~) INSTITUTPASTEUR/ELSEVIER Paris 1992

ReS. MicrobioL 1992, 143, 671-681

Functional ap.alysis of the pcrtussis toxin promoter R. Gross (1, 2), N.H. Carbonetti (I. 3), R. Rossi (]) and R. Rappuoli (1) m IRIS, Via Fioremina 1, 53100 Siena (Italy), ¢2) Unitd de Biochimie des Rdgulations Cellulaires, Institut Pasteur, 75724 Paris Cedex 15, and is) Department o f Microbiology and Immunology, BRB 13-037, 655 West Baltimore Street. Baltimore, MD 21201-1559 (USA)

SUMMARY

The expression of the pertussis toxin ptx oparon is positively regulated in cis by a promoter region of about 170 base pairs and in trans by the bvg locus, which codes for the transcriptional activator protein BvgA. The promoter contains t w o direct repeats which are essential for its activity. When the position of these direct repeats relative to the transc~ption start point was cher.~ed, the activity of the promoter was strongly impaired. The repeated sequences t~,erefore do not represent enhancer-like elements similar to those which have been identified in other positively regulated promoters; instead, the integrity of the whole promoter region seems to be an important feature of ptx regulation, k transcription interference assay was carried out to analyse in viva binding of regulatory proteins to the ptx promoter. The results suggest that the direct repeats are the recognition sequence of a protein, which binds to them only under conditions in which the promoter is activated. In vitro DNA binding experiments with BvgA protein purified from an overproducing Esch~richia colt strain were performed. However, no binding of BvgA to the ptx promoter was observed under conditions where binding of BvgA to the fha and bvg promoters occurred. This suggests that factors in addition to the bvg system are involved in the regulation of the Bordetella virulence regulon.

Key-words: Bordetella, Virulence, Pertussis toxin, Promoter; Regulation.

INTRODUCTION Bordetella pertussis, the causative agent of whooping cough, produces a variety of virulence factors, such as adhesins (fimbriae, filamentous haemagglutinin (FHA)), toxins (pertussis toxin (PTX), adenylate cyclase toxin (CYA), dermonecrotic toxin and others) and outer mem-

brane proteins (Gross et al., 1989a). The expression of these factors is regulated by the bvg locus in a coordinate manner in response to environmental signa!s, e.g. the presence of compounds such as MgSO4, nicotinic acid or changes in temperature (Gross and Rappuoli, 1989; Melton and Weiss, 1989). This reversible switch in the expression of the virulence factors

Submitted May 20, 1992, accepted July 7, 1992. For correspondence:R. Gross,Theodor-Boveri-lnstitulfur Biowissenschaften,Lehrstuhlfur Mikrobiologie,Am Hubland,8700Wurzburg (Germany)(presentaddress).

R. G R O S S E T AL.

672

has been called phenotypic modulation (Lacey, 1960). A second regulatory phenomenon was observed in the past which affects Bordetella virulence, the so-called phase variation (Leslie and Gardner, 1931). It was recognized that the bacteria lose their virulence properties upon cultivation in t'~e iaooratory with a high frequency. Virulent bacteria were termed phase I organisms, whereas avirulent variants were called phase III organisms. It was shown that such avirulent bacteria frequently carry mutations in their bvg loci (Arico et al., 1991). The bvg locus encodes sensory and regulatory proteirrs (Arico et aL, 1989) and it is structurally and functionally conserved in the species B. parapertussis and B. bronchiseptica (Arico et aL, 1991 ; Gross and Rappuoli, 1988). The first gene of the bvg operon, bvgA, codes tor a transcriptional activator protein that regulates the expression of the virulence rcguIon, either directly or together with other unidentified factors (Miller et al., 1989; Roy and Falkow, 1991). The BvgA protein has a domain, called a "receiver", homologous to a family of transcriptional activator proteins, including the Escherichia coli OmpR and NtrC proteins (Gross et al., 1989b). In several cases, it was shown that this conserved domain contains phosphate acceptor sites (Hess et aL, 1988; lgo et al., 1989; Keener and Kustu, 1988 ; Ninfa and Magasanik, 1988; Weiss and Magasanik, 1988). The phosphorylation of this group of activator proteins is generally mediated by sensory proteins in the cytoplasmic membrane in response to environmental stimuli. All sensory proteins have a strongly conserved domain, the "transmitter" domain, containing a kinase. The status of phosphorylation of the cytoplasmic activator proteins probably influences their transcriptional activation characteristics (Albright et al., 1989; Stock et al., 1990). However, so far, there is no experimental evidence that phosphotransfer is also involved in the B. pertussis bvg system. Although the bvg locus is essential for the expression of factors such as PTX, FHA, CYA

CAT

CYA

= =

chloramphenicol acetyltransferase. adenylate cyclase toxin.

and for itsown expression fGross and Rappuoli, 1989a; Scarlato e! al., 1990; Weiss and Falkow, 1984), fine analysisof the various promoters has revealed substantial differences. In contrast to the ptx and cya promoters, the fha and bvg promoters are strongly activatedin E. coliin the presence of the bvg locus (Miller et al., 1990; Goyard and Ullmann, 1991 ; Roy et al., 1990; Scarlato et al., 1990). The BvgA protein binds in vitro to a conserved invertedlyrepeated sequcalcchL the upstream regions of the bvg andfha operons (Roy and Falkow, 1991). This inverted repeat is not present in the ptx and cya promoters. Instead, it has been shown that in the regulatory region of the ptx promoter, a directly repeated sequence is important for its activation (Gross and Rappuoli, 1988). This sequence can be found neither in the bvg nor in the fha promoters. Recently, a 23-Kda protein from cellular extracts of B. pertussis was shown to bind in vitro to the direct repeats of the ptx promoter and to a related sequence in the cya promoter. This protein might be distinct from the BvgA activator protein (Huh and Weiss, 1991). These findings suggest that regulation of some virulence factors such as FHA involves a direct activation by the BvgA protein, whereas additional regulatory factors might be involved in the activation of other factors such as PTX and CYA. In the present report, we changed the position of the directly repeated sequences in the ptx promoter relative to the transcription start site and measured the strength of the various promoter derivatives using fusions with the chloramphenicol acetyltransferase (CAT) reporter gene. This analysis demonstrates that the direct repeats of the ptx promoter are not enhancerlike elements; instead, the r:x promoter seems to have quite strict structural requirements. Furthermore, we analysed binding of regulatory proteins to the ptx promoter and we provide evidence for the in vivo binding of a protein to the direct repeats using a transcription interference assay.

FHA PTX

= =

filamentous haemagglutinin. pertussis toxin.

FUNCTIONAL A N A L ]:SIS OF THE PERTUSSIS TOXIN PROMOTER MATERIALS AND METHODS Bacterial strains and growth conditions The Bordetella bronchiseptica strain BB7865 was obtained from the Culture Collection of the University o f Gfteborg, Sweden (Gross and Rappuoli, 1989). Strain BB7866 is a spontaneous phase I11 derivatNe of this s~rain containing a deletion in the beg locus (Arico et al., 1991). The bordetellae were gto.,,n on Bordet-Gengou plate5 (Bordet aild GeJ|gou, 1909) or ir Stainer-Scholte liquid medium (SS medium) (Stain~r and Scholte, 1970). Cloning experiments were carried out in the E. coli strain JMI01 (Maniatis et al., 1982). For site-directed mutagenesis, strain RZI032 was used (Kunkel, 1985). The E. coli strains were grown in LB-broth. Plasmid containing strains were grown in the presence of 12.5 i~g/ml tetracycline or 50 l.tg/ml ampicillin.

673

was cloned together with either the BamHi/Kpnl fragment of pBPI4, pBP28 or of pBP72 containing various parts of the ptx promoter (Gross and Rappuoli, 1988 and figure 2A) into the BarnHl site of Bluescript SK. In the resulting constructs, the various pieces of the ptx promoter were fused to the 5' region of the promoterless CAT gene. Then the three fusions were cut out as single BamHI fragments and cloned into the BamHl site of pRK415 in such an orientation that the CAT gene was under control of the lac promoter nf pRK415. The resulting clones ,Here called pRK-14-CAT, pRK-?~-CAT and pRK-72-CAT, containing 121 bp, 61 bp and 35 bp of the ptx promoter upstream region, respectively (see figure 3). As a reference plasmid to measure the activity of the lac promoter without intervening sequences of the ptx promoter, the CAT gene was directl~ cloned as a HindllI/BamHl fragment into pRK415. DNA manipulations were carried out by standc~a_ procedures (Maniatis et al., 1982). Bacterial conjugations were performed as described (Gross and Rapouoli, 1988).

DNA manipulati~.~s Plasmids containing theptx promoter and its deletion derivatives fused to the chloramphenicol acetyltransferase (CAT) reporter gene (pBP-series) have been described elsewhere (figure 2; Gross and Rappuoli, 1988). All constructs are based on the low copy vector pLAFR2, which is a deletion derivative of the broad host range plasmid RK2 (Friedman et al., 1982). Plasmid pBP4, containing a deletion of four cytosine residues in position - 3 1 of the ptx promoter, has also been described (Gross and Rappuoli, 1989). To change the position of the upstream region of the ptx promoter containing the two direct repeats, a 10-base-pair linker with the sequence 5 ' - G G G G A T C C C C - Y containing a BamHl site was introduced into the unique Kpnl site at position - 62 of the wild type promoter in pBP2, resulting in plasmitt pRob4. Further constructs were obtained by subcloning the 430 bp EcoR1/BamHl fragment of pRob4 upstream of the various ptx promoter dele~ion mutants of the pBP series. For the inversion of the upstream region in p R o b l l , the EcoRI/Kpnl fragment o f pBP2 was subcloned into the cloning vector "Bluescript SK" (Stratagene, San Diego, CA), creating a BamHl site upstream of the EcoRl site. Then the resulting fragment was ligated with its new BamHl site in the deletion p!asmid pBPI. For transcription interference assays, parts of the ptx promoter containing different amounts of the region between - 62 and - 182 were cloned in front o f the promoterless C A T gene behind the lac promoter of vector pRK415 (Keen et aL, !988). For this purpose, a BamH1/H;.ndlll fragment with the C A T gene was cloned ilt~.: ~he Bluescript SK vector. From the resulting plasmicl. )he CAT gene was isolated as a Kpnl and BamH! fragment. This fragment

Site-directed mutagenesis For site-directed mutagenesis, the vector Bluescript KS containing the ptx promoter from sequence position + 1 to - 182 on a BamHl/HindllI fragment was used. Three oligonucleotides with the sequences 5 ' . A C C G T G C T G A C C T T T T T G C C A T G GTGTG-Y (RI), 5'-AAAGTCGCGCGATG1-CGA C G G T C A C C G T C C - 3 ' (R2) and 5 ' - A A A G T C G C G C G A T G C A T G C G G T C A C C G T C C - 3 ' (R3) were used to change the four cytosine residues at sequence position - 31 to - 34 to four thymidine residues (RI) and to change the Kpn! recognition sequence at position - 6 2 from G G T A C C to G T C G A C (R2) and to G C A T G C ftR3), respectNely (fig. 1). Site-directed mutagenesis was essentially performed as described by Kunkel (1985). dUTP containing single strands were prepared from strain RZI032 as described by Blondel and Thillet (1990). The resulting mutated clones were sequenced to confirm the desired mutations and then cloned as BamHl/Hindlll fragments together with a fragment containiag the cat gene into the vector pLAFR2 as already dencribed (Gross and Rappuoli, 1988). The obtained plasmid~ were called pBPI4-4T IRI), pBPI4-Sal (R2) and pBPl4-Sph (R3).

CAT assay The Bordetella strains containing the plasmids with CAT fusions were grown in Stainer-Scholte medium to the middle log-phase. The cells were harvested and lysed by sonication. The relative plasmid

R. G R O S S E T A L .

674

-158 GCAACCGCCAACGCGCATGCGTGCAGATTCGTCGTAGAAAACCCTC -117 GATTCTTCCGTACATCCCGCTACTGCAATCCAACACGGCATGAACG GTCGAC (R2 ) CTCCTTCGGCGCAAAGTCGCGCGATGGTACCGGTCACCGTCCGGAC GCATGC (R3) T T T T (RI) -i0 +i CGTGCTGACCCCCCTGCCATGGTGTGATCCGTAAAATAGGCACCAT Fig. 1. Sequence and relevant features of the ptx promoter. The - l0 and - 35 boxes are underlined, as well as the direct repeats at position - 117 to - 157 involved in the activation of the promoter. The transcriptional start point is shown at position + 1. The changes introduced into the nucleotide sequence by site-directed mutagenesis are shown above or on the bottom of the relevant sequences. The name of the respective oligonucleotide primer used for mutagenesis is indicated (Rl, R2 and R3). Primer RI was used for the construction of plasmid pBPI4-4T, R2 for pBPl4-Sal and R3 for pBPl4-Sph, respectively.

copy numbers were determined and the CAT assay was performed as already described (Gross and Rappuoli, 1989). The res,qts of CAT assays of three independent cultures of each clone were used for quantitation of the C A r assay. RESULTS AND DISCUSSION Effects o f m u t a t i o n s in the regulatory region of

the ptx promoter Previously, deletion derivatives o f the p l x p r o m o t e r were described ( G r o s s a n d R a p p u o l i ,

1988) and analysis o f these p r o m o t e r m u t a n t s d e m o n s t r a t e d that directly repeated sequences in the 5' region o f the p r o m o t e r are involved in transcriptional activation. Figure 2A shows some o f these deletion derivatives a n d the position o f ~he directly repeated sequences. Progressive deletions in the region o f these repeats impaired p r o m o t e r activity ( G r o s s a n d R a p p u o l i , 1988). Using these deletion derivatives, the position o f the repeats relative to the t r a n s c r i p t i o n start point was changed by fusion o f a f r a g m e n t containing the 5' region (position - 62 to - 482) to

Fig. 2. Derivatives of the pertussin toxin promoter. Top. Deletion derivatives of the ptx promoter (pBP-series) used for construction of plasmids of the pRob-series. The initiation site of transcription is indicated by a thin arrow and the directly repeated sequences important for the promoter activity are shown as thick arrows. The numbers indicate sequence postlions relative to the start site of transcription. Restriction enzymes: B:BamHl, E:EcoRI, K:Kpnl. Bottom. On the left, the plasmids of the pRob-series are shown which were constructed by the fusion of the I~coRi,'B~ "at'.~l fragment of pRob4 to the various pBP-deletion derivatives (see fig. 2A). The promoter activities of .'..~,,-.pBP deletion plasmids and of the pRob plasmids are shown as relative CAT activity in the table on the right of the figure. The reported values are the mean of the results of quantitative CAT assays of three independent cultures for each clone. The standard deviation is between 1% and 3 070 for pRob4,7,9,11 and between 5 070and 8 070 for the other pRob plasmids. Restriction enzymes. B;BamHI, E:EcoR1, K:Kpnl. The boxed area around the BamHl site represents the 10-bp linker which was inserted at the Kpnl site of pBP2 to obtain a shift in the upstrearr, region for one helix turn.

675

F U N C T I O N A L A N A L }'SIS O F T H E P E R T U S S I S T O X I N P R O M O T E R

K E

-157

-482

-62 -810 i -35

-117

,0+rl-a- mRNA

i

-80 =

,,

E-

paP33

tI._._ ---

pB P28

~-

pBP46

~

pBP24

-123

c=~.-¢= !

-130 '- ~

-149 ~ . ~ -158

K ....

[r-~_

-183 ........

.......

,,,,,4

'.---- ......

tel.CAT.activity of pla*r~ids ~obspeP i~?

.]l?

~o ~ 35

iol--"

, i.o--~ • 167

-~0

.:~5

I

•228 .~o •~4

E

26~

.~9S

L

.214

B6z ~..~._~.._.... R~° K (~)----,~-~-aJ

~s • 12~ R I]OC~

IX8

. . -. .- .-.- - - "

.s~9

~Z7

....... [--~AT pBP2

~

pRob4 (pBPI)

3.4

~-

pRob7 (pBP33)

. . . . . ~. . . . .

K

1.1

3.4

4.0

2

L. . . . . . I -

,,Roo~o

~.~

44.5

I~

i--*"

pRob6

97.0

ca.3

~,s t'

67.1

O.eSi

too

0.2

(pBP24) pRob5 57.4 L.-- (pBPZO)

, ~ L [-K ~.,:~.L~--~---

15s

223 B' [_3~

(pBPI.') •

E

.4~

.394

"

~

z4

3.7

[--

(pHP46)

149 ( ~

~.4

pRobg(pBP28) 8.0

L

•l~3

~3

_[~

K ~

100

ca-. . . . . . . {""

nSP4

1.4

t,2

g-L~V

r-,,o~,,

,,

676

R. GROSS ET AL.

the various deletion derivatives (pBP series). The resulting plasmids (pRob series) were introduced into B. bronchiseptica and their respective relative promoter activities were determined using a CAT assay. Generally, only a slight increase in the promoter activity in the pRob plasmids was observed compared to the original pBP deletion plasmids (see fig. 2, ratio pRob/pBP). The results show that displacing the repeats by only 10 bp (one helix turn) virtually eliminated the activity of the promoter, since the construct pRob4 had only 3.4 °7oof the activity of the wild type promoter in construct pBP2. To ensure that the decrease in the promoter activity in pRob4 was not due to the inactivation of a secor~d important regulatory sequence around the l{pnI site, the nucleotide sequence at this position was changed by site-directed mutagenesis (see Materials and Methods, and figure 1). The resulting plasmids pBPI4-Sal and pBPl4-Sph did not show any significant difference in their promoter activity compared to the wild-type promoter in pBP2 (data not shown). The inversion of the upstream region from position - 6 2 to - 4 8 2 in plasmid pRobl I also abolished the promoter activity. Comparison of the upstream untranslated regions of some bvg-regulated genes such as the pertussis toxin operon and the structural genes of the fimbriae (Willems et al., 1990) revealed a common structural feature, a long stretch of cytosine residues which is found in the case of the pt~: promoter close to its - 35 region (fig. 1, I~icosiz and Rappuoli, 1987). A regulatory role f~r f.his C-stretch was recently proposed, because :,pontaneous phase variants in the expression of the fimbriae showed mutations in this sequence (Willems et aL, 1990). Furthermore, a deletion of i'cur out of the six cytosines in the ptx promoter in plasmid pBP4 abolished the activi'.y of the promoter (fig. 2B, Gross and Rappuoli, 1989). To see whether this stretch of cytosines plays a role in regulation in the case of the ptx promoter, four of the cytosines were changed to thymidine residues by site-directed mutagenesis (fig. 1). The resulting plasmid pBPI4-4T showed a reduction in its CAT activity of about 20 070compared with pBPI4 containing the wildtype promoter. Interestingly, the bvg-dependent

regulation of expression was fully retained: the promoter was not active when the bacteria were grown under modulative conditions (50 mM MgSO4) or in the phase Ill strain BB7866. These results show that the cytosine residues in the ptx promoter are not involved in its regulation. The strength of the promoter with the thymidine residues is somewhat reduced, indicating some structural role of the C-stretch for its activity. Therefore, the inactivation of the promoter derivative in pBP4 with the deletion of the four cytosine residues is probably due to a change in the position of the upstream region for about half a helix turn. The repeated sequences in pBP4 might be in a position where they can no longer function. The repeated sequences of the ptx promoter therefore do not represent enhancer-like elements such as the repeats found in NtrC-activated promoters of E. coli, which can function over long distances upstream as well as downstream of transcription start sites (Magasanik, 1989; Reitzer and Magasanik, 1985; Wedel et al., 1990). NtrC is an activator protein with sequence homologies to BvgA (Gross et al., 1989b), which seems to interact with RNA polymerase containing the alternative sigma 54 factor (Popham et al., 1989; Wedel et ai., 1990). Instead, the integrity of the ptx promoter seems to be an important feature. Therefore, the ptx promoter more closely resembles other E. coli promoters such as the ompC and ompFpromoters, which are activated by the OmpR protein (Fcrst and Inouye, 1988; Maeda et al., 1988; Rampersaud et aL, 1989). Indeed, the ptx promoter has a - 10 region which is similar to the consensus sequence of E. coil sigma7° promoters, but there is no obvious sequence homology to sigma 54 polymerasebinding sites. A major difference in the presumed mode of action between NtrC and OmpR activator proteins is that NtrC seems to stimulate the isomerization from a closed to an open promoter complex, but does not stimulate the binding of sigma s4 containing RNA polymerase to the promoter, whereas OmpR enhances binding of sigma7° containing RNA polymerase to the promoter, but not the isomerization of the RNA

677

F U N C T I O N A L A N A L }'SIS OF T H E P E R T U S S I S T O X I N P R O M O T E R

Protein binding to bvg regulated promoters

polymerase promoter complex (Tsung et al.,

1990).

The results of deletion analysis of the p t x plomoter (Gross and Rappuoli, 1988) and experiments on its structural requirements presented in this paper strongly suggest that direct repeats at position - 1 1 7 to - 157 are the target site of a regulatory protein. To rind out whether, in Bordetella species, in vivo binding occurs to these direct repeats, a transcription interference assay was performed. In this assay, the property of some transcriptional activator protein~ is also used to act as a repressor of transcription if their DNA recognition sequence is positioned in or downstream of the RNA polymerase binding site. Such assays have been used in several cases, e.g. with the VirG protein of A g r o b a c t e r i u m tumefaciens, which is a transcriptional activator with strong similarities to the BvgA protein (Powell and Kado, 1990).

Interestingly, when additional repeated sequences were inserted upstream of the promoter region in which the intact repeated sequences were already p r e s e n t , p r o m o t e r activity decreased by about 15 ~/0 and 80 °70, in pRob5 and pRob3, respectively. An explanation for this decrease in activity of pRob3 and pRob5 could involve competition of the repeated sequences for a binding protein. A second explanation could be loop formation induced by proteins b o u n d at the repeated sequences, as such activator proteins frequently form multimers. Thus, the putative binding protein, instead of interacting with RNA polymerase bound "dow,~stream" at the - 10 region, would interact with proteins b o u n d to the additional " u p s t r e a t r ' repeated sequences, thereby impairing the prontoter activity. D N A looping has been shown to be an i m p o r t a n t feature in promoter activity in a variety of cases (Adhya, 1989). In clone pRob3, with strongly impaired promoter activity, the distance between the two pairs of directly repeated sequences is 25 bp larger than in pRob5, and a possible loop t o r m a t i o n between the two pairs of repeats in pRob3 may therefore be easier.

For this purpose, various pieces of the region between - 6 2 and - 183 of the p t x promoter containing direct repeats or deletion derivatives were cloned in front of a promoterless CAT gene behind the constitutive lac promoter of the lowcopy broad host range plasmid pRK415 (see fig. 3). These constructs were introduced into the

• vc~

II

B

i 5,1) !

:¢

"-=

. . . . .

~

r-'n ~ . . . . .

.--,

~7

7

~'

i--

.

.

.

.

.

.

.

z. ~.RK

~pRK

72(.st

('AI

Fig. 3. Constructs used for the transcription interference assay. Dark l;nes ,~present parts of the ptx promoter cloned in between the !ac promoter of pRK415 and the promoterless cat gene. Arrows symbolii,: direct repeats present in the ptx promoter at position - 117 to - 157. "[he numbers refer to the sequence positions of the ptx promoter upstream region relative to the transcriptional start point in the originalptx pro-noter. S/D : Shine/Dalgarno sequence; CAT: cat gone reading frame; restriction enzymes: B:BamHI, H:H, ndlll. K:Kp,ll. The ,equence between the Kpnl ann the Hindlll restriction zites is derived from the li,~ker of the pUCI9 cioning vector.

R. GROSS ET AL.

678

virulent and non-virulent 8. bronchiseptica strains 7865 and 7866, respectively. The bacteria were then grown either under non-modulative conditions in SS medium or under modulative conditions in SS medium containing 50 mM MgSO 4, and the C A T activities of the various constructs were determined. As shown in table I, the introduction of the repeated sequences between the lac promoter and the cat gene (pRK-I 4-CAT) resulted in a reduction of C A T activity of about 45 %. This effect appears neither in phase 111 strain BB7866 nor in phase I strain BB7865 grown under modu!ative eondi:ions. There is no significant decrease in C A T activity if most or all of the repeats are deleted LoRK-28-CAT and pRK-72-CAT). It is therefore obvious that these direct repeats, which at their normal position in the ptx promoter exhibit an activating function, have a negative effect upon transcription when cloned downstream of a constitutive promoter. This effect is seen only in a phase I strain grown under non.modulative conditions. These results strongly suggest that a bvgregulated protein bound to the direct repeats interferes negatively with transcription from the lac promoter of pRK-14-CAT. This protein is likely to be the activator protein of the ptx promoter. In addition, results of the transcription interference assay indicate that the regulatory .~rotein which binds to the ptx promoter can act as a negative regulatory element and therefore might also be involved in the regulation of the recemly identified vir repressed genes (vrg) (Eeattie et al., 1990). The only thus far identified gene locus encod-

ing a D N A binding protein, which is involved in the activation of the ptx promoter, is the bye operon (Arico et al., 1989). The first gene, bvgA, of this operon codes for a 23-Kda protein with strong similarities to a family of transcriptional activator proteins (Gross et ai., 1989b). We used B v g A p r o t e i n p u r i f i e d to homogeneity from an overproducing E. coil strain (Arico, Manetti and Rappuoli, unpublished results) to investigate whether it is the protein which binds to the ptx promoter repeats. Surprisingly, in gel retardation assays, no binding of the BvgA protein to the entire ptx promoter or to parts of it containing only the direct repeats could be detected under conditions where it bound specifically to the bvg and j'ha promoters (data not shown). Even after increasing the amout:t of Bv.gA to 50 times (400 ng) over the amount necessary for detection of binding to the bvg a n d f h a promoters (g ng), no significant band shift could be detected (data not shown). Results from both in vivo and in vitro assays presented here are in good agreement with recently published data of in vitro D N A binding experiments with crude lysates prepared from B. pertussis or from BvgA-overexpressing E. coil strains. Recently, Huh and Weiss (1991) described a 23-Kda protein in lysates from a phase I B. pertussis culture grown under nonmodulative conditions which binds in vitro to the direct repeats of the ptx promoter and to a similar sequence in the cya promoter. No such binding activity was observed when the bacter-

Table I. Transcription interference assay. Strains/growth conditions Plasmid pRK-CAT pRK-14-CAT pRK-28-CAT pRK-72-CAT

Phase 1 7865

7865/MGSO 4

Phase 11'. 7866

100 070 55 % 90 070 96 070

98 070 93 % 98 070 100 070

98 070 96 % 95 070 100 070

7866/MGSO 4 100 95 95 96

070 070 % %

The valuesare givenin relativeCATactivitywiththe valueof pRK-CATin strain BB7865taken for 100 o7o.The standard deviation are between4 % and 6 40.

FUNCTIONAL ANAL YSIS OF THE PERTUSSIS TOXIN PROMOTER ia were growz un~*.r modulative conditions, sug.. gesting that the action of this DNA binding protein is under control of the bvg locus. It is likely that this protein is identical with the factor which impairs the activity of the lac promoter in our in vivo assay. Roy and Falkow (199!) could demonstrate in vitro binding of the P,vgA protein to the bvg and f h a promoters using E. coli lysates containing BvgA p;otein. Interestingly, n o in vitro binding activity to the ptx and cya promoters could be detected in similar E. coli extracts (Huh a n d Weiss, 1991). Consequently, it was suggested that the protein binding to the ptx a n d cya promoters present in the 13ordetella lysates might be distinct from BvgA. Using a transcription interference assay as indirect evidence of protein binding in vivo and purified BvgA protein instead of cellular lysates containing the BvgA protein for in vitro assays, we were able to confirm these findings. However, it should be pointed out that the results of the various in vitro binding assays with the ptx promoter remain inconclusive. Still, there are several possible explanations for the lack of in vitro binding of the BvgA protein to the ptx promoter. For instance, it is possible that the BvgA protein must be modified (e.g. by phosphorylation) for binding to some targets such as the ptx promoter, but not to others such as the bvg and f h a promoters. In all cases, the source of the BvgA protein was an overproducing E. coli strain. The BvgA protein used in this study was purified from an E. coli strain which did not express the BvgS sensor protein. Therefore, it is possible that the relevant modification(s) does not occur in the heterologous host or that it is lost duri,'g purification. In conclusion, the available data do not yet permit a definitive identification of the protein factor(s) binding to the ptx promoter, although it is likely that factors other than BvgA are involved. In this respect, the recent discovery of B. pertussis mutants which show strongly reduced transcription of virulence factors such as pertussis toxin but not of others, such as filamentous haemagglutinin, is important. These mutations cannot be c o m p l e m e n t e d by the bvg locus (Carbonetti and Gross, unpublished results). The

679

existence of such mutants argues strongly for the involvement of elements in the regulation of the virulence regulon of B. pertussis in additional to the bvg locus. The molecular characterization of these mutants is currently under way and should contribute substantially to the understanding of events underlying the regulation of the pertussis toxin and other virulence factors.

Acknowledgements

Part of this work was carried out in the laboratory of A. Ullmann, Institut Pasteur, to whom we are especially grateful for her generous help and for many stimulating discussions. The authors would like to thank V. Scarlato and

K. Maundrell for helpful discussions, B. Arico and R. Manetti for the gift of purified BvgAprotein, A. Blondel and D. Ladant for help with site-directed mutagenesis and A. Ullmann for critical reading of the manuscript. Furthermore, we thank H. Mollenkopf for his help with computer analysis and G. Corsi and J. Lortholary for the drawings. The work carried out at the Institut Pasteur was supported by grants from EMBO and ADIP to R.G.

Analyse fonctionnelle du promoteur de la toxine pertussique

L'expression de l'op~ron de la toxine pertussique est r~gul~e de fa¢on rositive en cis, par une region promoteur de 170 pb, et en trans, par le locus bvg qui code pour la protSine aetivatrice ,ranscriptionnelle BvgA. Le promoteur contient deux unitds de r~petition directes qui ,ont essentielles pour son activitY. Quand la position de ces unites de repetition directes relative au point de d6part de la transcription es! chang6e, l'activit(~ du promoteur est fortemere alt6rde. Les sdquences rdpdtdes ne reprdsentent done pas des dl6ments semblables aux amplificateurs ¢omme ceux qui ont dt6 identifi~s dans d'autres promoteurs r(~gul~s positivement ; par comte, l'int6gritd de la totalit~ de la r6gion promoteur semble ~tre un caract(~re important de la r6gulation de ptx. Pour aaalyser la liaison in vivo entre les protdines rdgulatrices et le promoteur ptx, nous avons mesur~ l'inter fdrence dans la transcription. Les resultats nous permetter, t de suggerer que les unit~s de r~petition directes constituent la s6quence de reconnaissance d'une pretdine qui se lie ~ elles seulement dans certaines conditions dans lesquelles le promoteur est active. Des experiences in vitro de liaison d'ADN avecla proteine BvgA purifiee provenant

680

R. G R O S S E T A L .

d'une souche surproductrice de Escherichia coil, ont 6t~ men~s/~ bien. Cependant, aucune liaison n'a ~t~ observ6e entre la protdine BvgA et le promoteur p t x dans les conditions oh se produit la liaison entre la prot~ine BvgA et les promoteurs f h a et bvg. Cela nous permet de penser que des facteurs suppl6mentaires au syst6me bvg sont impliqu6s duns le contr61e du r6gulon de la virulence de Bordetella.

Mots-clds: Bordetella, Toxine pertussique, Promoteur, Virulence; R~gulation.

References Adhya, S. (1989), Muhipartite genetic control eleme, ts: communication by DNA loop. Ann. Rev. Genet., 23, 227-250. Albright, L.M., Huala, E. & Ausubel, F.M. (1989), Piokaryotic signal transduction mediated by sensor and regulator protein pairs. Ann. Rev. Genet., 23, 311-336. Arico, B., Miller, J.F., Roy, C., Stibitz, S., Monack, D., Falkew, S., Gross, R. & Rappuoli. R. (1989), Sequences reouired for expression of Bordetell,; pertussis virulence factors share homology with prokaryotic signal transduction proteins. Proc. natl. Acad. Sci. USA, 86, 6671-6675. Arico, B., Scarlato, V., Monack, D., Falkow, S. & Rappupil, R. (1991), Structural and genetic analysis of the bvg locus in Bordetella spe(les. Molec. Microbiol., 5, 2481-2491. Beattie, D.T., Knapp, S. & Mekaianos, J.J. (1990), Evidence that modulation requires sequencesdownstream of the promoters of two vir-repressed genes of Bordetella pertussis. J. BacterioL, 172, 6997-7004. BIondel, A. & Thillet, J. (1990), A fast and convenient way to produce single-stranded DNA from a phagemid. Nucleic Acids Res., 19, 181. Bordet, J. & Gengou, O. (1909), L'endotoxine coquelucheuse. Ann. Inst. Pasteur (Paris), 23, 415-419. Forst, S. & Inouye, M. (1988), Environmentally regulated gene expression for membrane proteins in Escherichia coll. Ann. Rev. Cell. Biol., 4, 21-42. Friedman, A.M., Long, S.R., Brown, S.E., Buikema, W.J. & Ansubel, F.M. (1982), Construction of a broad host range cosmid cloning vector and its use in the genetic analysis of Rhizobium mutants. Gene, 18, 289-296. Goyard, S. & Ullmann, A. (1991), Analysis of Bordetella pertussis cya operon regulation by use of cya-lac fusions. FEMS Microbiol. Lett., 77, 251-256. Gross, R. & Rappuoli, R. (1988), Positive regulation of pertussis toxin expression. Proc. natl. Acad. Sci. USA, 85, 3913-3917. Gross, R. & Rappuoli, R. (1989), Pertnssis toxin promoter sequences involved in modulation. J. Bacteriol., 171, 4026-4030. Gross, R., Arico, B. & Rappuoli, R. (1989a), Genetics of pertussis toxin. Molec. Microbiol., 3, 119-124. Gross, R., Arico, B. & Rappuoli, R. (1989b), Families of bacterial signal transducing proteins. Molec. Microbiol., 3, 1661-1667.

Hess, J.F., Bourret, R.B. & Simon, M.1. (1988), Histidine phosphorylation and pilosphoryl group transfer in bacterial chemotaxis. Nature, 336, 139-143. Huh, Y.J. & Weiss, A.A. (1991), A 23-Kilodalton protein, distinct from BvgA, expressed by virulent Bordetella pertussls binds to the promoter region of vir-regulated toxins. Infect. lmmun., 59, 2389-2395. lgo, M.M., Ninfa, A.J,, Stock, J.B. & Silhavy, T.J. (1989), Phosphorylation and dephosphorylation of a bacterial transcriptional activator by a transmembrane receptor. Genes & Dev., 3, 1725-1734. Keen, N.T., Tamaki, S., Kobayashi, D. & Trollinger, D. (1988), Improved broad-host-range plasmids for DNA cloning in Gram-negative bacteria. Gene, 70,191-197. Keener, J. & Kustu, S. (1988), Protein kinase and phosphoprotein phosphatase activities of nitrogen regulatory proteins NTRB and NTRC of enteric bacteria: Roles of conserved amino-terminal domain of NTRC. Proc. natl. Acad. Sci. USA, 85, 4976-4980. Kunkel, T.A. (1985), Rapid and efficient site-specificmutagenesis without phenotypic selection. Proc. natl. Acad. Sci. USA, 82, 488-492. Lacey, B.W. (1960), Antigenic modulation of Bordetella pertussis. J. Hyg., 58, 57-93. Laoide, B. & Ullmann, A. (1990), Virulence dependent and independent regulation of the Bordetellapertussis ¢ya operon. EMBO J., 9, 999-1005. Leslie, P.H. & Gardner, A.D. (1931), The phases of Haemophil.ls pertussis. J. Hyg., 31,423-455. Maeda, S., Ozawa, Y., Mizuno, T. & Miznshima, S. (1988), Stereospecific positioning of the cis-acting sequence with respect to the canonical promoter i: required for activation of the ompC gene by a positive regulator, OmpR, in Escherichia coll. J. mol. Biol., 202, 433-441. Magasanik, B. (1989), Reversible phosphorylation of an enhancer binding regulates the transcription of bacterial nitrogen utilization genes. TIBS, 13, 475-479. Maniatis, T., Fritseh, E.F. & Sambrook, J. (1982), Molecular cloning: A laboratory manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY, USA). Melton, A.R. & Weiss, A.A. (1989), Environmental regulation of expression of virulence determinants in Bordetella pertussis. J. Bacteriol., 171, 6202-6212. Miller, J.F., Roy, C.R. & Falkow, S. (1989), Analysis of Bordetella pertussis virulence gene regulation by use of transcriptional fusions in Escherichia coll. J. Bacteriol., 171, 6345-6348. Nicosia, A. & Rappuoli, R. (1987), Promoter of the pertnssis toxin operon and production of pertussis toxin. J. Bacteriol., 169, 2843-2846. Ninfa, A.J. & Magasanik, B. (1986), Covalent modification of the glnG product, NRI, by the glnL product, NRII, regulates the transcription of the glnALG opeton in Escherichia coli. Proc. natl. Acad. Sci., USA, 83, 5909-5913. Popham, D.L., Szeto, D., Keener, J. & Kustu, S. (1989), Function of a bacterial activator protein that binds transcriptional enhancers. Science, 243, 629-635. Powell, B.S. & Kado, C.I. (1990), Specific binding of VirG to the vir box requires a C-terminal domain and exhibits a minimum concentration threshold. Molec. Microbiol., 4, 2159-2166. Rampersaud, A., Norioka, S. & lnouye, M. (1989), Characterization of OmpR binding sequences in the up-

F U N C T I O N A L A N A L YSIS OF THE PER TUSYlS TO.WIN P R O M O T E R stream region of the ompF promoter essential for transcriptional activation. J. Biol. Chem., 264, 18693-18700. Reitzer, L.J. & Magasanik, B. (1985), Expression of glnA in Escherichia coil is regulated at tandem promoters. Proc. Natl. Acad. Sci. USA, 82, 1979-1983. Roy, C.R. & Falkow, S. (1991), Identification of Bordetellapertussis regulatory sequences required for transcriptional activation of the fhaB gene and autoregulation of the bvgAS operon. J. Bacteriol., 173, 2385-2392. Roy, C.R., Miller, J.F. & Falkow, S. 0990), Autogenous regulation of the Bordetella pertussis bvgABC operon. Proc. Natl. Acad. Sci. USA, 87, 3763-3768. Scarlato, V., Prugnola, A.. Arico, B. & Rappuoli, R. (1990), Positive transcriptional feedback at the bvg locus controls expression of virulence factors in Bordetella pertussis. Proc. natl. Acad. Sci. USA, 87, 6753-6757. Stainer, D.W. & Scholte, M.J. (1970), A simple chemically defined medium for the production of phase I Bordetella pertussis. J. gen. ?dioobiol., 63, 211-220.

681

Stock, J.B., Stock, A.M. & Mottonen, J.M. (1990), Signal transduction in bacteria. Nature, :344, 395-400. Tsung, K., Brisette, R.E. & Inouye, M. (1990), Enhancement of RNA polymerase binding to promoters by a transcriptional activator, OmpR, in Escherichia coli: Its positive and negative effects on transcription. Proc. natl. Acad. Sci. USA, 87, 5940-5944. Wedel, A., Weiss, D.S., Popham, D., Drocge, P. & Kus;.u, S. (1990), A bacterial enhancer functions to tether a transcriptional activator near a promoter. Science, 248, 486-490. Weiss, A.A. & Falkow, S. (1984), Genetic analysis of pha;e change in Bordetella pertussis. Infect. Immun., 4 I, 263-269. Weiss, V. & Magasanik, B. (1988), Phosphorylation ff nitrogen regulator I (Nail of Escherichia coll. Prec. Natl. Acad. 3ci. USA, 85, 8919-8923. Willems, R., Paul, A., van der Heide, H.G.J., ler Avest, A.R. & Mooi, F.R. (1990), Fimbrial phase variation in Bordetella pertussis: a novel mechanism for transcriptional regulation. EMBO J., 9, 2803-2809.