognition mode (Barkan et al., 2012; Takenaka et al., 2013a; Yagi et al., 2013a). Based on this code, the prediction of the recognition sites of some PPR proteins has been possible (Barkan et al., 2012; Takenaka et al., 2013a). Experimental support for this model has accumulated for the P-type of PPR proteins but, with few exceptions, support is still lacking for the PLS subfamily, which in addition to the E and DWY motifs also contain noncanonical subtypes of longer (L/38 aa) and shorter (S/32 aa) PPR motifs. The function of the E and DYW motifs present in these editing factors is also unclear. A role for the DYW domain in the deamination reaction has been proposed, but no experimental proof through enzymatic activity assays has been obtained (Nakamura & Sugita, 2008; Okuda et al., 2009; Boussardon et al., 2014; Wagoner et al., 2015). Other RNA proteins essential for editing such as RIP/MORF and ORRM have been found to interact with some PPR proteins. These RNA-interacting proteins are also required for editing, but their exact function in this process is not clear (Bentolila et al., 2012; Takenaka et al., 2012; Sun et al., 2013). The detailed analysis of specific PPR proteins that participate in editing has provided insight into the mechanism of action of these proteins. In this study, using an in vitro binding assay, we analyze the binding of the CLB19 PPR protein with its RNA targets. We demonstrate that CLB19 has specific interaction with Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
Research 431
the rpoA and clpP1 RNA targets displaying a similar affinity towards these transcripts in vitro. By creating variants of the sequence upstream of the rpoA editing site, we identify particular bases that are essential or dispensable for CLB19 binding. Similar to other editing PPR proteins, we find that the E domain of CLB19 is essential for editing, but in vitro this motif is not required for RNA recognition. Interestingly, overexpression of a truncated E domain protein results in the inability to establish a differentiated female gametophyte. This is a novel phenotype associated with the overexpression of the truncated version of the CLB19 protein of the E domain that supports an important role for the plastid during female gamete development. Finally, we also find that the E domain, although dispensable for the RNAbinding in vitro, is responsible for the interaction of CLB19 with the MORF2/RIP2 RNA-binding protein.
Materials and Methods Plant material and growth conditions Arabidopsis thaliana (L) Heynh. Columbia (Col-0) and Lansberg erecta (Ler) ecotypes were used in this study. Plants were grown under 16 h : 8 h, light : dark cycle (120 lmol m2 s1) at 22°C. Seed growth under sterile conditions was done in 1 9 Murashige and Skoog (MS) media with Gamborg vitamins (Phytotechology Laboratories, Shawnee Mission, KS, USA) supplemented with 1% (w/v) sucrose, solidified with 0.8% (w/v) phytoagar (Caisson, North Logan, UT, USA). Adult plants were grown in MetroMix 200 (SunGro, Bellevue, WA, USA). To generate the overexpressing CLB19 and CLB19-DE transgenic lines, the corresponding fragments were amplified using the CLB19-GW Fw and CLB19-GW Rv or CLB19-EE+ Rv oligonucleotides (Table 1) and cloned into the pFGC1008 binary vector Table 1 Oligonucleotides used in the work DNA oligonucleotides
Sequence
CLB19-GW Fw CLB19-GW Rv CLB19-GW-1012 Rv CLB19-EE+ Rv MORF2 GW Fw MORF2 GW Rv MORF9 GW Fw MORF9 GW Rv
CACCATGGGTCTCCTTCCCGT AGCATTGAGGAGATCACCAGC ATTTGGCTTCATTGGCATGCT CGGATCCGCGGCCGCTCACTTCATTGGCAT CACCTACAATGGCTTTGCCTTTGTC TGTGTTTTCTCTGCGGCGAG CACCGCAATGGCTTCCTTCACAACAA AGAGGAATCAGAGGCTGCTGG
RNA oligonucleotides
Sequence
RPOA RPOAc CLPP CLPPc RPOA M1 RPOA M2 RPOA M3 RPOA M4 RPOA M5 RPOA M6
GUAUUACACGUGCAAAAUCUGAGAAC CAUAAUGUGCACGUUUUAGACUCUUG GCAACAGAAGCCCAAGCUCAUGGAAU CGUUGUCUUCGGGUUCGAGUACCUUA GUAUUCCACGUGCAAAAUCUGAGAAC GUAUUACCCGUGCAAAAUCUGAGAAC GUAUUACACGUGCAAAAUCUGAGAAC GUAUUACACGUGAGCAAUCUGAGAAC GUAUUACACCAGCAAAAUCUGAGAAC GGCUUACACGUGCAAAAUCUGAGAAC
New Phytologist (2015) 208: 430–441 www.newphytologist.com
New Phytologist
432 Research
(https://www.arabidopsis.org/). The transgenes were transformed into heterozygous clb19 or Col-0 plants (Clough & Bent, 1998). Independent transgenic lines were identified based on their hygromycin resistance (50 lg ml1). Expression and purification of CLB19 and CLB19-DE recombinant proteins The CLB19 and CLB19-DE fragments were amplified from genomic DNA using the CLB19-GW FW and the CLB19-GW Rv or CLB19-GW-1012 Rv primers (Table 1) and cloned into the pENTR/D/TOPO (Gateway; Invitrogen). These clones were transferred into the pDEST17 destination vector (Earley et al., 2006) (Invitrogen), to generate the fusion proteins containing a His6X epitope tag; each plasmid construction was verified by DNA sequencing. Protein induction was done using IPTG (Inalco SpA, Milano, Italy) at a concentration of 500 lM for 4 h. Native protein purifications were done according to the protocol provided by the manufacturer using a Ni-NTA agarose column (Qiagen) and increasing amounts of imidazole (Qiagen). The concentration of the eluted proteins was determined by the Bradford method, and their purity was verified on a Coomassie stained sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) gel (Supporting Information Fig. S1). Preparation of RNA probes The RNA fragments used in the gel electrophoretic mobility shift assays (Table 1) were synthesized as RNA oligonucleotides (Sigma-Aldrich). Each oligoribonucleotide was end-labeled by incubating with T4 polynucleotide kinase (Invitrogen) and [c-32 P]-ATP at 37°C for 1 h. The labeled oligoribonucleotides were purified using ProbeQuant G-50 Micro Columns (GE Healthcare, Piscataway, NJ, USA). Gel electrophoretic mobility shift assays Binding reactions were performed by mixing different amounts of the purified CLB19 and CLB19-DE proteins as indicated in each figure and the 32P-labeled RNA probe (10 pM) in a buffer containing 80 mM Tris-HCl (pH 7.5), 250 mM NaCl, 4 mM dithiothreitol, 0.05 mg ml1 BSA, 0.2 mM EDTA, 10% glycerol and 1 mg ml1 heparin. To minimize secondary structure, the oligoribonucleotides were heat-treated at 95°C for 3 min before initiating the reaction and kept on ice until they were mix with the protein. Unlabeled competitor RNAs were preincubated with the protein (50 nM) for 10 min before the labeled RNA was added. The reaction mixture was incubated for 30 min at 25°C. The samples were loaded onto a 5% nondenaturing polyacrylamide gel (30 : 1 acrylamide : N,N´-methylenebisacrylamide) in TBE buffer (89 mM Tris, 89 mM boric acid and 2 mM EDTA) electrophoresed at 4°C. The gels were exposed to Kodak X-ray films. To generate the binding curves to calculate Kd, protein concentrations between 5 nM to 50 lM were tested. The concentration of the oligoribonucleotide used in these assays was constant at 10 pM; that is, a lower concentration than the estimated New Phytologist (2015) 208: 430–441 www.newphytologist.com
Kd following the general parameters previously described (Barkan, 2011). Bimolecular fluorescence complementation (BiFC) assays For BiFC assays, full ORFs of CLB19, CLB19-DE, MORF2/ RIP2 and MORF9/RIP9 were PCR-amplified without their stop codon (Table 1) and cloned into the split-yellow fluorescent protein (YFP) destination vectors pSPYNE-35S and pSPYCE-35S (Walter et al., 2004) as indicated in the text; the constructs were verified by DNA sequencing. Transient assays were performed using Arabidopsis thaliana mesophyll protoplasts from 3 wk-old Col-0 plants following the protocol described by Yoo et al. (2007). Protoplasts were transformed with 20 lg of each of the pSPYCE and SPYNE plasmids. Expression analysis was done 15 h after transformation. Confocal images were obtained using a Carl Zeiss LSM510 META laserscanning microscope (http://www.zeiss.com/), equipped for excitation with an argon (Ar2) 488 nm laser. Whole-mount preparations and histological analysis For the phenotypic analysis of developing ovules, gynoecia of wild-type (WT) and CLB19-DE transgenic individuals were dissected longitudinally, fixed with FAA buffer (50% ethanol, 5% acetic acid, and 10% formaldehyde), dehydrated in increasing ethanol concentration, cleared in Herr’s solution (phenol : chloral hydrate : 85% lactic acid : xylene : oil of clove, 1 : 1 : 1 : 0.5 : 1), and observed using a DRMB Leica microscope under Nomarski illumination.
Results CLB19 specifically interacts to the rpoA and clpP1 editing sites in vitro The CLB19 protein is essential for editing two independent chloroplast transcripts: rpoA at codon 67 (changing Ser to Phe), and clpP1 at codon 187 (changing His to Tyr) (ChateignerBoutin & Hanson, 2002). Although available data support the hypothesis that PPR proteins provide the recognition specificity at the editing site, low sequence similarity (9 out of 19 bases) exists between the upstream sequences from the editing site of the two CLB19 target transcripts (Fig. 1a). To determine if these two different cis-acting sequences are recognized by CLB19, this protein was cloned into a bacterial expression system and tagged at its C-terminus with a 69 His tag. The recombinant CLB19His protein was purified (Fig. S1) and used in RNA in vitro binding assays (Barkan, 2011). Two oligoribonucleotides containing 26 bases surrounding the editing site of the rpoA and clpP1 transcripts were synthesized (Fig. 1b,c). These small RNAs include the in silico-predicted binding site for CLB19 (Barkan et al., 2012; Takenaka et al., 2013a). The capacity of CLB19 to interact with these RNAs was analyzed through electrophoretic mobility shift assays (EMSA). As shown in Fig. 1(b), recombinant CLB19 binds to the rpoA single-strand Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
New Phytologist
Research 433
(a)
(b)
Fig. 1 CLB19 specifically binds to the rpoA and clpP1 transcripts. (a) Alignment of the 5ʹ region around the editing site of CLB19 targets rpoA and clpP1 transcripts. Gray boxes correspond to conserved nucleotides between rpoA and clpP1. The asterisk indicates the editing site. (b) Gel electrophoretic mobility shift assays (EMSA) with the rpoA oligoribonucleotide. c-32P labeled rpoA RNA (10 pM) was incubated without () or with (+) 50 nM of the CLB19His purified protein. Binding specificity was demonstrated using X-fold excess (indicated in each lane) of the cold-specific rpoA competitor (lanes 3–5) or with a reverse complement oligoribonucleotide (lanes 6–8) as a nonspecific competitor. (c) EMSA assay using 10 pM of c-32P labeled RNA clpP1. The conditions used in the EMSA are as described in (b). (d) EMSA assay using 10 pM of c-32P labeled RNA rpoA in the absence () or in the presence (+) of the CLB19-His purified protein. The competitor used in this analysis corresponds to unlabeled X-fold excess of clpP oligoribonucleotide. The sequences of the RNA probes (rpoA and clpP1) and the nonspecific competitors (IN) are indicated beneath each gel. Bound complex is indicated by an arrow and unbound by an asterisk. The gels shown are representative from two independent experiments.
(c)
(d)
oligoribonucleotide. This interaction is fully dependent on the presence of CLB19, because in its absence did not result in any electrophoretic shift (Fig. 1b, lane 1). The specificity of the binding was corroborated using the same unlabeled oligoribonucleotide (Fig. 1b, lanes 3–5) or a nonspecific oligoribonucleotide as competitors (lanes 6–8). Binding competition was observed with the specific competitor but not with the nonspecific oligoribonucleotide (Fig. 1b, lanes 3–8). A similar analysis was performed with the RNA sequence of clpP1 (Fig. 1c). We observed the specific interaction of CLB19 with the sequence surrounding the editing site of clpP1. The specificity of this interaction was also confirmed by competition with the unlabeled clpP1 RNA (Fig. 1c, lanes 3–5), but not with the nonspecific competitor (Fig. 1c, lanes 6–8). These data demonstrate that in vitro, CLB19 has the capacity to specifically recognize both transcripts as targets in spite of their modest sequence similarity. As expected, we observed that the unlabeled clpP1 oligoribonucleotide strongly competed with the radioactive rpoA oligoribonucleotide (Fig. 1d). We also estimated the relative binding affinity of CLB19 to its two targets through EMSA using increasing concentrations of the purified CLB19-His protein with a constant concentration of Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
rpoA or clpP1 RNA oligoribonucleotides (Fig. 2). To generate the binding curves concentrations that ranged between 5 nM to 50 lM were originally tested. However, we observed that with concentrations > 200 nM the migration of the complex was altered and either did not resolve well by gel electrophoresis or did not enter the gel and our analysis was restricted to protein concentrations between 5 to 50 nM. This result is probably due to protein aggregation as has been previously observed for other PPR proteins (Barkan, 2011). From independent experiments we estimated a dissociation constant (Kd) of 14 nM for rpoA and 9 nM for clpP1 (Fig. S2). From this analysis we conclude that in vitro there are only minor difference in the affinity of CLB19 protein with the rpoA and clpP1 transcripts, in spite of the different nucleotide sequences. Sequence requirements of the CLB19 recognition Previous studies have reported that crucial cis-active elements in the recognition site for some editing PPR proteins, both in vivo and in vitro, are localized between 5 and 15 nucleotides upstream of the edited site (Bock et al., 1996; Chaudhuri & Maliga, 1996; Farre et al., 2001). In addition, bioinformatics studies predict a New Phytologist (2015) 208: 430–441 www.newphytologist.com
New Phytologist
434 Research (a)
(b) Fig. 2 Binding affinity of the CLB19 protein to the rpoA and clpP1 upstream sequences of the editing site. Electrophoretic mobility shift assays (EMSA) using increasing concentrations (nM) of the CLB19-His protein as specified in each lane and a fixed concentration (10 pM) of c-32P labeled (a) rpoA or (b) clpP1 RNAs. The asterisks mark the free radioactive oligoribonucleotide, and the arrows designate the oligoribonucleotides–CLB19 complex. The Kd values obtained from three independent experiments with SD for each target are shown. The gels shown are representative from three independent replicates.
one-to-one PPR–nucleotide interaction of the PPR proteins with their targets (Barkan et al., 2012; Takenaka et al., 2013a; Yin et al., 2013). In order to identify the important interactions of the CLB19 with its targets we analyzed the binding capacity of this protein to mutated rpoA RNA oligoribonucleotides (Fig. 3). Based on the predicted recognition site for this protein (Barkan et al., 2012; Yagi et al., 2013a) and also on the identity between the rpoA and clpP1 target sequences (Fig. 3a), six different positions in the rpoA target sequence were altered (Fig. 3b). The binding characteristics of each of these RNAs variants were analyzed through EMSAs (Fig. 3c). We observed that variation of the two nucleotides (UA) located at 17 and 16 bases from the editing site did not affect CLB19 binding (Fig. 3c, M6), supporting the prediction that these bases are not involved in the interaction between CLB19 and the rpoA RNA. By contrast, mutations at the 13 (A) and 11 (A) nucleotides (M1 and M2), which have been predicted to be contacted by the first and third PPR repeats, completely abolished CLB19 binding (Fig. 3c). We also found that mutations between 6 to 4 (CAA) nucleotides (M4), predicted to be in contact with the final three CLB19 PPR repeats, caused drastic loss of CLB19 binding to the RNA target. An unexpected finding in this analysis is that mutations at 9 (G) and 8 (U), predicted to contact the sixth and seventh PPR repeats, have a minimal effect on the CLB19 binding capacity (Fig. 3c, M5). This finding is particularly unexpected for the nucleotide at the 9 (G) position, which has a higher correlation with the proposed amino acid code (Barkan et al., 2012; Takenaka et al., 2013a; Yin et al., 2013) and is also conserved between the rpoA and clpP1 targets (Figs 1, 3a, S3). Finally, we also analyzed a variant version that changed the U nucleotide before the editing site (M3). Surprisingly we observed that this mutation completely abolished binding of the CLB19 (Fig. 3c). These results demonstrated that in vitro, the 1 nucleotide is essential for efficient CLB19 binding. Because we observed that M5 mutations did not impair RNA binding of the CLB19 protein, we compared the relative binding affinity of this mutated RNA with that of the wild-type (WT) sequence. Interestingly, the binding capacity of the variant RNA was very similar to that observed with the WT rpoA (Fig. 1b,c vs New Phytologist (2015) 208: 430–441 www.newphytologist.com
4a,b), demonstrating that changes in these two bases did not significantly affect the CLB19 binding affinity. Also the observed differences in binding in these analyses do not correlate with the secondary structure stability of the oligoribonucleotides used (data not shown). The E motif of CLB19 does not participate in the recognition of its targets Previous data have shown that the amino acid sequence of the E motifs is highly conserved across PPR proteins supporting the notion that these motifs have a similar function in the editing process (Okuda et al., 2007, 2009). To address the role of the E domain in the CLB19 binding affinity, this motif was removed (CLB19-DE) and the truncated protein was used in EMSA assays against the rpoA and clpP1 targets. We observed that the binding characteristics of the CLB19-DE to rpoA and clpP1 are similar to those we observed with the entire protein (Figs 1b,c vs 5a,b). These data demonstrate that at least in vitro, the E domain of CLB19 protein is dispensable for the binding to both target sites, and that the binding affinity of the truncated protein is not reduced compared with the entire protein. Functional analysis of the E domain of the CLB19 protein In order to analyze the role of the E domain in the functionality of CLB19, we tested the capacity of the CLB19-ΔE truncated recombinant protein to complement the clb19 yellow lethal phenotype. To this end the CLB19-ΔE gene, expressed from the CaMV35S promoter, was introduced into clb19/+ heterozygous plants. As shown in Fig. 6(b), we observed that in contrast to CLB19 (Chateigner-Boutin et al., 2008), the truncated version of the E domain does not complement the pale yellow seedling phenotype of the clb19 mutant in the F1 progeny (Fig. 6b). In the 35S:CLB19-ΔE transgenic plants the pale embryos segregate with a similar frequency (Fig. 6d) to the untransformed clb19 heterozygous plants (Fig. 6c). These results demonstrate that the E domain is required for CLB19 function and is consistent with the essential editing function that the E motif has in other PPR proteins (Okuda et al., 2007, 2009). Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
New Phytologist
Research 435 (a)
Fig. 3 Analysis of the contacts between CLB19 and the upstream sequence of the rpoA editing site. (a) Diagram of the proposed interaction between the CLB19 PPR motifs to the rpoA and clpP1 binding sites as predicted by Barkan et al. (2012) and Yagi et al. (2013a). Each type of pentatricopeptide repeat (PPR) motifs from CLB19 is ordered from the amino to the carboxy terminus. The corresponding amino acid at positions 6 and 1ʹ of the next motif are shown above each predicted nucleotide code and compared with the rpoA and clpP1 ligands. The distance used in the alignment is based on the proposed recognition model for PPR proteins. The nucleotides in bold reflect bases with adjustment to the code. In the rpoA and RNA clpP1 ligands the gray shade indicates bases that are conserved between them. Underlined and italic bases correspond to the bases varied and analyzed in (c). The arrow marks the edited C. (b) Sequence of the oligoribonucleotides used for the binding assays shown in (c). The mutagenized bases in each oligoribonucleotide (M1–M6) are shown in bold and lower cases. The asterisk marks the editing site. (c) Electrophoretic mobility shift assays (EMSA) were performed in the absence () or in the presence (+) of 50 nM of the purified CLB19-His tagged protein and 10 pM of the different c-32P-labeled RNA probes indicated in (b). Arrows designate the RNA–CLB19 complex. The gels shown are representative from two independent experiments. WT, wild-type.
(a)
(b)
(c)
(b)
Fig. 4 Binding characteristics of the CLB19 protein to the rpoA M5 mutant oligoribonucleotide. Gel electrophoretic mobility shift assays using 10 pM of c-32P labeled (a) wild-type (WT) or (b) mutagenized M5 rpoA RNAs in the presence of increasing concentrations (nM) of purified CLB19-His protein. Sequences of the probes are shown underneath each gel. The RNA–CLB19-His protein complex is marked by an arrow.
In addition to the pale embryo phenotype segregating in the clb19 heterozygous plants that carry the 35S:CLB19-ΔE transgene, we observed a high frequency of unfertilized ovules in the siliques of several independent transgenic lines (Fig. 6d). This defect was Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
not previously observed in the heterozygous clb19 mutant or when the 35S:CLB19 WT transgene was introduced into the clb19 heterozygous background (Chateigner-Boutin et al., 2008). In order to analyze whether this phenotype was exclusively present in the clb19/+ heterozygous background, we introduced the same transgene (35S:CLB19-ΔE) into Col-0 WT plants. Analysis of independent transgenic F2 lines showed that the siliques of these transgenic lines also contain unfertilized ovules (Fig. 6e). This finding confirms that overexpression of a truncated CLB19 protein lacking the E domain results in reproductive defects and partial sterility independent of the endogenous CLB19 gene. The nature of these reproductive defects was analyzed in more detail by comparing whole-mounted developing ovules of clb19/+: 35S:CLB19-DE transgenic lines and WT plants using light microscopy and Nomarsky illumination (Fig. 6f–k). In developing WT ovules, a subepidermal diploid megaspore mother cell undergoes meiosis. Three out of four of the meiotically derived cells degenerate without further division, giving rise to a single functional megaspore that initiates megagametogenesis to form a differentiated female gametophyte (Fig. 6f,g). By contrast, whereas all observed ovules from the clb19/+ 35S:CLB19-DE New Phytologist (2015) 208: 430–441 www.newphytologist.com
New Phytologist
436 Research (a)
(b) Fig. 5 Binding characteristics of the CLB19 deleted from the E domain to the rpoA and clpP1 targets. Gel electrophoretric mobility shift assays with 10 pM of the (a) rpoA or (b) clpP1 c-32P labeled oligoribonucleotides incubated without () or with (+) 50 nM of the CLB19-DE-His purified protein. Specificity of the binding was demonstrated using excess of rpoA or clpP1 (X) unlabeled competitors (lanes 2–5) or with the corresponding nonspecific competitors (IN, lanes 6–8). Asterisks mark the free c-32P labeled RNA and arrows mark the RNA– protein complex. The sequences of the probe RNAs (rpoA and clpP1) and the IN are indicated underneath each gel.
transgenic lines normally initiated meiosis, in many cases two meiotically derived cells survived and persisted during female gametophytic (Fig. 6h), forming a dyad of haploid cells separated by a thick cell wall (Fig. 6i). At subsequent developmental stages, in the mutant background, the differentiated functional megaspore often showed a secondary nucleolus (Fig. 6j), suggesting additional defects in its chromatin structure as compared with WT ovules. Supernumerary haploid products persisted at subsequent stages of development and were associated with remnants of degenerated megaspores (Fig. 6k). Identical cytological defects were prevalent at subsequent stages of female gametogenesis, suggesting that haploid cells do acquire a functional megaspore identity but are not able to divide by mitosis to form a female gametophyte, giving rise to sterile ovules. Importantly, we demonstrate that the truncated CLB19 and full protein localize in the chloroplasts identically, without any detectable accumulation in the cytoplasm or other cellular compartment (Fig. S4); this evidence supports the idea that the chloroplast contributes to this phenotype. Also, this gametophyte defect is observed in independent transgenic lines from the WT or clb19 mutant background; this finding suggests that the phenotype is not sensitive to the insertion site of the transgene. These results indicate that the E-domain truncated protein acts as a dominant/negative protein that interferes with cell fate during megasporogenesis and the subsequent establishment of a differentiated female gametophyte. CLB19 protein interacts with the MORF2/RIP2 protein through the E domain The data so far demonstrate that the interaction of CLB19 with its RNA targets depends primarily on the PPR repeats, whereas the E domain is essential for CLB19 function but does not have a direct participation in target recognition. Recent data support the hypothesis that E domains might be important for the interaction with other proteins of the editosome (Takenaka et al., 2014). A prominent group of proteins shown to be essential in organelle RNA editing is the MORF/RIP family (Bentolila et al., 2012; Takenaka et al., 2012; Sun et al., 2013). In Arabidopsis thaliana, nine members of this family exist, and two of them (MORF2/ RIP2 and MORF9/RIP9) are targeted only to the chloroplasts New Phytologist (2015) 208: 430–441 www.newphytologist.com
where they are required for editing multiple sites (Takenaka et al., 2012). In order to analyze whether CLB19 interacts with MORF2/RIP2 and MORF9/RIP9 proteins, we used BiFC (Kerppola, 2006). The complete coding sequence of CLB19 was fused in-frame at its carboxy terminus to the amino terminal end of the YFP protein and the gene fusion was inserted into the pSPINE vector (Walter et al., 2004). Using specific oligoribonucleotides (Table 1), the complete open reading frames of the MORF2/RIP2 and MORF9/RIP9 genes were amplified and fused to the carboxy-terminus of the YFP protein from the pSPICE vector. BiFC between these constructs was analyzed by cotransfection with the CLB19-YN and the MORF2/RIP2-YC or MORF9/RIP9-YC constructs in a mesophyll protoplast transient assay system (Yoo et al., 2007). As shown in Fig. 7, reconstitution of the fluorescent signal was observed in protoplasts that were cotransfected with the CLB19YN/MORF2/RIP2-YC constructs but not with the CLB19-YN/ MORF9/RIP9-YC. No fluorescent signal was detected in the controls cotransfected with the YN-CLB19 and the empty pSPYCE vector or the MORF2/RIP2-YC and the pSPINE vector, demonstrating that the fluorescence detected results from the specific interaction between CLB19 and MORF2/RIP2 proteins. To further explore the participation of the E domain in this interaction, we also analyzed the capacity of the truncated CLB19-DE to interact with the MORF2/RIP2 protein. In contrast to what was observed with the complete CLB19 protein, no fluorescence complementation was observed with the truncated CLB19 protein of the E domain and MORF2/RIP2 (Fig. 7). Taken together, these data demonstrate that CLB19 directly interacts with MORF2/RIP2 but not with MORF9/RIP9 and that the terminal E motif of CLB19 is essential for this interaction.
Discussion In mitochondria and chloroplasts it is well documented that the PPR proteins play central roles in diverse aspects of RNA regulation (reviewed in Barkan & Small, 2014). The function of these proteins is dependent on a direct interaction with their RNA targets following a complex recognition code, where multiple amino acids within each PPR repeat contact a single nucleotide in the Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
New Phytologist
Research 437
(b)
(a)
(c)
Fig. 6 The absence of E domain in CLB19 affects editing and results in defects in female gametophyte development. Phenotype of (a) 8-d-old wild-type Arabidopsis thaliana seedling and (b) 15-d-old clb19 mutant transformed with the 35S:CLB19-DE construct. Siliques from (c) clb19 heterozygous plants, (d) clb19 heterozygous transformed with 35S:CLB19-DE construct and (e) wild-type transformed with 35S: CLB19-DE. The asterisks indicate the presence of aborted ovules. (f) Wild-type premeiotic ovule showing a single megaspore mother cell (MMC) developing in the nucellus. (g) Wild-type postmeiotic ovule showing a single functional megaspore (FM). (h) Developing ovule of a 35S:CLB19-DE transgenic plant showing two dividing haploid megaspores (*) in the nucellus. (i) Developing ovule of a 35S:CLB19-DE transgenic plant showing two surviving megaspores (Mg) separated by a thick cell wall. (j) Postmeiotic ovule of a 35S:CLB19-DE transgenic plant showing a small additional nucleolus (arrow) within the functional megaspore (FM). (k) Persistence of an additional Mg in a developing ovule from a 35S:CLB19-DE transgenic that did not form a differentiated female gametophyte. Bars: (f–i) 10 lm, (j, k) 25 lm. Fu, funiculus; OI, outer integument; II, inner integument.
(f)
(g)
(i)
RNA (Barkan et al., 2012; Ke et al., 2013; Takenaka et al., 2013a; Yin et al., 2013). However, experimental validation of the rules that govern these interactions is still needed. This is particularly true for the PLS subfamily of PPR proteins involved in editing, where their recognition mechanism probably follows Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
(d)
(e)
(h)
(j)
(k)
different rules required for dissociation of the PPR protein after editing. For this reason the analysis of these types of PPR proteins will help to unravel important parameters of their recognition. The CLB19 PPR protein is required for the editing of the rpoA and clpP1 chloroplast transcripts (Chateigner-Boutin et al., New Phytologist (2015) 208: 430–441 www.newphytologist.com
438 Research
New Phytologist
Fig. 7 CLB19 and MORF2 interact through the E domain. Protein–protein bimolecular fluorescence complementation (BiFC) interaction assays using Arabidopsis thaliana mesophyll protoplasts. Protoplasts were cotransfected with combinations of the CLB19-YN and MORF2/RIP2-YC or MORF9/RIP9-YC constructs as indicated. The truncated CLB19 protein missing the E domains (CLB19D-YN) was also cotransfected with the MORF2/RIP2-YC construct. As controls, combinations with the CLB19::YN and the pSPICE empty vector or the MORF2/RIP2-YC and the pSPYNE empty vector were included. Pictures of confocal microscopy include the bright field (Bright), yellow fluorescent protein fluorescence (YFP), chlorophyll autofluorescence (Chl) and merged images for each cotransfection. The pictures shown are representative data from two independent experiments. Bar, 20 lm.
2008). In the present work we demonstrated that CLB19 binds specificity these two RNA targets despite the fact that these sequences are only partially conserved. This is relevant because some PPR proteins required for editing do not mediate direct target binding but participate through some other poorly understood mechanism (Yagi et al., 2013a). Our in vitro binding assays and mutagenesis analyses demonstrate that the key elements required in the RNA-CLB19 interaction are located within the 13 nucleotides upstream of the editing site. These results are consistent with previous findings for other editing PPR proteins (Okuda et al., 2006; Hammani et al., 2009; Okuda & Shikanai, 2012; Toda et al., 2012) and also agree with the proposed one-PPR motif to one-nucleotide code (Barkan et al., 2012; Ke et al., 2013; Takenaka et al., 2013a; Yin et al., 2013). However, our mutagenesis analysis also demonstrates different contributions of the 13 nucleotides upstream of the editing site of rpoA. Nucleotides at the 5ʹ distal and at the proximal region of the editing site have essential roles for binding, whereas those in the middle do not. This is the case for nucleotides at 8 and 9 that are predicted to contact the fifth and sixth PPR repeats of CLB19 and that are not essential in vitro for recognition. For the nucleotide at 8, this finding is supported by the New Phytologist (2015) 208: 430–441 www.newphytologist.com
fact that it is not conserved between the two CLB19 targets (U in rpoA and C in clpP1) or even within the rpoA transcripts of different species (Fig. S3). For the 9 nucleotide, this result is more surprising because this nucleotide (G) is conserved between the two targets (Fig. 3a) and in other plant species (Fig. S3). Although further in vivo corroboration will be necessary, these data support the idea that specific bases make important contributions to the binding specificity of CLB19. One finding derived from our analysis is that the U at the 1 position is essential for CLB19 binding. This result contrasts to other reports for the E-class proteins where it has been shown that despite being highly conserved, the U at 1 plays a minor role in binding recognition (Okuda & Shikanai, 2012; Okuda et al., 2014). In the case of CLB19, nucleotide changes at this position completely disrupt binding. The behavior of CLB19 in this respect resembles what has been observed for the DYW-class of PPR proteins, where interaction and sequence preference has been shown with the nucleotides upstream of the editing site, probably mediated through the DYW domain (Okuda et al., 2014). Although the a helixes of the PPR proteins E domains have been predicted to participate in RNA recognition (Yagi et al., 2013a), our analysis demonstrates that the CLB19 protein with a deleted E domain Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
New Phytologist interacts with its RNA target similarly to the full protein. Thus, these data support the notion that CLB19 interacts with the 1 nucleotide through the PPR motif rather than the E domain. We also corroborated the idea that the E domain is essential for the CLB19 editing function, because the CLB19 that is missing its E domain cannot complement the clb19 mutant phenotype. These results are consistent with the findings for other editing PPR proteins of the E- or the DYW-classes and support an essential role of this domain in the editing process (Okuda et al., 2007, 2009, 2014; Takenaka et al., 2014). However, these findings stand in contrast with the DWY domain that has been shown to be dispensable for RNA editing in some PPR proteins but not in others (Okuda et al., 2007; Wagoner et al., 2015). Our work also demonstrates that the E domain in CLB19 is fully dispensable for target recognition in vitro, as was observed for CCR4 (Okuda et al., 2007). Interestingly, we found that the E domain mediates the specific interaction of the CLB19 with the RNA-interacting protein MORF2/RIP2. Perhaps this domain may also be the interaction site with other basal factors essential for the editing reactions, including those containing the deaminase activity that has not been identified yet, as has been suggested by another group (Okuda et al., 2009). An intriguing finding of this work is that the overexpression of a truncated E domain results in severe defects in ovule development. Up to now, the reported defects associated with the clb19 mutation relate to seedling lethal phenotypes (Chateigner-Boutin et al., 2008) demonstrating that the interference with gametophyte development is caused by the overexpression of the truncated protein. Although the molecular explanation for the gametophytic defect remains to be determined, we hypothesized that these defects relate to poor chloroplast functionality because both the E-domain truncated and full CLB19 proteins are exclusively targeted to chloroplasts (Chateigner-Boutin et al., 2008). These data thus support an important role for plastids in the process of female gametogenesis. Interestingly, there are several reports that link mutations in PPR proteins with early seed development (Lurin et al., 2004; Bryant et al., 2011; Sosso et al., 2012) and embryogenesis defects (Cushing et al., 2005; Liu et al., 2013). More relevant to our data is the recent finding that the expression of 18 different PPR proteins increases during female gametogenesis and mutations of some of these proteins result in defects in gametophyte development (Lu et al., 2011; Sanchez-Leon et al., 2012). The phenotype of the overexpressed CLB19-DE lines resembles that of the Atppr2 mutant. AtPPR2 encodes a chloroplast PPR protein that apparently functions in plastid translation by interacting with the 23S rRNA. Mutations in AtPPR2 result in an arrest of the male and female gametogenesis at the first mitotic division, supporting a role for this protein during these processes (Lu et al., 2011). In the CLB19-DE overexpressing lines, we observed that more than one meiotic cell survives and persists during gametogenesis,s giving rise to sterile ovules without a functional megaspore and exhibiting the presence of supernumerary products. Thus, although the ppr2 mutant and the CLB19-DE overexpressing lines result in female gametogenesis defects, the mechanisms for this arrest appears to be different, Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
Research 439
suggesting a role of PPR protein-mediated function at different stages of female gametogenesis. We demonstrate that the CLB19-DE is not functional for editing but, at least in vitro, this truncated protein has the ability to interact with its targets similar to the full protein, supporting the idea that it retains its binding specificity. It is possible that the observed phenotype might result from the binding of the truncated CLB19 protein to the rpoA and clpP1 transcripts, making them inaccessible for proper editing or even for translation. However, defects in gametogenesis have not been associated with mutations in the rpoA gene (Serino & Maliga, 1998). To the best of our knowledge, mutations in the clpP1 gene have not been characterized, and the role of this gene during gametogenesis needs to be further analyzed. An alternative explanation is that the truncated CLB19 protein could sequester essential components of the editosome or another critical chloroplast process resulting in a general disfunction of the organelle. Recently new interacting proteins involved in editing have been identified (Zhang et al., 2014), demonstrating that additional participants in the editing process exist. Finally, overexpression of other truncated PPR proteins of the E domain apparently do not result in defects in ovule formation, unlike the one described here (Okuda et al., 2007). Thus, the defects in gametogenesis described in this work appear to be specific to the CLB19 protein. However, alternative possibilities, such as an effect outside the plastid or even an as-yet-unidentified function of CLB19, cannot be ruled out. Thus, understanding the molecular bases of the defect during female gametogenesis and the role of the plastids in the plant female gametogenesis process remains for future analysis. Previous work has demonstrated the participation of different RNA binding proteins (MORF/RIP and ORRM) in the editing process that takes place in organelles (Takenaka et al., 2012; Bentolila et al., 2013; Sun et al., 2013). Although the function of the MORF/RIP proteins is still unclear, it has been suggested that they are interacting factors between PPR proteins and other components of the editosome, including those with a deaminase activity (Bentolila et al., 2012; Takenaka et al., 2012). The MORF2/RIP2 and MORF9/RIP9 proteins localize into chloroplasts, and mutations in them affect most of the editing sites in this organelle (Takenaka et al., 2012). However, the phenotype for each MORF mutant is different, suggesting that particular functions are performed by each of these proteins. The morf2 mutant results in a yellow pale phenotype, the morf9 mutant displays a variegated phenotype (Takenaka et al., 2012). Our BiFC analysis demonstrates that CLB19 interacts exclusively with MORF2/ RIP2, supporting the idea that this protein and not MORF9/ RIP9 acts as a partner of CLB19. However, this result is not fully consistent with the editing defects previously observed in the morf2/rip2 and morf9/rip9 mutant plants (Takenaka et al., 2012; Bentolila et al., 2013). In the absence of the MORF9/RIP9 gene, a substantial decrease in the editing of the clpP1 and rpoA genes is observed. By contrast, the reduction in editing observed in the morf2/rip2 mutant is less severe for clpP1 and in the case of the rpoA transcripts the percentage of editing is increased compared with the WT gene. In contrast to our findings these results support the hypothesis that MORF9/RIP9 participates in the New Phytologist (2015) 208: 430–441 www.newphytologist.com
440 Research
CLB19-mediated editing process. It is possible, however, that these apparent contradictory results only reflect the complexity of the system where some proteins, such as MORF2/RIP2, interact directly with a PPR protein while others, such as MORF9/RIP9, may require additional factors or even post-translational modifications for their binding. Accordingly, it was shown that MORF2/RIP2 and MORF9/RIP9 proteins can form heterodimers in yeast two-hybrid assays (Takenaka et al., 2012). Of course, experimental corroboration of these possibilities in vivo must be done. Additionally, although the role of MORF2/RIP2 in the CLB19-mediated editing appears to be relatively minor, it is important to consider that differences in the editosome composition appear to exist and that these differences can be critical under specific conditions. For example, recent data showed direct interaction between MORF2/RIP2 and MORF8/RIP8 and the protoporphyrinogen IX oxidase 1 (PPO1) protein (Zhang et al., 2014). PPO1 participates in the last common enzymatic step of the heme and chlorophyll biosynthesis and is apparently important for editing multiple sites of plastid RNA transcripts, acting as a regulator of the MORF/RIP protein stability. Although this factor is unlikely to participate in the CLB19 editing process, this result shows that the participation of specific regulators can affect editing in response to particular developmental or environmental conditions through modulating the MORF/RIP editing function. Exploring the existence of novel CLB19 interacting proteins capable of regulating the editing process in response to particular environmental conditions, and their impact on the function of particular MORF/RIP proteins is a matter for future studies. In summary, we provide an important advance in the characterization of the CLB19-editing PPR protein. Editing of the rpoA and clpP1 transcripts is indispensable for proper chloroplast function, and in this sense also may be an important target for regulation. Our analysis provides interesting clues about the particularities of the CLB19 editing protein and shows that chloroplasts play an important role in female gametogenesis.
Acknowledgements We would like to thank Drs Rosario Mu~ noz and Agustın LopezMunguıa for their helpful comments, and Luis de Luna-Valdez and Marel Chenge for helping with the RNA structure and sequence alignment analyses. This work was supported by the CONACyT (127546 and 129266) and PAPIIT-DGAPAUNAM (IN208211-3 and IN207214) grants.
References Ban T, Ke J, Chen R, Gu X, Tan MH, Zhou XE, Kang Y, Melcher K, Zhu JK, Xu HE. 2013. Structure of a PLS-class pentatricopeptide repeat protein provides insights into mechanism of RNA recognition. Journal of Biological Chemistry 288: 31 540–31 548. Barkan A. 2011. Studying the structure and processing of chloroplast transcripts. Methods in Molecular Biology 774: 183–197. Barkan A, Rojas M, Fujii S, Yap A, Chong YS, Bond CS, Small I. 2012. A combinatorial amino acid code for RNA recognition by pentatricopeptide repeat proteins. PLoS Genetics 8: e1002910. Barkan A, Small I. 2014. Pentatricopeptide repeat proteins in plants. Annual Review of Plant Biology 65: 415–442. New Phytologist (2015) 208: 430–441 www.newphytologist.com
New Phytologist Bentolila S, Elliott LE, Hanson MR. 2008. Genetic architecture of mitochondrial editing in Arabidopsis thaliana. Genetics 178: 1693–1708. Bentolila S, Heller WP, Sun T, Babina AM, Friso G, van Wijk KJ, Hanson MR. 2012. RIP1, a member of an Arabidopsis protein family, interacts with the protein RARE1 and broadly affects RNA editing. Proceedings of the National Academy of Sciences, USA 109: E1453–E1461. Bentolila S, Oh J, Hanson MR, Bukowski R. 2013. Comprehensive highresolution analysis of the role of an Arabidopsis gene family in RNA editing. PLoS Genetics 9: e1003584. Bock R, Hermann M, Kossel H. 1996. In vivo dissection of cis-acting determinants for plastid RNA editing. EMBO Journal 15: 5052–5059. Boussardon C, Avon A, Kindgren P, Bond CS, Challenor M, Lurin C, Small I. 2014. The cytidine deaminase signature HxE(x)n CxxC of DYW1 binds zinc and is necessary for RNA editing of ndhD-1. New Phytologist 203: 1090–1095. Bryant N, Lloyd J, Sweeney C, Myouga F, Meinke D. 2011. Identification of nuclear genes encoding chloroplast-localized proteins required for embryo development in Arabidopsis. Plant Physiology 155: 1678–1689. Chateigner-Boutin AL, Hanson MR. 2002. Cross-competition in transgenic chloroplasts expressing single editing sites reveals shared cis elements. Molecular and Cellular Biology 22: 8448–8456. Chateigner-Boutin AL, Ramos-Vega M, Guevara-Garcia A, Andres C, de la Luz Gutierrez-Nava M, Cantero A, Delannoy E, Jimenez LF, Lurin C, Small I et al. 2008. CLB19, a pentatricopeptide repeat protein required for editing of rpoA and clpP chloroplast transcripts. Plant Journal 56: 590–602. Chateigner-Boutin AL, Small I. 2010. Plant RNA editing. RNA Biology 7: 213– 219. Chaudhuri S, Maliga P. 1996. Sequences directing C to U editing of the plastid psbL mRNA are located within a 22 nucleotide segment spanning the editing site. EMBO Journal 15: 5958–5964. Clough SJ, Bent AF. 1998. Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plant Journal 16: 735–743. Cushing DA, Forsthoefel NR, Gestaut DR, Vernon DM. 2005. Arabidopsis emb175 and other ppr knockout mutants reveal essential roles for pentatricopeptide repeat (PPR) proteins in plant embryogenesis. Planta 221: 424–436. Delannoy E, Stanley WA, Bond CS, Small ID. 2007. Pentatricopeptide repeat (PPR) proteins as sequence-specificity factors in post-transcriptional processes in organelles. Biochemical Society Transactions 35: 1643–1647. Earley KW, Haag JR, Pontes O, Opper K, Juehne T, Song K, Pikaard CS. 2006. Gateway-compatible vectors for plant functional genomics and proteomics. Plant Journal 45: 616–629. Farre JC, Leon G, Jordana X, Araya A. 2001. cis recognition elements in plant mitochondrion RNA editing. Molecular and Cellular Biology 21: 6731–6737. Fisk DG, Walker MB, Barkan A. 1999. Molecular cloning of the maize gene crp1 reveals similarity between regulators of mitochondrial and chloroplast gene expression. EMBO Journal 18: 2621–2630. Fujii S, Small I. 2011. The evolution of RNA editing and pentatricopeptide repeat genes. New Phytologist 191: 37–47. Gully BS, Cowieson N, Stanley WA, Shearston K, Small ID, Barkan A, Bond CS. 2015. The solution structure of the pentatricopeptide repeat protein PPR10 upon binding atpH RNA. Nucleic Acids Research 43: 1918–1926. Gutierrez-Marcos JF, Dal Pra M, Giulini A, Costa LM, Gavazzi G, Cordelier S, Sellam O, Tatout C, Paul W, Perez P et al. 2007. empty pericarp4 encodes a mitochondrion-targeted pentatricopeptide repeat protein necessary for seed development and plant growth in maize. Plant Cell 19: 196–210. Hammani K, Okuda K, Tanz SK, Chateigner-Boutin AL, Shikanai T, Small I. 2009. A study of new Arabidopsis chloroplast RNA editing mutants reveals general features of editing factors and their target sites. Plant Cell 21: 3686–3699. Ke J, Chen RZ, Ban T, Zhou XE, Gu X, Tan MH, Chen C, Kang Y, Brunzelle JS, Zhu JK et al. 2013. Structural basis for RNA recognition by a dimeric PPR–protein complex. Nature Structural & Molecular Biology 20: 1377–1382. Kerppola TK. 2006. Design and implementation of bimolecular fluorescence complementation (BiFC) assays for the visualization of protein interactions in living cells. Nature Protocols 1: 1278–1286. Kobayashi Y, Matsuo M, Sakamoto K, Wakasugi T, Yamada K, Obokata J. 2008. Two RNA editing sites with cis-acting elements of moderate sequence identity are recognized by an identical site-recognition protein in tobacco chloroplasts. Nucleic Acids Research 36: 311–318. Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
New Phytologist Kobe B, Kajava AV. 2000. When protein folding is simplified to protein coiling: the continuum of solenoid protein structures. Trends in Biochemical Sciences 25: 509–515. Liu YJ, Xiu ZH, Meeley R, Tan BC. 2013. Empty pericarp5 encodes a pentatricopeptide repeat protein that is required for mitochondrial RNA editing and seed development in maize. Plant Cell 25: 868–883. Lu Y, Li C, Wang H, Chen H, Berg H, Xia Y. 2011. AtPPR2, an Arabidopsis pentatricopeptide repeat protein, binds to plastid 23S rRNA and plays an important role in the first mitotic division during gametogenesis and in cell proliferation during embryogenesis. Plant Journal 67: 13–25. Lurin C, Andres C, Aubourg S, Bellaoui M, Bitton F, Bruyere C, Caboche M, Debast C, Gualberto J, Hoffmann B et al. 2004. Genome-wide analysis of Arabidopsis pentatricopeptide repeat proteins reveals their essential role in organelle biogenesis. Plant Cell 16: 2089–2103. Miyamoto T, Obokata J, Sugiura M. 2004. A site-specific factor interacts directly with its cognate RNA editing site in chloroplast transcripts. Proceedings of the National Academy of Sciences, USA 101: 48–52. Nakamura T, Sugita M. 2008. A conserved DYW domain of the pentatricopeptide repeat protein possesses a novel endoribonuclease activity. FEBS Letters 582: 4163–4168. Nakamura T, Yagi Y, Kobayashi K. 2012. Mechanistic insight into pentatricopeptide repeat proteins as sequence-specific RNA-binding proteins for organellar RNAs in plants. Plant and Cell Physiology 53: 1171–1179. O’Toole N, Hattori M, Andres C, Iida K, Lurin C, Schmitz-Linneweber C, Sugita M, Small I. 2008. On the expansion of the pentatricopeptide repeat gene family in plants. Molecular Biology and Evolution 25: 1120–1128. Okuda K, Chateigner-Boutin AL, Nakamura T, Delannoy E, Sugita M, Myouga F, Motohashi R, Shinozaki K, Small I, Shikanai T. 2009. Pentatricopeptide repeat proteins with the DYW motif have distinct molecular functions in RNA editing and RNA cleavage in Arabidopsis chloroplasts. Plant Cell 21: 146–156. Okuda K, Myouga F, Motohashi R, Shinozaki K, Shikanai T. 2007. Conserved domain structure of pentatricopeptide repeat proteins involved in chloroplast RNA editing. Proceedings of the National Academy of Sciences, USA 104: 8178– 8183. Okuda K, Nakamura T, Sugita M, Shimizu T, Shikanai T. 2006. A pentatricopeptide repeat protein is a site recognition factor in chloroplast RNA editing. Journal of Biological Chemistry 281: 37 661–37 667. Okuda K, Shikanai T. 2012. A pentatricopeptide repeat protein acts as a sitespecificity factor at multiple RNA editing sites with unrelated cis-acting elements in plastids. Nucleic Acids Research 40: 5052–5064. Okuda K, Shoki H, Arai M, Shikanai T, Small I, Nakamura T. 2014. Quantitative analysis of motifs contributing to the interaction between PLSsubfamily members and their target RNA sequences in plastid RNA editing. Plant Journal 80: 870–882. Pfalz J, Bayraktar OA, Prikryl J, Barkan A. 2009. Site-specific binding of a PPR protein defines and stabilizes 50 and 30 mRNA termini in chloroplasts. EMBO Journal 28: 2042–2052. Sanchez-Leon N, Arteaga-Vazquez M, Alvarez-Mejia C, Mendiola-Soto J, Duran-Figueroa N, Rodriguez-Leal D, Rodriguez-Arevalo I, Garcia-Campayo V, Garcia-Aguilar M, Olmedo-Monfil V et al. 2012. Transcriptional analysis of the Arabidopsis ovule by massively parallel signature sequencing. Journal of Experimental Botany 63: 3829–3842. Schmitz-Linneweber C, Small I. 2008. Pentatricopeptide repeat proteins: a socket set for organelle gene expression. Trends in Plant Science 13: 663–670. Serino G, Maliga P. 1998. RNA polymerase subunits encoded by the plastid rpo genes are not shared with the nucleus-encoded plastid enzyme. Plant Physiology 117: 1165–1170. Shikanai T. 2006. RNA editing in plant organelles: machinery, physiological function and evolution. Cellular and Molecular Life Sciences 63: 698–708. Small ID, Peeters N. 2000. The PPR motif – a TPR-related motif prevalent in plant organellar proteins. Trends in Biochemical Sciences 25: 46–47. Sosso D, Mbelo S, Vernoud V, Gendrot G, Dedieu A, Chambrier P, Dauzat M, Heurtevin L, Guyon V, Takenaka M et al. 2012. PPR2263, a DYW-subgroup pentatricopeptide repeat protein, is required for mitochondrial nad5 and cob transcript editing, mitochondrion biogenesis, and maize growth. Plant Cell 24: 676–691. Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
Research 441 Sun T, Germain A, Giloteaux L, Hammani K, Barkan A, Hanson MR, Bentolila S. 2013. An RNA recognition motif-containing protein is required for plastid RNA editing in Arabidopsis and maize. Proceedings of the National Academy of Sciences, USA 110: E1169–E1178. Takenaka M, Verbitskiy D, Zehrmann A, Hartel B, Bayer-Csaszar E, Glass F, Brennicke A. 2014. RNA editing in plant mitochondria-connecting RNA target sequences and acting proteins. Mitochondrion 19: 191–197. Takenaka M, Zehrmann A, Brennicke A, Graichen K. 2013a. Improved computational target site prediction for pentatricopeptide repeat RNA editing factors. PLoS One 8: e65343. Takenaka M, Zehrmann A, Verbitskiy D, Hartel B, Brennicke A. 2013b. RNA editing in plants and its evolution. Annual Review of Genetics 47: 335–352. Takenaka M, Zehrmann A, Verbitskiy D, Kugelmann M, Hartel B, Brennicke A. 2012. Multiple organellar RNA editing factor (MORF) family proteins are required for RNA editing in mitochondria and plastids of plants. Proceedings of the National Academy of Sciences, USA 109: 5104–5109. Toda T, Fujii S, Noguchi K, Kazama T, Toriyama K. 2012. Rice MPR25 encodes a pentatricopeptide repeat protein and is essential for RNA editing of nad5 transcripts in mitochondria. Plant Journal 72: 450–460. Wagoner JA, Sun T, Lin L, Hanson MR. 2015. Cytidine deaminase motifs within the DYW domain of two pentatricopeptide repeat-containing proteins are required for site-specific chloroplast RNA Editing. Journal of Biological Chemistry 290: 2957–2968. Walter M, Chaban C, Schutze K, Batistic O, Weckermann K, Nake C, Blazevic D, Grefen C, Schumacher K, Oecking C et al. 2004. Visualization of protein interactions in living plant cells using bimolecular fluorescence complementation. Plant Journal 40: 428–438. Yagi Y, Hayashi S, Kobayashi K, Hirayama T, Nakamura T. 2013a. Elucidation of the RNA recognition code for pentatricopeptide repeat proteins involved in organelle RNA editing in plants. PLoS One 8: e57286. Yagi Y, Tachikawa M, Noguchi H, Satoh S, Obokata J, Nakamura T. 2013b. Pentatricopeptide repeat proteins involved in plant organellar RNA editing. RNA Biology 10: 1419–1425. Yin P, Li Q, Yan C, Liu Y, Liu J, Yu F, Wang Z, Long J, He J, Wang HW et al. 2013. Structural basis for the modular recognition of single-stranded RNA by PPR proteins. Nature 504: 168–171. Yoo SD, Cho YH, Sheen J. 2007. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nature Protocols 2: 1565–1572. Zhang F, Tang W, Hedtke B, Zhong L, Liu L, Peng L, Lu C, Grimm B, Lin R. 2014. Tetrapyrrole biosynthetic enzyme protoporphyrinogen IX oxidase 1 is required for plastid RNA editing. Proceedings of the National Academy of Sciences, USA 111: 2023–2028.
Supporting Information Additional supporting information may be found in the online version of this article. Fig. S1 Purity of the CLB19-His and CLB19DE-His proteins. Fig. S2 Binding affinity of CLB19 towards the rpoA and clpP1 targets. Fig. S3 Sequence alignments of the region around the editing site of rpoA or clpP1 from different species. Fig. S4 Subcellular localization of the CLB19-DE protein. Please note: Wiley Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office. New Phytologist (2015) 208: 430–441 www.newphytologist.com
Functional analysis of the Arabidopsis thaliana CHLOROPLAST BIOGENESIS 19 pentatricopeptide repeat editing protein Maricela Ramos-Vega1, Arturo Guevara-Garcıa1, Ernesto Llamas1, Nidia Sa nchez-Le on2, Vianey Olmedo-Monfil2, Jean Philippe Vielle-Calzada2 and Patricia Le on1 1
Departamento de Biologıa Molecular de Plantas, Instituto de Biotecnologıa, Universidad Nacional Autonoma de Mexico, Av. Universidad 2001, Col. Chamilpa, Cuernavaca 62210, Mexico;
2
Grupo de Desarrollo Reproductivo y Apomixis, Laboratorio Nacional de Genomica para la Biodiversidad, CINVESTAV, Irapuato 36821, Mexico
Summary Author for correspondence: n Patricia Leo Tel: +52 55 5622 7856 Email: [email protected] Received: 8 January 2015 Accepted: 16 April 2015
New Phytologist (2015) 208: 430–441 doi: 10.1111/nph.13468
Key words: chloroplast, CLB19, ClpP protease, female gametogenesis, pentatricopeptide repeat (PPR) proteins, plastid-encoded RNA polymerase, RNA editing, RNA-binding proteins.
The Arabidopsis thaliana pentatricopeptide repeat (PPR) family of proteins contains several degenerate 35-aa motifs named PPR repeats. These proteins control diverse post-transcriptional regulatory mechanisms, including RNA editing. CLB19 belongs to the PLS subfamily of PPR proteins and is essential for the editing and functionality of the subunit A of plastidencoded RNA polymerase (RpoA) and the catalytic subunit of the Clp protease (ClpP1). We demonstrate in vitro that CLB19 has a specific interaction with these two targets, in spite of their modest sequence similarity. Using site-directed mutagenesis of the rpoA target, we analyzed the essential nucleotides required for CLB19–rpoA interactions. We verified that, similar to other editing proteins, the C-terminal E domain of CLB19 is essential for editing but not for RNA binding. Using biomolecular fluorescence complementation, we demonstrated that the E domain of CLB19 interacts with the RNA-interacting protein MORF2/RIP2 but not with MORF9/RIP9. An interesting finding from this analysis was that overexpression of a truncated CLB19 protein lacking the E domain interferes with cell fate during megasporogenesis and the subsequent establishment of a female gametophyte, supporting an important role of plastids in female gametogenesis. Together these analyses provide important clues about the particularities of the CLB19 editing protein.
Introduction One of the most representative classes of proteins involved in the regulation of different aspects of plastid and mitochondria functions is the pentatricopeptide repeat (PPR) protein family (Small & Peeters, 2000). These proteins are found in most eukaryotes but have expanded in terrestrial plants and represent one of the largest families in these lineages, with > 400 members in Arabidopsis thaliana and 600 in rice genomes (SchmitzLinneweber & Small, 2008). Structurally, PPR proteins are characterized by the presence of tandem arrays of a degenerate 35-amino acid motif, known as PPR (Lurin et al., 2004). Crystal structure analysis has shown that this PPR motif folds into a pair of antiparallel a-helices (Ban et al., 2013; Ke et al., 2013; Yin et al., 2013; Gully et al., 2015). The structure of the PPR motif is related to the tetratricopeptide repeat (TPR), which makes both proteins members of the alpha-solenoid superfamily (Kobe & Kajava, 2000). In some cases the PPR motifs constitute the entire PPR protein (i.e. the so-called P subfamily), whereas in others additional domains unrelated to PPR (E or DYW) are present (i.e. the so-called PLS subfamily). These non-PPR motifs in the PLS subfamily are always localized at the carboxy-termini of the proteins (O’Toole et al., 2008). 430 New Phytologist (2015) 208: 430–441 www.newphytologist.com
The PPR proteins in plants are nuclear-encoded and with few exceptions are targeted to mitochondria or plastids. In these organelles, PPR proteins are known to participate in diverse posttranscriptional processes, including RNA processing, splicing, RNA stability, editing and translation (Delannoy et al., 2007; Schmitz-Linneweber & Small, 2008; Pfalz et al., 2009). As a consequence, the majority of mutations in these proteins result in defects in either plastids or mitochondrial functions (Fisk et al., 1999; Gutierrez-Marcos et al., 2007). In spite of their structural similarity, PPR functional redundancy is limited. Molecular and biochemical evidence has shown that most PPR proteins target specific RNAs (Nakamura et al., 2012). RNA editing is a post-transcriptional modification that alters the sequence of a transcript by insertion, deletion or conversion of specific bases, changing the RNA sequence encoded by the DNA (Shikanai, 2006; Chateigner-Boutin & Small, 2010). Editing is a prevalent modification in plant organelles with > 600 sites in the mitochondria and 43 sites in the plastids of Arabidopsis thaliana (Bentolila et al., 2008). RNA editing in plant mitochondria and plastids involves the conversion of cytidine (C) to uridine (U) as a result of a deamination reaction (ChateignerBoutin & Small, 2010; Takenaka et al., 2013b; Yagi et al., 2013b). Thus, RNA editing defects could result in amino acid Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
New Phytologist substitutions in the nonedited protein that causes either premature protein termination or affects protein activity or stability. Almost all PPR proteins that participate in RNA editing described so far belong to the PLS subfamily, containing E or DYW domains at their carboxy terminal ends (Fujii & Small, 2011). One of these proteins is CLB19 required for editing the plastid transcripts encoding the subunit A of the chloroplastencoded RNA polymerase (rpoA) and the catalytic subunit of the Clp protease complex (clpP1). Mutations in CLB19 result in plants with a pale yellow phenotype that is lethal during early seedling development due to the lack of photosynthesis (Chateigner-Boutin et al., 2008). The cis-acting elements required for C recognition during the editing process have been widely analyzed (Chateigner-Boutin et al., 2008; Okuda & Shikanai, 2012). Biochemical data shows that the sequences essential for recognition are located within 20 to 10 nucleotides surrounding the editing site (Chaudhuri & Maliga, 1996; Farre et al., 2001). In vivo and in vitro evidence has further demonstrated that direct binding of the PPR protein to the single-stranded RNA near the editing site is essential (Miyamoto et al., 2004; Kobayashi et al., 2008; Okuda & Shikanai, 2012). However, in several examples the sequences recognized by the same PPR protein lack a consensus sequence; this demonstrates that the recognition mechanism is complex (Chateigner-Boutin et al., 2008; Okuda & Shikanai, 2012). Recent analyses using bioinformatics have provided insights into the general mechanism of RNA recognition by the PPR proteins. These studies imply that two or three independent amino acids at specific positions in each PPR repeat (3, 6 and 1ʹ of the following PPR repeat) are responsible for nucleotide specificity following a one-PPR motif to one-nucleotide recognition mode (Barkan et al., 2012; Takenaka et al., 2013a; Yagi et al., 2013a). Based on this code, the prediction of the recognition sites of some PPR proteins has been possible (Barkan et al., 2012; Takenaka et al., 2013a). Experimental support for this model has accumulated for the P-type of PPR proteins but, with few exceptions, support is still lacking for the PLS subfamily, which in addition to the E and DWY motifs also contain noncanonical subtypes of longer (L/38 aa) and shorter (S/32 aa) PPR motifs. The function of the E and DYW motifs present in these editing factors is also unclear. A role for the DYW domain in the deamination reaction has been proposed, but no experimental proof through enzymatic activity assays has been obtained (Nakamura & Sugita, 2008; Okuda et al., 2009; Boussardon et al., 2014; Wagoner et al., 2015). Other RNA proteins essential for editing such as RIP/MORF and ORRM have been found to interact with some PPR proteins. These RNA-interacting proteins are also required for editing, but their exact function in this process is not clear (Bentolila et al., 2012; Takenaka et al., 2012; Sun et al., 2013). The detailed analysis of specific PPR proteins that participate in editing has provided insight into the mechanism of action of these proteins. In this study, using an in vitro binding assay, we analyze the binding of the CLB19 PPR protein with its RNA targets. We demonstrate that CLB19 has specific interaction with Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
Research 431
the rpoA and clpP1 RNA targets displaying a similar affinity towards these transcripts in vitro. By creating variants of the sequence upstream of the rpoA editing site, we identify particular bases that are essential or dispensable for CLB19 binding. Similar to other editing PPR proteins, we find that the E domain of CLB19 is essential for editing, but in vitro this motif is not required for RNA recognition. Interestingly, overexpression of a truncated E domain protein results in the inability to establish a differentiated female gametophyte. This is a novel phenotype associated with the overexpression of the truncated version of the CLB19 protein of the E domain that supports an important role for the plastid during female gamete development. Finally, we also find that the E domain, although dispensable for the RNAbinding in vitro, is responsible for the interaction of CLB19 with the MORF2/RIP2 RNA-binding protein.
Materials and Methods Plant material and growth conditions Arabidopsis thaliana (L) Heynh. Columbia (Col-0) and Lansberg erecta (Ler) ecotypes were used in this study. Plants were grown under 16 h : 8 h, light : dark cycle (120 lmol m2 s1) at 22°C. Seed growth under sterile conditions was done in 1 9 Murashige and Skoog (MS) media with Gamborg vitamins (Phytotechology Laboratories, Shawnee Mission, KS, USA) supplemented with 1% (w/v) sucrose, solidified with 0.8% (w/v) phytoagar (Caisson, North Logan, UT, USA). Adult plants were grown in MetroMix 200 (SunGro, Bellevue, WA, USA). To generate the overexpressing CLB19 and CLB19-DE transgenic lines, the corresponding fragments were amplified using the CLB19-GW Fw and CLB19-GW Rv or CLB19-EE+ Rv oligonucleotides (Table 1) and cloned into the pFGC1008 binary vector Table 1 Oligonucleotides used in the work DNA oligonucleotides
Sequence
CLB19-GW Fw CLB19-GW Rv CLB19-GW-1012 Rv CLB19-EE+ Rv MORF2 GW Fw MORF2 GW Rv MORF9 GW Fw MORF9 GW Rv
CACCATGGGTCTCCTTCCCGT AGCATTGAGGAGATCACCAGC ATTTGGCTTCATTGGCATGCT CGGATCCGCGGCCGCTCACTTCATTGGCAT CACCTACAATGGCTTTGCCTTTGTC TGTGTTTTCTCTGCGGCGAG CACCGCAATGGCTTCCTTCACAACAA AGAGGAATCAGAGGCTGCTGG
RNA oligonucleotides
Sequence
RPOA RPOAc CLPP CLPPc RPOA M1 RPOA M2 RPOA M3 RPOA M4 RPOA M5 RPOA M6
GUAUUACACGUGCAAAAUCUGAGAAC CAUAAUGUGCACGUUUUAGACUCUUG GCAACAGAAGCCCAAGCUCAUGGAAU CGUUGUCUUCGGGUUCGAGUACCUUA GUAUUCCACGUGCAAAAUCUGAGAAC GUAUUACCCGUGCAAAAUCUGAGAAC GUAUUACACGUGCAAAAUCUGAGAAC GUAUUACACGUGAGCAAUCUGAGAAC GUAUUACACCAGCAAAAUCUGAGAAC GGCUUACACGUGCAAAAUCUGAGAAC
New Phytologist (2015) 208: 430–441 www.newphytologist.com
New Phytologist
432 Research
(https://www.arabidopsis.org/). The transgenes were transformed into heterozygous clb19 or Col-0 plants (Clough & Bent, 1998). Independent transgenic lines were identified based on their hygromycin resistance (50 lg ml1). Expression and purification of CLB19 and CLB19-DE recombinant proteins The CLB19 and CLB19-DE fragments were amplified from genomic DNA using the CLB19-GW FW and the CLB19-GW Rv or CLB19-GW-1012 Rv primers (Table 1) and cloned into the pENTR/D/TOPO (Gateway; Invitrogen). These clones were transferred into the pDEST17 destination vector (Earley et al., 2006) (Invitrogen), to generate the fusion proteins containing a His6X epitope tag; each plasmid construction was verified by DNA sequencing. Protein induction was done using IPTG (Inalco SpA, Milano, Italy) at a concentration of 500 lM for 4 h. Native protein purifications were done according to the protocol provided by the manufacturer using a Ni-NTA agarose column (Qiagen) and increasing amounts of imidazole (Qiagen). The concentration of the eluted proteins was determined by the Bradford method, and their purity was verified on a Coomassie stained sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) gel (Supporting Information Fig. S1). Preparation of RNA probes The RNA fragments used in the gel electrophoretic mobility shift assays (Table 1) were synthesized as RNA oligonucleotides (Sigma-Aldrich). Each oligoribonucleotide was end-labeled by incubating with T4 polynucleotide kinase (Invitrogen) and [c-32 P]-ATP at 37°C for 1 h. The labeled oligoribonucleotides were purified using ProbeQuant G-50 Micro Columns (GE Healthcare, Piscataway, NJ, USA). Gel electrophoretic mobility shift assays Binding reactions were performed by mixing different amounts of the purified CLB19 and CLB19-DE proteins as indicated in each figure and the 32P-labeled RNA probe (10 pM) in a buffer containing 80 mM Tris-HCl (pH 7.5), 250 mM NaCl, 4 mM dithiothreitol, 0.05 mg ml1 BSA, 0.2 mM EDTA, 10% glycerol and 1 mg ml1 heparin. To minimize secondary structure, the oligoribonucleotides were heat-treated at 95°C for 3 min before initiating the reaction and kept on ice until they were mix with the protein. Unlabeled competitor RNAs were preincubated with the protein (50 nM) for 10 min before the labeled RNA was added. The reaction mixture was incubated for 30 min at 25°C. The samples were loaded onto a 5% nondenaturing polyacrylamide gel (30 : 1 acrylamide : N,N´-methylenebisacrylamide) in TBE buffer (89 mM Tris, 89 mM boric acid and 2 mM EDTA) electrophoresed at 4°C. The gels were exposed to Kodak X-ray films. To generate the binding curves to calculate Kd, protein concentrations between 5 nM to 50 lM were tested. The concentration of the oligoribonucleotide used in these assays was constant at 10 pM; that is, a lower concentration than the estimated New Phytologist (2015) 208: 430–441 www.newphytologist.com
Kd following the general parameters previously described (Barkan, 2011). Bimolecular fluorescence complementation (BiFC) assays For BiFC assays, full ORFs of CLB19, CLB19-DE, MORF2/ RIP2 and MORF9/RIP9 were PCR-amplified without their stop codon (Table 1) and cloned into the split-yellow fluorescent protein (YFP) destination vectors pSPYNE-35S and pSPYCE-35S (Walter et al., 2004) as indicated in the text; the constructs were verified by DNA sequencing. Transient assays were performed using Arabidopsis thaliana mesophyll protoplasts from 3 wk-old Col-0 plants following the protocol described by Yoo et al. (2007). Protoplasts were transformed with 20 lg of each of the pSPYCE and SPYNE plasmids. Expression analysis was done 15 h after transformation. Confocal images were obtained using a Carl Zeiss LSM510 META laserscanning microscope (http://www.zeiss.com/), equipped for excitation with an argon (Ar2) 488 nm laser. Whole-mount preparations and histological analysis For the phenotypic analysis of developing ovules, gynoecia of wild-type (WT) and CLB19-DE transgenic individuals were dissected longitudinally, fixed with FAA buffer (50% ethanol, 5% acetic acid, and 10% formaldehyde), dehydrated in increasing ethanol concentration, cleared in Herr’s solution (phenol : chloral hydrate : 85% lactic acid : xylene : oil of clove, 1 : 1 : 1 : 0.5 : 1), and observed using a DRMB Leica microscope under Nomarski illumination.
Results CLB19 specifically interacts to the rpoA and clpP1 editing sites in vitro The CLB19 protein is essential for editing two independent chloroplast transcripts: rpoA at codon 67 (changing Ser to Phe), and clpP1 at codon 187 (changing His to Tyr) (ChateignerBoutin & Hanson, 2002). Although available data support the hypothesis that PPR proteins provide the recognition specificity at the editing site, low sequence similarity (9 out of 19 bases) exists between the upstream sequences from the editing site of the two CLB19 target transcripts (Fig. 1a). To determine if these two different cis-acting sequences are recognized by CLB19, this protein was cloned into a bacterial expression system and tagged at its C-terminus with a 69 His tag. The recombinant CLB19His protein was purified (Fig. S1) and used in RNA in vitro binding assays (Barkan, 2011). Two oligoribonucleotides containing 26 bases surrounding the editing site of the rpoA and clpP1 transcripts were synthesized (Fig. 1b,c). These small RNAs include the in silico-predicted binding site for CLB19 (Barkan et al., 2012; Takenaka et al., 2013a). The capacity of CLB19 to interact with these RNAs was analyzed through electrophoretic mobility shift assays (EMSA). As shown in Fig. 1(b), recombinant CLB19 binds to the rpoA single-strand Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
New Phytologist
Research 433
(a)
(b)
Fig. 1 CLB19 specifically binds to the rpoA and clpP1 transcripts. (a) Alignment of the 5ʹ region around the editing site of CLB19 targets rpoA and clpP1 transcripts. Gray boxes correspond to conserved nucleotides between rpoA and clpP1. The asterisk indicates the editing site. (b) Gel electrophoretic mobility shift assays (EMSA) with the rpoA oligoribonucleotide. c-32P labeled rpoA RNA (10 pM) was incubated without () or with (+) 50 nM of the CLB19His purified protein. Binding specificity was demonstrated using X-fold excess (indicated in each lane) of the cold-specific rpoA competitor (lanes 3–5) or with a reverse complement oligoribonucleotide (lanes 6–8) as a nonspecific competitor. (c) EMSA assay using 10 pM of c-32P labeled RNA clpP1. The conditions used in the EMSA are as described in (b). (d) EMSA assay using 10 pM of c-32P labeled RNA rpoA in the absence () or in the presence (+) of the CLB19-His purified protein. The competitor used in this analysis corresponds to unlabeled X-fold excess of clpP oligoribonucleotide. The sequences of the RNA probes (rpoA and clpP1) and the nonspecific competitors (IN) are indicated beneath each gel. Bound complex is indicated by an arrow and unbound by an asterisk. The gels shown are representative from two independent experiments.
(c)
(d)
oligoribonucleotide. This interaction is fully dependent on the presence of CLB19, because in its absence did not result in any electrophoretic shift (Fig. 1b, lane 1). The specificity of the binding was corroborated using the same unlabeled oligoribonucleotide (Fig. 1b, lanes 3–5) or a nonspecific oligoribonucleotide as competitors (lanes 6–8). Binding competition was observed with the specific competitor but not with the nonspecific oligoribonucleotide (Fig. 1b, lanes 3–8). A similar analysis was performed with the RNA sequence of clpP1 (Fig. 1c). We observed the specific interaction of CLB19 with the sequence surrounding the editing site of clpP1. The specificity of this interaction was also confirmed by competition with the unlabeled clpP1 RNA (Fig. 1c, lanes 3–5), but not with the nonspecific competitor (Fig. 1c, lanes 6–8). These data demonstrate that in vitro, CLB19 has the capacity to specifically recognize both transcripts as targets in spite of their modest sequence similarity. As expected, we observed that the unlabeled clpP1 oligoribonucleotide strongly competed with the radioactive rpoA oligoribonucleotide (Fig. 1d). We also estimated the relative binding affinity of CLB19 to its two targets through EMSA using increasing concentrations of the purified CLB19-His protein with a constant concentration of Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
rpoA or clpP1 RNA oligoribonucleotides (Fig. 2). To generate the binding curves concentrations that ranged between 5 nM to 50 lM were originally tested. However, we observed that with concentrations > 200 nM the migration of the complex was altered and either did not resolve well by gel electrophoresis or did not enter the gel and our analysis was restricted to protein concentrations between 5 to 50 nM. This result is probably due to protein aggregation as has been previously observed for other PPR proteins (Barkan, 2011). From independent experiments we estimated a dissociation constant (Kd) of 14 nM for rpoA and 9 nM for clpP1 (Fig. S2). From this analysis we conclude that in vitro there are only minor difference in the affinity of CLB19 protein with the rpoA and clpP1 transcripts, in spite of the different nucleotide sequences. Sequence requirements of the CLB19 recognition Previous studies have reported that crucial cis-active elements in the recognition site for some editing PPR proteins, both in vivo and in vitro, are localized between 5 and 15 nucleotides upstream of the edited site (Bock et al., 1996; Chaudhuri & Maliga, 1996; Farre et al., 2001). In addition, bioinformatics studies predict a New Phytologist (2015) 208: 430–441 www.newphytologist.com
New Phytologist
434 Research (a)
(b) Fig. 2 Binding affinity of the CLB19 protein to the rpoA and clpP1 upstream sequences of the editing site. Electrophoretic mobility shift assays (EMSA) using increasing concentrations (nM) of the CLB19-His protein as specified in each lane and a fixed concentration (10 pM) of c-32P labeled (a) rpoA or (b) clpP1 RNAs. The asterisks mark the free radioactive oligoribonucleotide, and the arrows designate the oligoribonucleotides–CLB19 complex. The Kd values obtained from three independent experiments with SD for each target are shown. The gels shown are representative from three independent replicates.
one-to-one PPR–nucleotide interaction of the PPR proteins with their targets (Barkan et al., 2012; Takenaka et al., 2013a; Yin et al., 2013). In order to identify the important interactions of the CLB19 with its targets we analyzed the binding capacity of this protein to mutated rpoA RNA oligoribonucleotides (Fig. 3). Based on the predicted recognition site for this protein (Barkan et al., 2012; Yagi et al., 2013a) and also on the identity between the rpoA and clpP1 target sequences (Fig. 3a), six different positions in the rpoA target sequence were altered (Fig. 3b). The binding characteristics of each of these RNAs variants were analyzed through EMSAs (Fig. 3c). We observed that variation of the two nucleotides (UA) located at 17 and 16 bases from the editing site did not affect CLB19 binding (Fig. 3c, M6), supporting the prediction that these bases are not involved in the interaction between CLB19 and the rpoA RNA. By contrast, mutations at the 13 (A) and 11 (A) nucleotides (M1 and M2), which have been predicted to be contacted by the first and third PPR repeats, completely abolished CLB19 binding (Fig. 3c). We also found that mutations between 6 to 4 (CAA) nucleotides (M4), predicted to be in contact with the final three CLB19 PPR repeats, caused drastic loss of CLB19 binding to the RNA target. An unexpected finding in this analysis is that mutations at 9 (G) and 8 (U), predicted to contact the sixth and seventh PPR repeats, have a minimal effect on the CLB19 binding capacity (Fig. 3c, M5). This finding is particularly unexpected for the nucleotide at the 9 (G) position, which has a higher correlation with the proposed amino acid code (Barkan et al., 2012; Takenaka et al., 2013a; Yin et al., 2013) and is also conserved between the rpoA and clpP1 targets (Figs 1, 3a, S3). Finally, we also analyzed a variant version that changed the U nucleotide before the editing site (M3). Surprisingly we observed that this mutation completely abolished binding of the CLB19 (Fig. 3c). These results demonstrated that in vitro, the 1 nucleotide is essential for efficient CLB19 binding. Because we observed that M5 mutations did not impair RNA binding of the CLB19 protein, we compared the relative binding affinity of this mutated RNA with that of the wild-type (WT) sequence. Interestingly, the binding capacity of the variant RNA was very similar to that observed with the WT rpoA (Fig. 1b,c vs New Phytologist (2015) 208: 430–441 www.newphytologist.com
4a,b), demonstrating that changes in these two bases did not significantly affect the CLB19 binding affinity. Also the observed differences in binding in these analyses do not correlate with the secondary structure stability of the oligoribonucleotides used (data not shown). The E motif of CLB19 does not participate in the recognition of its targets Previous data have shown that the amino acid sequence of the E motifs is highly conserved across PPR proteins supporting the notion that these motifs have a similar function in the editing process (Okuda et al., 2007, 2009). To address the role of the E domain in the CLB19 binding affinity, this motif was removed (CLB19-DE) and the truncated protein was used in EMSA assays against the rpoA and clpP1 targets. We observed that the binding characteristics of the CLB19-DE to rpoA and clpP1 are similar to those we observed with the entire protein (Figs 1b,c vs 5a,b). These data demonstrate that at least in vitro, the E domain of CLB19 protein is dispensable for the binding to both target sites, and that the binding affinity of the truncated protein is not reduced compared with the entire protein. Functional analysis of the E domain of the CLB19 protein In order to analyze the role of the E domain in the functionality of CLB19, we tested the capacity of the CLB19-ΔE truncated recombinant protein to complement the clb19 yellow lethal phenotype. To this end the CLB19-ΔE gene, expressed from the CaMV35S promoter, was introduced into clb19/+ heterozygous plants. As shown in Fig. 6(b), we observed that in contrast to CLB19 (Chateigner-Boutin et al., 2008), the truncated version of the E domain does not complement the pale yellow seedling phenotype of the clb19 mutant in the F1 progeny (Fig. 6b). In the 35S:CLB19-ΔE transgenic plants the pale embryos segregate with a similar frequency (Fig. 6d) to the untransformed clb19 heterozygous plants (Fig. 6c). These results demonstrate that the E domain is required for CLB19 function and is consistent with the essential editing function that the E motif has in other PPR proteins (Okuda et al., 2007, 2009). Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
New Phytologist
Research 435 (a)
Fig. 3 Analysis of the contacts between CLB19 and the upstream sequence of the rpoA editing site. (a) Diagram of the proposed interaction between the CLB19 PPR motifs to the rpoA and clpP1 binding sites as predicted by Barkan et al. (2012) and Yagi et al. (2013a). Each type of pentatricopeptide repeat (PPR) motifs from CLB19 is ordered from the amino to the carboxy terminus. The corresponding amino acid at positions 6 and 1ʹ of the next motif are shown above each predicted nucleotide code and compared with the rpoA and clpP1 ligands. The distance used in the alignment is based on the proposed recognition model for PPR proteins. The nucleotides in bold reflect bases with adjustment to the code. In the rpoA and RNA clpP1 ligands the gray shade indicates bases that are conserved between them. Underlined and italic bases correspond to the bases varied and analyzed in (c). The arrow marks the edited C. (b) Sequence of the oligoribonucleotides used for the binding assays shown in (c). The mutagenized bases in each oligoribonucleotide (M1–M6) are shown in bold and lower cases. The asterisk marks the editing site. (c) Electrophoretic mobility shift assays (EMSA) were performed in the absence () or in the presence (+) of 50 nM of the purified CLB19-His tagged protein and 10 pM of the different c-32P-labeled RNA probes indicated in (b). Arrows designate the RNA–CLB19 complex. The gels shown are representative from two independent experiments. WT, wild-type.
(a)
(b)
(c)
(b)
Fig. 4 Binding characteristics of the CLB19 protein to the rpoA M5 mutant oligoribonucleotide. Gel electrophoretic mobility shift assays using 10 pM of c-32P labeled (a) wild-type (WT) or (b) mutagenized M5 rpoA RNAs in the presence of increasing concentrations (nM) of purified CLB19-His protein. Sequences of the probes are shown underneath each gel. The RNA–CLB19-His protein complex is marked by an arrow.
In addition to the pale embryo phenotype segregating in the clb19 heterozygous plants that carry the 35S:CLB19-ΔE transgene, we observed a high frequency of unfertilized ovules in the siliques of several independent transgenic lines (Fig. 6d). This defect was Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
not previously observed in the heterozygous clb19 mutant or when the 35S:CLB19 WT transgene was introduced into the clb19 heterozygous background (Chateigner-Boutin et al., 2008). In order to analyze whether this phenotype was exclusively present in the clb19/+ heterozygous background, we introduced the same transgene (35S:CLB19-ΔE) into Col-0 WT plants. Analysis of independent transgenic F2 lines showed that the siliques of these transgenic lines also contain unfertilized ovules (Fig. 6e). This finding confirms that overexpression of a truncated CLB19 protein lacking the E domain results in reproductive defects and partial sterility independent of the endogenous CLB19 gene. The nature of these reproductive defects was analyzed in more detail by comparing whole-mounted developing ovules of clb19/+: 35S:CLB19-DE transgenic lines and WT plants using light microscopy and Nomarsky illumination (Fig. 6f–k). In developing WT ovules, a subepidermal diploid megaspore mother cell undergoes meiosis. Three out of four of the meiotically derived cells degenerate without further division, giving rise to a single functional megaspore that initiates megagametogenesis to form a differentiated female gametophyte (Fig. 6f,g). By contrast, whereas all observed ovules from the clb19/+ 35S:CLB19-DE New Phytologist (2015) 208: 430–441 www.newphytologist.com
New Phytologist
436 Research (a)
(b) Fig. 5 Binding characteristics of the CLB19 deleted from the E domain to the rpoA and clpP1 targets. Gel electrophoretric mobility shift assays with 10 pM of the (a) rpoA or (b) clpP1 c-32P labeled oligoribonucleotides incubated without () or with (+) 50 nM of the CLB19-DE-His purified protein. Specificity of the binding was demonstrated using excess of rpoA or clpP1 (X) unlabeled competitors (lanes 2–5) or with the corresponding nonspecific competitors (IN, lanes 6–8). Asterisks mark the free c-32P labeled RNA and arrows mark the RNA– protein complex. The sequences of the probe RNAs (rpoA and clpP1) and the IN are indicated underneath each gel.
transgenic lines normally initiated meiosis, in many cases two meiotically derived cells survived and persisted during female gametophytic (Fig. 6h), forming a dyad of haploid cells separated by a thick cell wall (Fig. 6i). At subsequent developmental stages, in the mutant background, the differentiated functional megaspore often showed a secondary nucleolus (Fig. 6j), suggesting additional defects in its chromatin structure as compared with WT ovules. Supernumerary haploid products persisted at subsequent stages of development and were associated with remnants of degenerated megaspores (Fig. 6k). Identical cytological defects were prevalent at subsequent stages of female gametogenesis, suggesting that haploid cells do acquire a functional megaspore identity but are not able to divide by mitosis to form a female gametophyte, giving rise to sterile ovules. Importantly, we demonstrate that the truncated CLB19 and full protein localize in the chloroplasts identically, without any detectable accumulation in the cytoplasm or other cellular compartment (Fig. S4); this evidence supports the idea that the chloroplast contributes to this phenotype. Also, this gametophyte defect is observed in independent transgenic lines from the WT or clb19 mutant background; this finding suggests that the phenotype is not sensitive to the insertion site of the transgene. These results indicate that the E-domain truncated protein acts as a dominant/negative protein that interferes with cell fate during megasporogenesis and the subsequent establishment of a differentiated female gametophyte. CLB19 protein interacts with the MORF2/RIP2 protein through the E domain The data so far demonstrate that the interaction of CLB19 with its RNA targets depends primarily on the PPR repeats, whereas the E domain is essential for CLB19 function but does not have a direct participation in target recognition. Recent data support the hypothesis that E domains might be important for the interaction with other proteins of the editosome (Takenaka et al., 2014). A prominent group of proteins shown to be essential in organelle RNA editing is the MORF/RIP family (Bentolila et al., 2012; Takenaka et al., 2012; Sun et al., 2013). In Arabidopsis thaliana, nine members of this family exist, and two of them (MORF2/ RIP2 and MORF9/RIP9) are targeted only to the chloroplasts New Phytologist (2015) 208: 430–441 www.newphytologist.com
where they are required for editing multiple sites (Takenaka et al., 2012). In order to analyze whether CLB19 interacts with MORF2/RIP2 and MORF9/RIP9 proteins, we used BiFC (Kerppola, 2006). The complete coding sequence of CLB19 was fused in-frame at its carboxy terminus to the amino terminal end of the YFP protein and the gene fusion was inserted into the pSPINE vector (Walter et al., 2004). Using specific oligoribonucleotides (Table 1), the complete open reading frames of the MORF2/RIP2 and MORF9/RIP9 genes were amplified and fused to the carboxy-terminus of the YFP protein from the pSPICE vector. BiFC between these constructs was analyzed by cotransfection with the CLB19-YN and the MORF2/RIP2-YC or MORF9/RIP9-YC constructs in a mesophyll protoplast transient assay system (Yoo et al., 2007). As shown in Fig. 7, reconstitution of the fluorescent signal was observed in protoplasts that were cotransfected with the CLB19YN/MORF2/RIP2-YC constructs but not with the CLB19-YN/ MORF9/RIP9-YC. No fluorescent signal was detected in the controls cotransfected with the YN-CLB19 and the empty pSPYCE vector or the MORF2/RIP2-YC and the pSPINE vector, demonstrating that the fluorescence detected results from the specific interaction between CLB19 and MORF2/RIP2 proteins. To further explore the participation of the E domain in this interaction, we also analyzed the capacity of the truncated CLB19-DE to interact with the MORF2/RIP2 protein. In contrast to what was observed with the complete CLB19 protein, no fluorescence complementation was observed with the truncated CLB19 protein of the E domain and MORF2/RIP2 (Fig. 7). Taken together, these data demonstrate that CLB19 directly interacts with MORF2/RIP2 but not with MORF9/RIP9 and that the terminal E motif of CLB19 is essential for this interaction.
Discussion In mitochondria and chloroplasts it is well documented that the PPR proteins play central roles in diverse aspects of RNA regulation (reviewed in Barkan & Small, 2014). The function of these proteins is dependent on a direct interaction with their RNA targets following a complex recognition code, where multiple amino acids within each PPR repeat contact a single nucleotide in the Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
New Phytologist
Research 437
(b)
(a)
(c)
Fig. 6 The absence of E domain in CLB19 affects editing and results in defects in female gametophyte development. Phenotype of (a) 8-d-old wild-type Arabidopsis thaliana seedling and (b) 15-d-old clb19 mutant transformed with the 35S:CLB19-DE construct. Siliques from (c) clb19 heterozygous plants, (d) clb19 heterozygous transformed with 35S:CLB19-DE construct and (e) wild-type transformed with 35S: CLB19-DE. The asterisks indicate the presence of aborted ovules. (f) Wild-type premeiotic ovule showing a single megaspore mother cell (MMC) developing in the nucellus. (g) Wild-type postmeiotic ovule showing a single functional megaspore (FM). (h) Developing ovule of a 35S:CLB19-DE transgenic plant showing two dividing haploid megaspores (*) in the nucellus. (i) Developing ovule of a 35S:CLB19-DE transgenic plant showing two surviving megaspores (Mg) separated by a thick cell wall. (j) Postmeiotic ovule of a 35S:CLB19-DE transgenic plant showing a small additional nucleolus (arrow) within the functional megaspore (FM). (k) Persistence of an additional Mg in a developing ovule from a 35S:CLB19-DE transgenic that did not form a differentiated female gametophyte. Bars: (f–i) 10 lm, (j, k) 25 lm. Fu, funiculus; OI, outer integument; II, inner integument.
(f)
(g)
(i)
RNA (Barkan et al., 2012; Ke et al., 2013; Takenaka et al., 2013a; Yin et al., 2013). However, experimental validation of the rules that govern these interactions is still needed. This is particularly true for the PLS subfamily of PPR proteins involved in editing, where their recognition mechanism probably follows Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
(d)
(e)
(h)
(j)
(k)
different rules required for dissociation of the PPR protein after editing. For this reason the analysis of these types of PPR proteins will help to unravel important parameters of their recognition. The CLB19 PPR protein is required for the editing of the rpoA and clpP1 chloroplast transcripts (Chateigner-Boutin et al., New Phytologist (2015) 208: 430–441 www.newphytologist.com
438 Research
New Phytologist
Fig. 7 CLB19 and MORF2 interact through the E domain. Protein–protein bimolecular fluorescence complementation (BiFC) interaction assays using Arabidopsis thaliana mesophyll protoplasts. Protoplasts were cotransfected with combinations of the CLB19-YN and MORF2/RIP2-YC or MORF9/RIP9-YC constructs as indicated. The truncated CLB19 protein missing the E domains (CLB19D-YN) was also cotransfected with the MORF2/RIP2-YC construct. As controls, combinations with the CLB19::YN and the pSPICE empty vector or the MORF2/RIP2-YC and the pSPYNE empty vector were included. Pictures of confocal microscopy include the bright field (Bright), yellow fluorescent protein fluorescence (YFP), chlorophyll autofluorescence (Chl) and merged images for each cotransfection. The pictures shown are representative data from two independent experiments. Bar, 20 lm.
2008). In the present work we demonstrated that CLB19 binds specificity these two RNA targets despite the fact that these sequences are only partially conserved. This is relevant because some PPR proteins required for editing do not mediate direct target binding but participate through some other poorly understood mechanism (Yagi et al., 2013a). Our in vitro binding assays and mutagenesis analyses demonstrate that the key elements required in the RNA-CLB19 interaction are located within the 13 nucleotides upstream of the editing site. These results are consistent with previous findings for other editing PPR proteins (Okuda et al., 2006; Hammani et al., 2009; Okuda & Shikanai, 2012; Toda et al., 2012) and also agree with the proposed one-PPR motif to one-nucleotide code (Barkan et al., 2012; Ke et al., 2013; Takenaka et al., 2013a; Yin et al., 2013). However, our mutagenesis analysis also demonstrates different contributions of the 13 nucleotides upstream of the editing site of rpoA. Nucleotides at the 5ʹ distal and at the proximal region of the editing site have essential roles for binding, whereas those in the middle do not. This is the case for nucleotides at 8 and 9 that are predicted to contact the fifth and sixth PPR repeats of CLB19 and that are not essential in vitro for recognition. For the nucleotide at 8, this finding is supported by the New Phytologist (2015) 208: 430–441 www.newphytologist.com
fact that it is not conserved between the two CLB19 targets (U in rpoA and C in clpP1) or even within the rpoA transcripts of different species (Fig. S3). For the 9 nucleotide, this result is more surprising because this nucleotide (G) is conserved between the two targets (Fig. 3a) and in other plant species (Fig. S3). Although further in vivo corroboration will be necessary, these data support the idea that specific bases make important contributions to the binding specificity of CLB19. One finding derived from our analysis is that the U at the 1 position is essential for CLB19 binding. This result contrasts to other reports for the E-class proteins where it has been shown that despite being highly conserved, the U at 1 plays a minor role in binding recognition (Okuda & Shikanai, 2012; Okuda et al., 2014). In the case of CLB19, nucleotide changes at this position completely disrupt binding. The behavior of CLB19 in this respect resembles what has been observed for the DYW-class of PPR proteins, where interaction and sequence preference has been shown with the nucleotides upstream of the editing site, probably mediated through the DYW domain (Okuda et al., 2014). Although the a helixes of the PPR proteins E domains have been predicted to participate in RNA recognition (Yagi et al., 2013a), our analysis demonstrates that the CLB19 protein with a deleted E domain Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
New Phytologist interacts with its RNA target similarly to the full protein. Thus, these data support the notion that CLB19 interacts with the 1 nucleotide through the PPR motif rather than the E domain. We also corroborated the idea that the E domain is essential for the CLB19 editing function, because the CLB19 that is missing its E domain cannot complement the clb19 mutant phenotype. These results are consistent with the findings for other editing PPR proteins of the E- or the DYW-classes and support an essential role of this domain in the editing process (Okuda et al., 2007, 2009, 2014; Takenaka et al., 2014). However, these findings stand in contrast with the DWY domain that has been shown to be dispensable for RNA editing in some PPR proteins but not in others (Okuda et al., 2007; Wagoner et al., 2015). Our work also demonstrates that the E domain in CLB19 is fully dispensable for target recognition in vitro, as was observed for CCR4 (Okuda et al., 2007). Interestingly, we found that the E domain mediates the specific interaction of the CLB19 with the RNA-interacting protein MORF2/RIP2. Perhaps this domain may also be the interaction site with other basal factors essential for the editing reactions, including those containing the deaminase activity that has not been identified yet, as has been suggested by another group (Okuda et al., 2009). An intriguing finding of this work is that the overexpression of a truncated E domain results in severe defects in ovule development. Up to now, the reported defects associated with the clb19 mutation relate to seedling lethal phenotypes (Chateigner-Boutin et al., 2008) demonstrating that the interference with gametophyte development is caused by the overexpression of the truncated protein. Although the molecular explanation for the gametophytic defect remains to be determined, we hypothesized that these defects relate to poor chloroplast functionality because both the E-domain truncated and full CLB19 proteins are exclusively targeted to chloroplasts (Chateigner-Boutin et al., 2008). These data thus support an important role for plastids in the process of female gametogenesis. Interestingly, there are several reports that link mutations in PPR proteins with early seed development (Lurin et al., 2004; Bryant et al., 2011; Sosso et al., 2012) and embryogenesis defects (Cushing et al., 2005; Liu et al., 2013). More relevant to our data is the recent finding that the expression of 18 different PPR proteins increases during female gametogenesis and mutations of some of these proteins result in defects in gametophyte development (Lu et al., 2011; Sanchez-Leon et al., 2012). The phenotype of the overexpressed CLB19-DE lines resembles that of the Atppr2 mutant. AtPPR2 encodes a chloroplast PPR protein that apparently functions in plastid translation by interacting with the 23S rRNA. Mutations in AtPPR2 result in an arrest of the male and female gametogenesis at the first mitotic division, supporting a role for this protein during these processes (Lu et al., 2011). In the CLB19-DE overexpressing lines, we observed that more than one meiotic cell survives and persists during gametogenesis,s giving rise to sterile ovules without a functional megaspore and exhibiting the presence of supernumerary products. Thus, although the ppr2 mutant and the CLB19-DE overexpressing lines result in female gametogenesis defects, the mechanisms for this arrest appears to be different, Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
Research 439
suggesting a role of PPR protein-mediated function at different stages of female gametogenesis. We demonstrate that the CLB19-DE is not functional for editing but, at least in vitro, this truncated protein has the ability to interact with its targets similar to the full protein, supporting the idea that it retains its binding specificity. It is possible that the observed phenotype might result from the binding of the truncated CLB19 protein to the rpoA and clpP1 transcripts, making them inaccessible for proper editing or even for translation. However, defects in gametogenesis have not been associated with mutations in the rpoA gene (Serino & Maliga, 1998). To the best of our knowledge, mutations in the clpP1 gene have not been characterized, and the role of this gene during gametogenesis needs to be further analyzed. An alternative explanation is that the truncated CLB19 protein could sequester essential components of the editosome or another critical chloroplast process resulting in a general disfunction of the organelle. Recently new interacting proteins involved in editing have been identified (Zhang et al., 2014), demonstrating that additional participants in the editing process exist. Finally, overexpression of other truncated PPR proteins of the E domain apparently do not result in defects in ovule formation, unlike the one described here (Okuda et al., 2007). Thus, the defects in gametogenesis described in this work appear to be specific to the CLB19 protein. However, alternative possibilities, such as an effect outside the plastid or even an as-yet-unidentified function of CLB19, cannot be ruled out. Thus, understanding the molecular bases of the defect during female gametogenesis and the role of the plastids in the plant female gametogenesis process remains for future analysis. Previous work has demonstrated the participation of different RNA binding proteins (MORF/RIP and ORRM) in the editing process that takes place in organelles (Takenaka et al., 2012; Bentolila et al., 2013; Sun et al., 2013). Although the function of the MORF/RIP proteins is still unclear, it has been suggested that they are interacting factors between PPR proteins and other components of the editosome, including those with a deaminase activity (Bentolila et al., 2012; Takenaka et al., 2012). The MORF2/RIP2 and MORF9/RIP9 proteins localize into chloroplasts, and mutations in them affect most of the editing sites in this organelle (Takenaka et al., 2012). However, the phenotype for each MORF mutant is different, suggesting that particular functions are performed by each of these proteins. The morf2 mutant results in a yellow pale phenotype, the morf9 mutant displays a variegated phenotype (Takenaka et al., 2012). Our BiFC analysis demonstrates that CLB19 interacts exclusively with MORF2/ RIP2, supporting the idea that this protein and not MORF9/ RIP9 acts as a partner of CLB19. However, this result is not fully consistent with the editing defects previously observed in the morf2/rip2 and morf9/rip9 mutant plants (Takenaka et al., 2012; Bentolila et al., 2013). In the absence of the MORF9/RIP9 gene, a substantial decrease in the editing of the clpP1 and rpoA genes is observed. By contrast, the reduction in editing observed in the morf2/rip2 mutant is less severe for clpP1 and in the case of the rpoA transcripts the percentage of editing is increased compared with the WT gene. In contrast to our findings these results support the hypothesis that MORF9/RIP9 participates in the New Phytologist (2015) 208: 430–441 www.newphytologist.com
440 Research
CLB19-mediated editing process. It is possible, however, that these apparent contradictory results only reflect the complexity of the system where some proteins, such as MORF2/RIP2, interact directly with a PPR protein while others, such as MORF9/RIP9, may require additional factors or even post-translational modifications for their binding. Accordingly, it was shown that MORF2/RIP2 and MORF9/RIP9 proteins can form heterodimers in yeast two-hybrid assays (Takenaka et al., 2012). Of course, experimental corroboration of these possibilities in vivo must be done. Additionally, although the role of MORF2/RIP2 in the CLB19-mediated editing appears to be relatively minor, it is important to consider that differences in the editosome composition appear to exist and that these differences can be critical under specific conditions. For example, recent data showed direct interaction between MORF2/RIP2 and MORF8/RIP8 and the protoporphyrinogen IX oxidase 1 (PPO1) protein (Zhang et al., 2014). PPO1 participates in the last common enzymatic step of the heme and chlorophyll biosynthesis and is apparently important for editing multiple sites of plastid RNA transcripts, acting as a regulator of the MORF/RIP protein stability. Although this factor is unlikely to participate in the CLB19 editing process, this result shows that the participation of specific regulators can affect editing in response to particular developmental or environmental conditions through modulating the MORF/RIP editing function. Exploring the existence of novel CLB19 interacting proteins capable of regulating the editing process in response to particular environmental conditions, and their impact on the function of particular MORF/RIP proteins is a matter for future studies. In summary, we provide an important advance in the characterization of the CLB19-editing PPR protein. Editing of the rpoA and clpP1 transcripts is indispensable for proper chloroplast function, and in this sense also may be an important target for regulation. Our analysis provides interesting clues about the particularities of the CLB19 editing protein and shows that chloroplasts play an important role in female gametogenesis.
Acknowledgements We would like to thank Drs Rosario Mu~ noz and Agustın LopezMunguıa for their helpful comments, and Luis de Luna-Valdez and Marel Chenge for helping with the RNA structure and sequence alignment analyses. This work was supported by the CONACyT (127546 and 129266) and PAPIIT-DGAPAUNAM (IN208211-3 and IN207214) grants.
References Ban T, Ke J, Chen R, Gu X, Tan MH, Zhou XE, Kang Y, Melcher K, Zhu JK, Xu HE. 2013. Structure of a PLS-class pentatricopeptide repeat protein provides insights into mechanism of RNA recognition. Journal of Biological Chemistry 288: 31 540–31 548. Barkan A. 2011. Studying the structure and processing of chloroplast transcripts. Methods in Molecular Biology 774: 183–197. Barkan A, Rojas M, Fujii S, Yap A, Chong YS, Bond CS, Small I. 2012. A combinatorial amino acid code for RNA recognition by pentatricopeptide repeat proteins. PLoS Genetics 8: e1002910. Barkan A, Small I. 2014. Pentatricopeptide repeat proteins in plants. Annual Review of Plant Biology 65: 415–442. New Phytologist (2015) 208: 430–441 www.newphytologist.com
New Phytologist Bentolila S, Elliott LE, Hanson MR. 2008. Genetic architecture of mitochondrial editing in Arabidopsis thaliana. Genetics 178: 1693–1708. Bentolila S, Heller WP, Sun T, Babina AM, Friso G, van Wijk KJ, Hanson MR. 2012. RIP1, a member of an Arabidopsis protein family, interacts with the protein RARE1 and broadly affects RNA editing. Proceedings of the National Academy of Sciences, USA 109: E1453–E1461. Bentolila S, Oh J, Hanson MR, Bukowski R. 2013. Comprehensive highresolution analysis of the role of an Arabidopsis gene family in RNA editing. PLoS Genetics 9: e1003584. Bock R, Hermann M, Kossel H. 1996. In vivo dissection of cis-acting determinants for plastid RNA editing. EMBO Journal 15: 5052–5059. Boussardon C, Avon A, Kindgren P, Bond CS, Challenor M, Lurin C, Small I. 2014. The cytidine deaminase signature HxE(x)n CxxC of DYW1 binds zinc and is necessary for RNA editing of ndhD-1. New Phytologist 203: 1090–1095. Bryant N, Lloyd J, Sweeney C, Myouga F, Meinke D. 2011. Identification of nuclear genes encoding chloroplast-localized proteins required for embryo development in Arabidopsis. Plant Physiology 155: 1678–1689. Chateigner-Boutin AL, Hanson MR. 2002. Cross-competition in transgenic chloroplasts expressing single editing sites reveals shared cis elements. Molecular and Cellular Biology 22: 8448–8456. Chateigner-Boutin AL, Ramos-Vega M, Guevara-Garcia A, Andres C, de la Luz Gutierrez-Nava M, Cantero A, Delannoy E, Jimenez LF, Lurin C, Small I et al. 2008. CLB19, a pentatricopeptide repeat protein required for editing of rpoA and clpP chloroplast transcripts. Plant Journal 56: 590–602. Chateigner-Boutin AL, Small I. 2010. Plant RNA editing. RNA Biology 7: 213– 219. Chaudhuri S, Maliga P. 1996. Sequences directing C to U editing of the plastid psbL mRNA are located within a 22 nucleotide segment spanning the editing site. EMBO Journal 15: 5958–5964. Clough SJ, Bent AF. 1998. Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plant Journal 16: 735–743. Cushing DA, Forsthoefel NR, Gestaut DR, Vernon DM. 2005. Arabidopsis emb175 and other ppr knockout mutants reveal essential roles for pentatricopeptide repeat (PPR) proteins in plant embryogenesis. Planta 221: 424–436. Delannoy E, Stanley WA, Bond CS, Small ID. 2007. Pentatricopeptide repeat (PPR) proteins as sequence-specificity factors in post-transcriptional processes in organelles. Biochemical Society Transactions 35: 1643–1647. Earley KW, Haag JR, Pontes O, Opper K, Juehne T, Song K, Pikaard CS. 2006. Gateway-compatible vectors for plant functional genomics and proteomics. Plant Journal 45: 616–629. Farre JC, Leon G, Jordana X, Araya A. 2001. cis recognition elements in plant mitochondrion RNA editing. Molecular and Cellular Biology 21: 6731–6737. Fisk DG, Walker MB, Barkan A. 1999. Molecular cloning of the maize gene crp1 reveals similarity between regulators of mitochondrial and chloroplast gene expression. EMBO Journal 18: 2621–2630. Fujii S, Small I. 2011. The evolution of RNA editing and pentatricopeptide repeat genes. New Phytologist 191: 37–47. Gully BS, Cowieson N, Stanley WA, Shearston K, Small ID, Barkan A, Bond CS. 2015. The solution structure of the pentatricopeptide repeat protein PPR10 upon binding atpH RNA. Nucleic Acids Research 43: 1918–1926. Gutierrez-Marcos JF, Dal Pra M, Giulini A, Costa LM, Gavazzi G, Cordelier S, Sellam O, Tatout C, Paul W, Perez P et al. 2007. empty pericarp4 encodes a mitochondrion-targeted pentatricopeptide repeat protein necessary for seed development and plant growth in maize. Plant Cell 19: 196–210. Hammani K, Okuda K, Tanz SK, Chateigner-Boutin AL, Shikanai T, Small I. 2009. A study of new Arabidopsis chloroplast RNA editing mutants reveals general features of editing factors and their target sites. Plant Cell 21: 3686–3699. Ke J, Chen RZ, Ban T, Zhou XE, Gu X, Tan MH, Chen C, Kang Y, Brunzelle JS, Zhu JK et al. 2013. Structural basis for RNA recognition by a dimeric PPR–protein complex. Nature Structural & Molecular Biology 20: 1377–1382. Kerppola TK. 2006. Design and implementation of bimolecular fluorescence complementation (BiFC) assays for the visualization of protein interactions in living cells. Nature Protocols 1: 1278–1286. Kobayashi Y, Matsuo M, Sakamoto K, Wakasugi T, Yamada K, Obokata J. 2008. Two RNA editing sites with cis-acting elements of moderate sequence identity are recognized by an identical site-recognition protein in tobacco chloroplasts. Nucleic Acids Research 36: 311–318. Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
New Phytologist Kobe B, Kajava AV. 2000. When protein folding is simplified to protein coiling: the continuum of solenoid protein structures. Trends in Biochemical Sciences 25: 509–515. Liu YJ, Xiu ZH, Meeley R, Tan BC. 2013. Empty pericarp5 encodes a pentatricopeptide repeat protein that is required for mitochondrial RNA editing and seed development in maize. Plant Cell 25: 868–883. Lu Y, Li C, Wang H, Chen H, Berg H, Xia Y. 2011. AtPPR2, an Arabidopsis pentatricopeptide repeat protein, binds to plastid 23S rRNA and plays an important role in the first mitotic division during gametogenesis and in cell proliferation during embryogenesis. Plant Journal 67: 13–25. Lurin C, Andres C, Aubourg S, Bellaoui M, Bitton F, Bruyere C, Caboche M, Debast C, Gualberto J, Hoffmann B et al. 2004. Genome-wide analysis of Arabidopsis pentatricopeptide repeat proteins reveals their essential role in organelle biogenesis. Plant Cell 16: 2089–2103. Miyamoto T, Obokata J, Sugiura M. 2004. A site-specific factor interacts directly with its cognate RNA editing site in chloroplast transcripts. Proceedings of the National Academy of Sciences, USA 101: 48–52. Nakamura T, Sugita M. 2008. A conserved DYW domain of the pentatricopeptide repeat protein possesses a novel endoribonuclease activity. FEBS Letters 582: 4163–4168. Nakamura T, Yagi Y, Kobayashi K. 2012. Mechanistic insight into pentatricopeptide repeat proteins as sequence-specific RNA-binding proteins for organellar RNAs in plants. Plant and Cell Physiology 53: 1171–1179. O’Toole N, Hattori M, Andres C, Iida K, Lurin C, Schmitz-Linneweber C, Sugita M, Small I. 2008. On the expansion of the pentatricopeptide repeat gene family in plants. Molecular Biology and Evolution 25: 1120–1128. Okuda K, Chateigner-Boutin AL, Nakamura T, Delannoy E, Sugita M, Myouga F, Motohashi R, Shinozaki K, Small I, Shikanai T. 2009. Pentatricopeptide repeat proteins with the DYW motif have distinct molecular functions in RNA editing and RNA cleavage in Arabidopsis chloroplasts. Plant Cell 21: 146–156. Okuda K, Myouga F, Motohashi R, Shinozaki K, Shikanai T. 2007. Conserved domain structure of pentatricopeptide repeat proteins involved in chloroplast RNA editing. Proceedings of the National Academy of Sciences, USA 104: 8178– 8183. Okuda K, Nakamura T, Sugita M, Shimizu T, Shikanai T. 2006. A pentatricopeptide repeat protein is a site recognition factor in chloroplast RNA editing. Journal of Biological Chemistry 281: 37 661–37 667. Okuda K, Shikanai T. 2012. A pentatricopeptide repeat protein acts as a sitespecificity factor at multiple RNA editing sites with unrelated cis-acting elements in plastids. Nucleic Acids Research 40: 5052–5064. Okuda K, Shoki H, Arai M, Shikanai T, Small I, Nakamura T. 2014. Quantitative analysis of motifs contributing to the interaction between PLSsubfamily members and their target RNA sequences in plastid RNA editing. Plant Journal 80: 870–882. Pfalz J, Bayraktar OA, Prikryl J, Barkan A. 2009. Site-specific binding of a PPR protein defines and stabilizes 50 and 30 mRNA termini in chloroplasts. EMBO Journal 28: 2042–2052. Sanchez-Leon N, Arteaga-Vazquez M, Alvarez-Mejia C, Mendiola-Soto J, Duran-Figueroa N, Rodriguez-Leal D, Rodriguez-Arevalo I, Garcia-Campayo V, Garcia-Aguilar M, Olmedo-Monfil V et al. 2012. Transcriptional analysis of the Arabidopsis ovule by massively parallel signature sequencing. Journal of Experimental Botany 63: 3829–3842. Schmitz-Linneweber C, Small I. 2008. Pentatricopeptide repeat proteins: a socket set for organelle gene expression. Trends in Plant Science 13: 663–670. Serino G, Maliga P. 1998. RNA polymerase subunits encoded by the plastid rpo genes are not shared with the nucleus-encoded plastid enzyme. Plant Physiology 117: 1165–1170. Shikanai T. 2006. RNA editing in plant organelles: machinery, physiological function and evolution. Cellular and Molecular Life Sciences 63: 698–708. Small ID, Peeters N. 2000. The PPR motif – a TPR-related motif prevalent in plant organellar proteins. Trends in Biochemical Sciences 25: 46–47. Sosso D, Mbelo S, Vernoud V, Gendrot G, Dedieu A, Chambrier P, Dauzat M, Heurtevin L, Guyon V, Takenaka M et al. 2012. PPR2263, a DYW-subgroup pentatricopeptide repeat protein, is required for mitochondrial nad5 and cob transcript editing, mitochondrion biogenesis, and maize growth. Plant Cell 24: 676–691. Ó 2015 The Authors New Phytologist Ó 2015 New Phytologist Trust
Research 441 Sun T, Germain A, Giloteaux L, Hammani K, Barkan A, Hanson MR, Bentolila S. 2013. An RNA recognition motif-containing protein is required for plastid RNA editing in Arabidopsis and maize. Proceedings of the National Academy of Sciences, USA 110: E1169–E1178. Takenaka M, Verbitskiy D, Zehrmann A, Hartel B, Bayer-Csaszar E, Glass F, Brennicke A. 2014. RNA editing in plant mitochondria-connecting RNA target sequences and acting proteins. Mitochondrion 19: 191–197. Takenaka M, Zehrmann A, Brennicke A, Graichen K. 2013a. Improved computational target site prediction for pentatricopeptide repeat RNA editing factors. PLoS One 8: e65343. Takenaka M, Zehrmann A, Verbitskiy D, Hartel B, Brennicke A. 2013b. RNA editing in plants and its evolution. Annual Review of Genetics 47: 335–352. Takenaka M, Zehrmann A, Verbitskiy D, Kugelmann M, Hartel B, Brennicke A. 2012. Multiple organellar RNA editing factor (MORF) family proteins are required for RNA editing in mitochondria and plastids of plants. Proceedings of the National Academy of Sciences, USA 109: 5104–5109. Toda T, Fujii S, Noguchi K, Kazama T, Toriyama K. 2012. Rice MPR25 encodes a pentatricopeptide repeat protein and is essential for RNA editing of nad5 transcripts in mitochondria. Plant Journal 72: 450–460. Wagoner JA, Sun T, Lin L, Hanson MR. 2015. Cytidine deaminase motifs within the DYW domain of two pentatricopeptide repeat-containing proteins are required for site-specific chloroplast RNA Editing. Journal of Biological Chemistry 290: 2957–2968. Walter M, Chaban C, Schutze K, Batistic O, Weckermann K, Nake C, Blazevic D, Grefen C, Schumacher K, Oecking C et al. 2004. Visualization of protein interactions in living plant cells using bimolecular fluorescence complementation. Plant Journal 40: 428–438. Yagi Y, Hayashi S, Kobayashi K, Hirayama T, Nakamura T. 2013a. Elucidation of the RNA recognition code for pentatricopeptide repeat proteins involved in organelle RNA editing in plants. PLoS One 8: e57286. Yagi Y, Tachikawa M, Noguchi H, Satoh S, Obokata J, Nakamura T. 2013b. Pentatricopeptide repeat proteins involved in plant organellar RNA editing. RNA Biology 10: 1419–1425. Yin P, Li Q, Yan C, Liu Y, Liu J, Yu F, Wang Z, Long J, He J, Wang HW et al. 2013. Structural basis for the modular recognition of single-stranded RNA by PPR proteins. Nature 504: 168–171. Yoo SD, Cho YH, Sheen J. 2007. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nature Protocols 2: 1565–1572. Zhang F, Tang W, Hedtke B, Zhong L, Liu L, Peng L, Lu C, Grimm B, Lin R. 2014. Tetrapyrrole biosynthetic enzyme protoporphyrinogen IX oxidase 1 is required for plastid RNA editing. Proceedings of the National Academy of Sciences, USA 111: 2023–2028.
Supporting Information Additional supporting information may be found in the online version of this article. Fig. S1 Purity of the CLB19-His and CLB19DE-His proteins. Fig. S2 Binding affinity of CLB19 towards the rpoA and clpP1 targets. Fig. S3 Sequence alignments of the region around the editing site of rpoA or clpP1 from different species. Fig. S4 Subcellular localization of the CLB19-DE protein. Please note: Wiley Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office. New Phytologist (2015) 208: 430–441 www.newphytologist.com
