crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 37, pp. 19449 –19461, September 9, 2016 © 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

Functional Characterization of Propeptides in Plant Subtilases as Intramolecular Chaperones and Inhibitors of the Mature Protease* Received for publication, June 18, 2016, and in revised form, July 21, 2016 Published, JBC Papers in Press, July 22, 2016, DOI 10.1074/jbc.M116.744151

Michael Meyer‡, Sebastian Leptihn§, Max Welz‡, and X Andreas Schaller‡1 From the ‡Institute of Plant Physiology and Biotechnology and the §Department of Microbiology, University of Hohenheim, D-70593 Stuttgart, Germany Subtilisin-like serine proteases (SBTs) are extracellular proteases that depend on their propeptides for zymogen maturation and activation. The function of propeptides in plant SBTs is poorly understood and was analyzed here for the propeptide of tomato subtilase 3 (SBT3PP). SBT3PP was found to be required as an intramolecular chaperone for zymogen maturation and secretion of SBT3 in vivo. Secretion was impaired in a propeptide-deletion mutant but could be restored by co-expression of the propeptide in trans. SBT3 was inhibited by SBT3PP with a Kd of 74 nM for the enzyme-inhibitor complex. With a melting point of 87 °C, thermal stability of the complex was substantially increased as compared with the free protease suggesting that propeptide binding stabilizes the structure of SBT3. Even closely related propeptides from other plant SBTs could not substitute for SBT3PP as a folding assistant or autoinhibitor, revealing high specificity for the SBT3-SBT3PP interaction. Separation of the chaperone and inhibitor functions of SBT3PP in a domain-swap experiment indicated that they are mediated by different regions of the propeptide and, hence, different modes of interaction with SBT3. Release of active SBT3 from the autoinhibited complex relied on a pH-dependent cleavage of the propeptide at Asn-38 and Asp-54. The remarkable stability of the autoinhibited complex and pH dependence of the secondary cleavage provide means for stringent control of SBT3 activity, to ensure that the active enzyme is not released before it reaches the acidic environment of the trans-Golgi network or its final destination in the cell wall.

Subtilases (SBTs)2 are found in all kingdoms of life. They constitute the S8 family of serine peptidases (1) and are characterized by a specific arrangement of the aspartate, histidine, and serine residues of the catalytic triad within the active site of the enzyme (2). SBTs include general proteases with relaxed substrate specificity for protein degradation and turnover as well as processing enzymes that cleave selected substrates at highly

* This

work was supported by German Research Foundation (DFG) Grant SCHA 591/4-1 (to A. S.). The authors declare that they have no conflicts of interest with the contents of this article. 1 To whom correspondence should be addressed. Tel. 49-711-459-22197; Fax: 49-711-459-23751; E-mail: [email protected]. 2 The abbreviations used are: SBT, subtilase; CD, circular dichroism; ORF, open reading frame; PP, propeptide; PC, proprotein convertase; PA, proteaseassociated; GuHCl, guanidine hydrochloride; ER, endoplasmic reticulum; PICS, proteomic identification of cleavage sites; IMC, intramolecular chaperone; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine.

SEPTEMBER 9, 2016 • VOLUME 291 • NUMBER 37

specific sites (3). Most bacterial SBTs are of the catabolic type including subtilisin E and subtilisin Carlsberg from Bacillus subtilis and Bacillus licheniformis, the prototypical members of the S8A subfamily of subtilases (4). The type-example for subfamily S8B is kexin from Saccharomyces cerevisiae, which was identified as the first SBT from eukaryotes and the first with narrow specificity for dibasic cleavage sites (5). Dibasic cleavage specificity is typically found also in the seven kexin-related proprotein convertases (PCs) in mammals (6). In contrast, all plant SBTs belong to subfamily S8A. They are thus more closely related to bacterial subtilisins than to kexin, but they comprise both, general proteases for protein turnover as well as processing enzymes for limited proteolysis at highly specific sites (7, 8). Early structural investigations of subtilisin E showed that it is produced with an N-terminal signal peptide targeting the protein to the periplasmic space and a 77-amino acid prodomain, which is located between the signal peptide and the catalytic domain but is not part of the mature enzyme (9, 10). The general preproprotein structure is shared with mammalian and plant SBTs, and it evolved convergently in numerous other serine-, aspartate-, cysteine-, and metalloproteases, highlighting the importance of this type of domain organization (10 –14). Although the catalytic domain is generally well conserved between plant SBTs and the prototypical bacterial SBTs, there are also distinctive plant-specific features. Between the His and the Ser residues of the catalytic triad, most plant SBTs carry a large insertion of some 120 amino acids, the so-called proteaseassociated (PA) domain. X-ray structure analysis of SBT3 from tomato revealed that the PA domain mediates homo-dimerization via interaction with an unusual ␤-hairpin that is not found in bacterial SBTs resulting in the activation of the tomato enzyme (15). However, structural modeling of representative Arabidopsis SBTs indicated that PA domain-mediated dimerization as an autoregulatory mechanism for enzyme activation is unlikely to be a general property of all plant SBTs (16). Consistent with this notion, dimerization was not observed in the second structurally characterized plant subtilase, cucumisin from melon fruits (17). In cucumisin, the PA domain is located comparatively close to the active site channel and appears to contribute to substrate selectivity (17). Additional distinguishing features of SBT3 and cucumisin as compared with bacterial SBTs include a stabilizing fibronectin III-like domain at the C terminus and the lack of bound calcium (15, 17). Two Ca2⫹ binding sites, one of high and the other of JOURNAL OF BIOLOGICAL CHEMISTRY

19449

Function of Propeptides in Plant Subtilases β1 SBT3 PP SBT1.4 PP SBT1.1 PP SBT1.2 PP SBT1.3 PP AtSBT1.9 PP SubtilisinE PP

α1

. . . . | . . . . | . . . . | . . . . |

23 28 23 21 27 21 30

- - - - - QR S T Y - - - QN F R S T Y - - - - QN F R T Y - - - - SD L ET Y - - - E L E AK T Y - - - - - ETSPY AGK S S T E K K Y

I I I I I I I

*.

. . | . . . . | . . . . | . . .

*|

. . . . | . . . . |

V H L D K S L M P N - - - - V F T D H H H WH S S T I D S I K A S V P S S V D V H L D K S L M P N - - - - V F T D H H H WH S S T I D S I K A S V P S S L N V Q L H P Q H A S T R T - - P F S S K L QWH L S F L E N F I S - - - - - - S V Q V E S P E S Q I S T Q S S R V D L E SWY N S F L P K T I A - - - - - I A F R V D S F S K P A - - - - V F P T H Y HWY S S E F T E P V N - - - - - - I H MD L S A K P L - - - - P F S D H R S WF S T T L T S V I T - - - - - - V G F K Q T MS AM - - - - S S AK K K D V I S E K GGK - - - - - - - - - N1

β2 SBT3 PP SBT1.4 PP SBT1.1 PP SBT1.2 PP SBT1.3 PP AtSBT1.9 PP SubtilisinE PP

. . . . | . . . . | . . . . |

64 71 62 62 59 55 63

R FH S APK L V Y S YDN V R FH S V PK L V Y S YDH V GEN S S SR L L Y S YH S A G S D E K SWL I Y S Y R N V - - - - - - - I LH V YDN V - - NRK PK I I Y AY TD S - - - - - - - V QK Q F K Y -

β3

α2

β4

. . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . .

LHGF SAV L SKD EL AALKK L PGF I SAYKDR T V EPH FHGF SAV L SKD ELK ALKK S PGF I SAYKDR T V EPD F EGF AAL L S EN E LK ALKK SND V L S I Y P ERK L E VQ I K G F A A R L S A K Q V K E M E K K P G F I S AW P Q R I L S L H F H G F S A S L S P F Q A A S V L QH P S I L A T F E D R R R Q L H V H G F S A V L T N S E L QR L K H K P G Y V S F T K D L P V K L H V N A A A A T L D E K A V K E L K K D P S V A Y V E E D H I AH E Y

| . . .

TTHT TTYT TTYS TTHT TTRS TTFS AQ S V

N2

FIGURE 1. Alignment of subtilase propeptides. Alignment of the propeptides from six plant subtilases and bacterial subtilisin E, all without their signal peptides and with four N-terminal amino acids of the catalytic domain. Signal peptide cleavage sites were determined with SignalP 4.0 (64). The sequence alignment with secondary structure prediction was generated using PROMALS3D (31) with some manual editing in the loop region between ␣1 and ␤2. Part of this loop was exchanged in a domain-swap experiment, and this part is highlighted in white letters on gray shading. Highly conserved residues (identical in ⬎75% of the sequences) and partially conserved residues are shaded in black and gray, respectively. Conserved ␣-helices and ␤-strands are indicated as gray helices or arrows above the alignment. Conserved hydrophobic regions N1 and N2 are underlined. Residues are numbered from the first Met. The black arrow shows the autocatalytic processing site at the prodomain junction. Amino acids identified by N-terminal sequencing are underlined in the SBT3PP sequence, and the internal cleavage site residues (Asn-38, Asp-54) are indicated (asterisks).

low affinity, are typically found in S8A subtilases (3), and the binding of calcium ions contributes to enzyme stability (18). Despite the lack of calcium, both SBT3 and cucumisin exhibit remarkable thermal stability indicating that plants evolved different means to stabilize the subtilisin fold (8, 15, 16). The prodomain was not included in the crystal structure of SBT3 or cucumisin, and its function in plant SBTs is thus still poorly understood. In bacterial proteases, on the other hand, prodomain function has been studied intensively, e.g. in subtilisins and in ␣-lytic protease, where it is needed for correct folding and enzyme maturation (19, 20). When expressed without their propeptides, these proteases accumulate as partially folded, inactive intermediates that are kinetically trapped in a molten globule-like conformation. In the presence of the corresponding propeptides they acquire their native state indicating that the propeptides assist in protein folding. The function of propeptides has thus been described as that of an intramolecular chaperone in bacterial subtilisins and mammalian PCs alike (21, 22). However, unlike chaperones, which accelerate folding by blocking aggregation or other unproductive side pathways, propeptides act as specific single-turnover catalysts. They reduce the energy barrier of a transition state late in the folding pathway, thus allowing the zymogen to proceed from the molten globule to the native conformation (10, 11, 19, 20, 23, 24). As the propeptide is not part of the mature enzyme, it has to be processed during zymogen maturation. The process has been studied for bacterial and some mammalian SBTs where it depends on the functional catalytic triad and is thus autocatalytic (25, 26). Also, in tomato SBT3 the prodomain is processed in an autocatalytic and intramolecular reaction, as active-site mutants are no longer processed and cannot be rescued by the wild-type enzyme provided as a separate polypeptide in trans (27). However, autocatalytic processing of subtilisin is not sufficient to release the active enzyme as the propeptide remains non-covalently bound to the catalytic domain acting as an auto-

19450 JOURNAL OF BIOLOGICAL CHEMISTRY

inhibitor. Inhibition by the cognate prodomain has been demonstrated for bacterial, mammalian as well as plant SBTs. It likely serves to keep the protease inactive until it reaches its final subcellular destination, thus preventing precocious activation and inappropriate proteolysis (28 –30). This autoinhibitory mechanism implies that the interaction of the propeptide with the catalytic domain and, hence, latency of the zymogen are broken in a compartment-specific manner. In the well studied case of furin, for example, release of the propeptide requires a second autocatalytic cleavage event, which is pH-dependent and thus occurs only when the zymogen reaches the trans-Golgi network (26). How the process might be regulated in plants is entirely unknown. It is also unclear to what extent propeptides of plant SBTs resemble bacterial and mammalian homologs with respect to their role during enzyme folding and which features of the propeptides may contribute to their activity as intramolecular chaperones and enzyme inhibitors. These are the questions that were addressed here for the interaction of tomato SBT3 with its own as well as alien propeptides.

Results Secondary Structure of the SBT3 Propeptide—To obtain first structural insight into the propeptide (PP) of SBT3 and its relation to the PPs of other plant SBTs and bacterial subtilisin, we generated a structure-based multiple sequence alignment using PROMALS3D, thereby including three-dimensional structure information and secondary structure prediction as additional constraints for the alignment (31). Despite the overall low sequence identity (16.9% between the PPs of SBT3 and subtilisin E), the conserved hydrophobic sequence motifs N1 and N2 that appear to be important for the chaperoning function of previously characterized PPs (21, 32, 33) could also be detected in the plant sequences (Fig. 1). The structural scaffold of two ␤-␣-␤ motives that is conserved in PPs of bacterial subtilisins and mammalian PCs and important for their interaction with VOLUME 291 • NUMBER 37 • SEPTEMBER 9, 2016

-S

A

BT 3 -S P BT P 1 - S .1 BT PP 1 - S .2 BT PP 1 - S .3 BT PP 1 - A .4 tS PP BT 1. 9 PP

Function of Propeptides in Plant Subtilases

(kDa) 63 48 35 28 17

&S PP 3

PP

100 75 63

-S

BT

1.

3 1.

-S

BT

3

PP

PP BT

BT -S

(kDa)

-S

BT -S

3

C

3

B

∆S

-K

-K

10

(kDa) 63 48 35

48

28

35

17 10

FIGURE 2. Purification of SBT3 and subtilase propeptides. A and C, subtilase propeptides (A) and the Ser-57-to-Lys-70 propeptide loop mutants (C; ⌬S-K, &S-K) were purified by affinity chromatography, and 2 ␮g were separated by 15% SDS-PAGE. B, SBT3 was purified from the supernatant of a tomato cell suspension culture, and 0.5 ␮g were separated by 12% SDS-PAGE. Gels were stained with Coomassie Brilliant Blue R-250. The molecular masses of the marker proteins are indicated.

cognate catalytic domains (21, 34, 35) was also predicted for the PP of SBT3 (SBT3PP) and other plant SBTs (Fig. 1). To further investigate secondary structure composition, SBT3PP was expressed in Escherichia coli as an N-terminally His-tagged fusion protein. As previously reported for the PP of cucumisin (30), SBT3PP was found to be insoluble in E. coli and accumulated in inclusion bodies. The recombinant protein was solubilized in 8 M urea and purified to apparent homogeneity by affinity chromatography on nickel-agarose beads under denaturing conditions (Fig. 2A). Renaturation was achieved at a concentration of 0.5 mg/ml by dialysis against 50 mM HEPES buffer containing 50 mM Arg and Glu (36) resulting in ⬎70% soluble SBT3PP, which was analyzed for secondary structure content by circular dichroism (CD) spectroscopy in the far UV range. Unfortunately, because of a generally weak signal that required high protein concentrations, spectra could not be recorded all the way down to 190 nm, and a reliable deconvolution of the data for estimation of secondary structure composition was thus not possible. However, strong negative ellipticity was observed at 222 nm, indicting the presence of significant ␣ helical content in addition to unstructured regions as indicated by the strong signal below 205 nm (Fig. 3A). Tryptophan fluorescence spectroscopy was then used to analyze thermal unfolding of SBT3PP during heating from 25 °C to 90 °C. Unfolding occurred in a broad temperature range without a clear transition point, and refolding upon cooling exhibited the same temperature characteristics (Fig. 3C). The data indicate that weak secondary structure is present in the free SBT3PP. SBT3PP thus resembles the PP of cucumisin with respect to secondary strucSEPTEMBER 9, 2016 • VOLUME 291 • NUMBER 37

ture content and stability (30). In contrast, PPs of mammalian PCs are only marginally stable on their own (with the exception of the PP in PC1 from Mus musculus), and the PPs of bacterial subtilisins are fully unfolded at 25 °C (35, 37, 38). Only after binding to subtilisin, these PPs acquire regular secondary structure going from a disordered to a highly ordered state (38). To assess whether SBT3PP shows a similar increase in stability after binding to SBT3, we expressed SBT3 in a transgenic cell suspension culture as a homologous expression system and purified the mature recombinant enzyme to apparent homogeneity essentially as described (27) (Fig. 2B). The complex of mature SBT3 with its PP was established at 4 °C with a 10-fold molar excess of the propeptide followed by gel filtration to separate the complex from unbound SBT3PP (Fig. 4). Thermal unfolding of the free protease and the protease-propeptide complex was monitored by CD spectroscopy at 220 nm (Fig. 3B). Consistent with previous reports (15), SBT3 exhibited considerable thermal stability, with 76 °C as the transition point for unfolding. In contrast to bacterial subtilisin, which is destabilized by binding of its propeptide, resulting in a reduced melting temperature of the complex in comparison to the free protease (33), the SBT3-SBT3PP complex showed a marked increase in melting temperature to 87 °C, which was 11 °C above that of free SBT3. Interestingly, unfolding was quicker and the cooperativity of unfolding higher, as indicated by the steeper slope of the transition, for the complex as compared with the free enzyme (Fig. 3B). We conclude that the interaction of SBT3 and its propeptide stabilizes the domain structure of the complex, increasing the already remarkable thermal stability of SBT3 significantly. Requirement of SBT3PP and Related Plant PPs for Folding and Secretion—The data indicate similarities between the PPs of SBT3 and cucumisin. The latter is the only plant PP characterized so far and was described as an autoinhibitor of its mature enzyme (30). In the following we investigated whether the function of plant PPs goes beyond this inhibitory role and includes that of an intramolecular chaperone for enzyme maturation. According to Shinde and Thomas (21), the chaperone function in the propeptide-mediated maturation pathway of bacterial subtilisins and mammalian PCs is apparent in three distinct stages: (i) the folding of the polypeptide to a structured state, (ii) autoprocessing of the PP resulting in a non-covalently associated PP-inhibited protease complex, and (iii) secondary cleavage of the PP to release the active enzyme . As an additional activity that is closely linked to their role in folding, PPs are also required for secretion or, in eukaryotes, for transport into specific compartments of the secretory pathway (21, 26, 39). To address the question of whether SBT3 requires folding assistance at all, we denatured the protein and tested whether or not it can refold in the absence of denaturant. Denaturation required harsh conditions because of the exceptional stability of SBT3. In fact, the enzyme retained ⬃80% activity after incubation in 8 M urea. Upon titration with guanidine hydrochloride (GuHCl), SBT3 unfolded with a transition midpoint at 5.8 M (Fig. 5A). Therefore, to fully denature the protein, it was subjected to 8 M GuHCl or, alternatively, TCA precipitation. In an attempt to renature the protein, TCA/GuHCl was removed by dialysis. Refolding resulted in soluble protein, but differences in JOURNAL OF BIOLOGICAL CHEMISTRY

19451

Function of Propeptides in Plant Subtilases

B 0

1.0 fraction of unfolded protein

[Θ] MRW (deg -7 cm 2 dmol -1 )

A -500 -1000 -1500 -2000 -2500 -3000

200

210

220

230

240

250

260

with SBT3PP without SBT3PP

0.8 0.6 0.4 0.2 0.0 55

60

C

65

70

75

80

85

90

95

100

temperature (°C)

wavelength (nm) 1.00 0.90 0.85 0.80

0.4

0.75 0.70

0.2 0.0 unfolding phase 30

40

refolding phase 50

60

70

80 90 80 temperature (°C)

70

60

50

40

1st derivative (10-3)

350/330 nm ratio

0.95

30

FIGURE 3. Structure and stability of the SBT3 propeptide. A, circular dichroism spectroscopy of recombinant SBT3PP. SBT3PP (15 ␮M) was analyzed in 20 mM sodium phosphate buffer, pH 7.5, at 20 °C. Data represent the average of four scans corrected for the buffer control. B, thermal unfolding of SBT3 (closed circles) and the SBT3-SBT3PP complex (open circles). The loss of secondary structure was monitored by CD spectroscopy at 220 nm and is shown as the fraction of protein unfolding with increasing temperature. C, thermal stability of SBT3PP. Thermal unfolding (left) was analyzed in a Prometheus NT.48 instrument (NanoTemper Technologies). Tryptophan fluorescence was recorded at 350 and 330 nm, and the 350/330 nm ratio is plotted against the temperature (black line). There is no well defined peak in the first derivative (dotted line) and, therefore, no clear transition point for protein unfolding (left panel). After the unfolding reaction, protein refolding was recorded in the same assay under decreasing temperature conditions (right panel).

the CD and Trp fluorescence spectra showed that SBT3 did not assume its native conformation (Fig. 5, B and C). A red shift was observed for the fluorescence maximum, indicating increased solvent accessibility of Trp residues (Fig. 5B) in renatured as compared with native SBT3. However, the protein was not completely unfolded. CD spectroscopy revealed considerable secondary structure in SBT3 renatured from 8 M GuHCl or TCA, which is reminiscent of the molten globule-like state described for partially folded subtilisin (Fig. 5C). The data suggest that SBT3 requires assistance to complete its folding pathway. However, our attempts to refold the protein in the presence of its PP were not successful and did not result in native-like CD or fluorescence spectra within the time frame of the experiment (2 weeks). Also in subtilisin, refolding is very slow when the propeptide is added in trans (24). As compared with the intramolecular process, the bimolecular reaction is at least 1000-fold slower, resulting in 50% refolding after 8 days at 4 °C (22). Being unable to directly demonstrate chaperone activity for SBT3PP in vitro, we looked at the in vivo situation where folding is intimately linked to secretion (39). In eukaryotes, proteins are co-translationally targeted to the endoplasmic reticulum (ER), fold in the ER, and need to pass ER quality control as a prerequisite for further sorting along the secretory pathway and secretion, whereas misfolded proteins are targeted for degradation (40). Secretion was thus used as a proxy for successful folding in vivo (26). Folding/secretion of SBT3 and its dependence on the PP were analyzed by transient expression of the

19452 JOURNAL OF BIOLOGICAL CHEMISTRY

test proteins in Nicotiana benthamiana plants. We previously used this system to demonstrate that the PP of SBT3 is processed in an intramolecular autocatalytic reaction in the ER (27). Active site (S538A, S538C) mutants of SBT3 accumulated in the ER as unprocessed precursors indicating that the activity of SBT3 and autocatalytic processing are required for secretion of the mature enzyme (27). The question of whether SBT3 depends on its PP for folding and sorting was addressed by use of a SBT3 deletion mutant (SBT3⌬PP) lacking the PP sequence (residues Gln-23 to His112). Upon transient expression in N. benthamiana, wild-type SBT3 was processed and secreted to the apoplastic space. In contrast, SBT3⌬PP was only detected intracellularly at a much reduced expression level, indicating that the mutant did not pass ER quality control (Fig. 6). Co-expression of SBT3⌬PP with its PP as a separate polypeptide chain partially restored accumulation of SBT3⌬PP and export to the apoplast (Fig. 6). The data confirm a requirement of SBT3 for its prodomain for secretion. They further suggest that SBT3PP, like the PP of subtilisin (19), is able to provide folding assistance in trans. SBT3PP thus resembles PPs in bacterial and mammalian SBTs with respect to their chaperone-like activity (21, 22). Addressing the question of specificity, additional closely and more distantly related PPs were tested for the ability to substitute for SBT3PP as folding assistants, including the PPs of selected tomato subtilases (SBT1.4, SBT1.2, SBT1.1, and SBT1.3, exhibiting 90, 52, 34, and 34% sequence identity with SBT3PP, respectively) and the closest homolog of SBT3 in AraVOLUME 291 • NUMBER 37 • SEPTEMBER 9, 2016

Function of Propeptides in Plant Subtilases 100 80

40

60 40

20

A

360 355 Fmax (AU)

60

rel. activity (%)

A280

A

350

20 0

345

75 43 35

340 0

28 17 10

B

A280

40 30

20

20 10

rel. activity (%)

50 30

10

0

kDa

2

3

1.0 normalized fluorescence

B

0

75 43 35 28 17 10

1

4

5

6

7

[GuHCl] (M)

SBT3 native refolded from GuHCl

0.8 0.6 0.4 0.2 0.0

320

340

360

380

400

420

440

wavelength (nm)

25

C

SBT3 native refolded from TCA precipitation refolded from 8 M GuHCl

20 * *

FIGURE 4. Purification of the SBT3-SBT3PP complex. SBT3 and the SBT3SBT3PP complex were separated by gel filtration. Fractions were analyzed by SDS-PAGE and SBT3 activity assay using a fluorigenic peptide substrate. A, gel filtration of SBT3 (100 ␮g) monitored at 280 nm (solid line). SBT3 activity was assayed in 50 ␮l aliquots of the fractions (diamonds). 15-␮l aliquots of the same fractions were separated by 15% SDS-PAGE, and the Coomassie-stained gels are shown below the chromatogram. The gel on the very left shows the protein preparation used in the experiment containing SBT3 (open triangle) and a degradation product (closed triangle). B, SBT3 (46 ␮g) incubated for 10 min in presence of a 10-fold molar excess of SBT3PP was separated by gel filtration, and fractions were analyzed as described for A. The gel on the very left shows the protein preparations used in the experiment for SBT3 (open and closed triangles) and SBT3PP (asterisk).

bidopsis (AtSBT1.9, 42% sequence identity; cf. Fig. 1). Most PPs were inactive; only the most similar one, SBT1.4PP sharing 90% sequence identity with SBT3PP, supported secretion of SBT3⌬PP to some extent. However, neither the expression level nor secretion was restored to a level comparable with SBT3PP (Fig. 6). SBT3 thus exhibits a specific requirement for its own prodomain for folding and secretion, indicating that the ␤-␣-␤-␤-␣-␤ fold that is shared with PPs of SBTs in plants and other organisms is not sufficient for the chaperone function. Ability of SBT3PP and Related Plant Propeptides to Associate with SBT3 in an Auto-inhibited Complex—The highly specific requirement of SBT3 for SBT3PP during folding/secretion raised the question of whether SBT3 exhibits a similar specificity for its cognate prodomain with respect to the formation of the PP-inhibited protease complex. To address this question, the different PPs were expressed in E. coli, solubilized from inclusion bodies in 8 M urea, purified by affinity chromatography, renatured by dialysis (Fig. 2A), and tested as inhibitors of SEPTEMBER 9, 2016 • VOLUME 291 • NUMBER 37

15 Θ (mDeg)

kDa

0

10 5 0 -5 -10 -15 190

200

210

220

230

240

250

260

wavelength (nm)

FIGURE 5. Structure and stability of SBT3. A, chemical denaturation of SBT3 (1.25 ␮M) by stepwise addition of GuHCl was recorded by tryptophan fluorescence spectroscopy. The background corrected fluorescence maxima from three independent experiments were plotted against the GuHCl concentration (0 –7 M). AU, absorbance units. B, tryptophan fluorescence of native SBT3 (solid line) and SBT3 renatured from 8 M GuHCl (dotted line). Normalized fluorescence is plotted against the wavelength. C, far-UV CD spectra of native SBT3 (solid line) and SBT3 renatured from TCA precipitation (dotted line) or 8 M GuHCl (dashed line). Spectra were recorded from 260 to 190 nm. For refolding, samples were incubated in 50 mM HEPES, pH 7.5, containing 50 mM Arg and Glu followed by dialysis against 20 mM phosphate buffer, pH 7.5.

SBT3 activity. Activity assays contained 90 nM SBT3 and a fluorigenic peptide substrate at 20 ␮M. The activity of SBT3 was strongly inhibited by its own PP with half-maximal inhibition (IC50) at 184 nM, corresponding to a 2-fold molar excess of the PP over the subtilase (Fig. 7A). Somewhat weaker inhibition of SBT3 activity was also observed for the closely related SBT1.4PP with an IC50 of 488 nM, whereas all other tested PPs turned out to be very poor inhibitors of SBT3 (Fig. 7A). ⬃60% of SBT3 activity was retained even at 100-fold molar excess of the more distantly related PPs (Fig. 7A; SBT1.1PP could not be JOURNAL OF BIOLOGICAL CHEMISTRY

19453

Function of Propeptides in Plant Subtilases SBT3∆PP and

100 75 63

total extract

120 rel. SBT3 activity (%)

ec - S tor BT -S 3 BT - S 3∆ BT PP - S 3P BT P - S 1. B T 1P P - S 1. B T 2P P - S 1. B T 3P P - A 1. t1 4P .9 P PP

(kDa)

-v

A

A

48 35

apoplastic wash

100 75

100 80 SBT3PP

60

SBT1.4PP SBT1.2PP

40

SBT1.3PP

20

AtSBT1.9PP

0

63

-2 0 1

48

10

35

100 1000 [propeptide] (nM)

10000

B SBT3∆PP and

(kDa) 100 75 63 48 35 100 75 63

0.5

0.0 1

10

100 1000 [propeptide] (nM)

10000

48 35

FIGURE 6. In vivo chaperone function of subtilase propeptides. SBT3⌬PP was expressed in N. benthamiana leaves with or without co-expression of different PPs. A, 20 ␮g of total leaf extract (top) or 4 ␮g of apoplastic proteins (bottom) were separated by 12% SDS-PAGE. Proteins were visualized by Coomassie-based staining with InstantBlue (Expedeon). The molecular weight of marker proteins is indicated. B, 4 ␮g of total leaf extract (top) or 1 ␮g of apoplastic proteins (bottom) from the samples used in A were separated as above and transferred to a nitrocellulose membrane. Blots were developed using a polyclonal antiserum against SBT3 (1:2000; Ref. 27) and a peroxidaseconjugated secondary antibody (1:10000, Calbiochem) with enhanced chemiluminescence detection. The position of SBT3 is indicated (black arrow).

tested in this experiment, because renaturation under different conditions did not result in soluble protein). The interaction of SBT3 with its PP in an autoinhibited complex is thus rather specific; SBT3 does not share the loose propeptide specificity reported for other subtilases, including bacterial subtilisins (41), mammalian PCs (42), and even cucumisin, which was shown to be inhibited by PPs from other plant species (30). To corroborate these findings we determined the dissociation constant (Kd) of the SBT3-propeptide complexes by microscale thermophoresis. Fluorescence-labeled SBT3 (30 nM) was titrated with increasing concentrations of the unlabeled PPs (2.44 –5000 nM for SBT3PP; 2.2–9000 nM for SBT1.4PP). Complex formation was recorded as a ligand-dependent change in thermophoresis and was plotted against the PP concentration (Fig. 7B). Dissociation constants of 73.5 ⫾ 10.8 nM and 1120 ⫾ 164 nM were derived from the saturation curves for the interaction of SBT3 with its own PP and with SBT1.4PP, respectively. For the remaining PPs no binding curves could be recorded, indicating that the Kd of their interaction with SBT3 is above the detection limit of the thermophoresis assay (⬎30 ␮M). A dissociation constant in the two-digit

19454 JOURNAL OF BIOLOGICAL CHEMISTRY

SBT1.4PP

fraction bound

BT -S 3 B - S T 3∆ B T PP - S 3P BT P - S 1. B T 1PP - S 1. B T 2PP - S 1. B T 3PP - A 1. t1 4P .9 P PP

-S

apoplastic wash

total extract

-v

ec

to

r

B

SBT3PP

1.0

FIGURE 7. Interaction of SBT3 with different subtilase PPs. A, inhibition of SBT3 activity by different PPs. 90 nM concentrations of purified SBT3 were incubated with increasing concentrations of the PPs from SBT3 (closed circles), SBT1.4 (open circles), SBT1.2 (diamonds), SBT1.3 (triangles), or AtSBT1.9 (squares). Activity was recorded over 15 min at room temperature using a fluorigenic peptide substrate. Activity is expressed in percent of SBT3 activity without PPs (100% corresponding to a reaction rate of 427.3 ⫾ 49.7 pmol/ min). Half-maximal inhibition (IC50) was observed at 158 nM for SBT3PP and at 372 nM for SBT1.4PP, respectively. GraphPad Prism 6 was used for curve fitting (GraphPad software; R2SBT3PP ⫽ 0.9715, R2SBT1.4PP ⫽ 0.9425). Results represent the mean of at least three independent experiments ⫾ S.D. B, dissociation constants of the SBT3/PP complexes analyzed by microscale thermophoresis. Labeled SBT3 (30 nM) was titrated with unlabeled SBT3PP (closed circles) and SBT1.4PP (open circles). The fraction of SBT3 bound in the complex is plotted against the PP concentration. Data points represent the mean ⫾ S.E. of three biological replicates using independent PP purifications. GraphPad Prism 6 was used for curve fitting (R2SBT3PP ⫽ 0.939; R2SBT1.4PP ⫽ 0.877).

nanomolar range for the SBT3-SBT3PP interaction indicates tight binding of the inhibitory PP to SBT3. A strong interaction between SBT3 and its PP is also consistent with the increase in thermostability that was observed for the complex as compared with the free protease (Fig. 3B). The 15-fold higher Kd for SBT1.4PP, the most closely related plant PP, is consistent with its reduced inhibitory potential (3-fold higher IC50) and indicates that the interaction of SBT3PP with its cognate protease is highly specific with respect to both the formation of an autoinhibited complex (Fig. 7) and folding assistance (Fig. 6). Folding Assistance by SBT3PP and Its Inhibitory Activity Are Not Necessarily Linked—The specificity observed here for the interaction of SBT3PP with SBT3 was unexpected considering the apparent promiscuity of PPs with respect to the inhibition of subtilases in bacteria. The subtilisins Carlsberg and BPN⬘, for example, are inhibited with similar efficiency by both their PPs, even though they share ⬍50% sequence identity (28). Furthermore, subtilisins are inhibited more effectively by the PP of VOLUME 291 • NUMBER 37 • SEPTEMBER 9, 2016

Function of Propeptides in Plant Subtilases

SEPTEMBER 9, 2016 • VOLUME 291 • NUMBER 37

120 rel. SBT3 activity (%)

A

100 80 60 40

SBT3PP

SBT1.3PP

SBT3PPΔS-K

SBT1.3PP&S-K

20 0 10

100 1000 [propeptide] (nM)

10000

-v

ec - S tor BT -S 3 BT - S 3∆ BT PP - S 3P BT P - S 3P BT D∆ - S 1. SBT 3PP K - S 1. BT 3PP - S 3P &S -K BT P 1. 3P P

SBT3∆PP and

(kDa) 100 75

total extract

B

63 48 100 75

apoplastic wash

Aqualysin I as compared with their own PPs, even though there is only 20% sequence conservation (41). The apparent specificity of SBT3 for its own PP also distinguishes it from the plant subtilase cucumisin. Cucumisin is inhibited not only by its own PP but also by PPs from Arabidopsis and rice subtilases (ARA12 and RSP1, respectively) that share ⬃36% sequence identity (30). Aiming to identify distinguishing features of SBT3PP that may be responsible for the specificity of interaction, we compared the plant PP sequences and found that the loop between helix ␣1 and strand ␤2 is extended in SBT3PP and SBT1.4PP, as compared with PPs that lacked inhibitory or chaperone activity (Fig. 1). To test whether this loop extension is responsible for the observed specificity, a domain-swap experiment was performed in which the respective region (residues Ser-57 to Lys70) was deleted from SBT3PP (SBT3PP⌬S-K) and inserted into the shorter loop of the apparently inactive PP of SBT1.3 (SBT1.3PP&S-K; cf. Fig. 1). The mutant PPs were expressed in E. coli, purified, and renatured as before (Fig. 2C). The activity of SBT3PP⌬S-K as an inhibitor of SBT3 was somewhat reduced as compared with the wild-type PP requiring a 3-fold higher concentration to achieve the same level of SBT3 inhibition (Fig. 8A). The loop extension thus seems to make only a minor contribution to the binding specificity of SBT3PP to the mature protease. It is also not sufficient to promote binding of an otherwise inactive PP, as the inhibitory activity of SBT1.3PP&S-K was not increased as compared with unmodified SBT1.3PP (Fig. 8A). Chaperoning activity of the modified PPs was analyzed in the transient expression assay for folding/secretion in N. benthamiana. The ability of the SBT3 propeptide to restore folding/ secretion was completely lost in the loop-deletion mutant, indicating that the extended loop, in addition to the generally conserved ␤-␣-␤-␤-␣-␤ fold, is absolutely required for the specific interaction of SBT3PP with SBT3 during zymogen maturation (Fig. 8B). Separation of the two activities, as evident from the complete loss of chaperoning activity as compared with a marginally impaired inhibitory activity, suggests that the PP interacts differently with immature SBT3 during folding and with mature SBT3 in the autoinhibited complex. Propeptide Cleavage and Release of Mature SBT3—The maturation of SBTs requires at least two proteolytic events, the first one separating the PP from the catalytic domain resulting in the non-covalently linked self-inhibited complex and the second one cleaving and destabilizing the PP, which is then released to result in the active enzyme. Both cleavages are autocatalytic in bacterial and mammalian SBTs, and consequently, multiple basic residues are found upstream of the two scissile bonds in PCs, reflecting the substrate specificity of these enzymes (29, 35). Although processing of the prodomain is also autocatalytic in plants (27), the residues downstream of the scissile bond appear to be at least as important for cleavage site recognition. These residues mark the N terminus of the mature proteases, which is highly conserved in plant SBTs (43, 44) with Thr-ThrXaa-Thr/Ser as the first four amino acids (Fig. 1; Xaa representing a positively charged or hydrophobic residue). The conserved N terminus suggests that plant SBTs may share a common mechanism for processing site recognition, which appears to be different from that in PCs or bacterial subtilisins.

63 48

FIGURE 8. Relevance of the Ser-57 to Lys-70 loop of SBT3PP for inhibition and folding. The Ser-57-to-Lys-70 loop (cf. Fig. 1) was deleted from SBT3PP and inserted into SBT1.3PP to investigate its contribution to inhibition and folding. A, SBT3 activity was measured against a fluorigenic substrate as described for Fig. 7 with increasing concentrations of SBT3PP (closed circles), SBT3PP⌬S-K (open circles), SBT1.3PP (closed triangles), and SBT1.3PP&S-K (open triangles), respectively. Data points represent the mean of three independent experiments ⫾ S.D. B, transient expression of SBT3⌬PP in N. benthamiana with or without co-expression of PPs in trans. Six ␮g of protein from total leaf extracts (top) or 1.5 ␮g of apoplastic proteins (bottom) harvested 4 days after infiltration were separated by 12% SDS-PAGE and transferred to a nitrocellulose membrane. Blots were developed as in Fig. 6. The position of SBT3 (black arrow) and marker proteins are indicated.

Addressing the question of whether the internal cleavage of the PP is also autocatalytic in plant SBTs, we assessed the stability of the PP in the purified SBT3-SBT3PP complex by SDSPAGE (Fig. 9). The complex was found to be stable at neutral pH. However, upon incubation at acidic pH, PP cleavage was observed, first at pH 5.7 and to a stronger extent at pH 5.2 (Fig. 9A). pH-dependent cleavage and degradation of the propeptide was also reported for some mammalian PCs and has been well studied in furin, where it provides a mechanism for compartment-specific activation of the protease (26, 29). Similarly in SBT3, pH dependence of PP cleavage may prevent precocious activation and ensure that the active enzyme is not released before the pH drops along the secretory pathway from pH 6.3 in trans-Golgi cisternae to pH 5.6 in the trans-Golgi network/ early endosome (45). A time-course of PP cleavage indicated that auto-processing at pH 5.2 is very slow. Significant degradation was observed only after overnight incubation (Fig. 9B). Similar findings were JOURNAL OF BIOLOGICAL CHEMISTRY

19455

Function of Propeptides in Plant Subtilases

pH

6. pH 2 5. pH 7 5. 2

A

B (kDa) 75 63 48 35

(kDa) 75 63 48 35

28

28

0

5

15

30

60 120 o/n

17

*

17

10 10

*

C % difference

30

15

0

P4

P3

P2

P1

P1’

P2’

P3’

P4’

P4

P3

P2

P1

P1’

P2’

P3’

P4’

% difference

30

15

0

FIGURE 9. pH-dependent cleavage of SBT3PP and substrate selectivity of SBT3. Five ␮g of the purified SBT3-SBT3PP complex were incubated for different time periods and at different pH, separated by 15% SDS-PAGE, and stained with InstantBlue. The positions of SBT3 (arrow), SBT3PP (asterisk), SBT3PP degradation products (diamonds), and marker proteins (kDa) are indicated. A, incubation of SBT3-SBT3PP for 16 h at 4 °C at the indicated pH. B, incubation of SBT3-SBT3PP at pH 5.2 for the indicated time periods (in min at room temperature, or overnight at 4 °C). C, PICS analysis of SBT3 cleavage site specificity. The upper panel shows the result obtained for the trypsin library which is based on the identification of 243 unique cleaved peptides. The result for the chymotrypsin library (149 unique peptides) is shown below. Amino acids enriched at least 2-fold over natural abundance are shown for 4 positions on either side of the cleavage site (P4 to P4⬘). Amino acid distribution is expressed as percent difference (p ⫽ 0.005) to the natural abundance after normalization against the Swiss-Prot protein database for Arabidopsis thaliana. P, N, and T in positions P2, P1, and P3⬘ matching the cleavage site at Asn-38 are shown in white letters for the trypsin (top) and chymotrypsin (bottom) libraries, respectively. Residues I, D, S, and K in positions P2, P1, P1⬘, and P3⬘ match the Asp52 cleavage site in SBT3PP and are depicted in black letters.

reported for bacterial and mammalian SBTs, where cleavage and degradation of the prodomain is slow and the rate-limiting step of enzyme maturation (26, 46). In subtilisin, PP degradation occurs in trans and requires the energetically unfavorable dissociation of the PP from the stable subtilisin-propeptide complex. Once a free protease molecule is released, it can act on other complexes and facilitate PP degradation in a bimolecular reaction (47). The slow activation of SBT3 (Fig. 9B) is consistent with this mechanism and also with the exceptional stability of the SBT3PP-SBT3 complex (Figs. 3B and 4B). To identify the internal propeptide processing site, the two cleavage products (the bands marked in Fig. 9) were subjected to Edman degradation for N-terminal sequencing. The sequence for the larger cleavage product matched best to the loop region between strand ␤1 and helix ␣1, indicating cleavage between Asn-38 and Val-39 (Fig. 1). This region corresponds to the site of PP processing in Bacillus sp. subtilases (37, 48). Addi-

19456 JOURNAL OF BIOLOGICAL CHEMISTRY

tional cleavage between Asp-54 and Ser-55 resulted in the generation of the smaller degradation product. As expected for an autocatalytic processing event, the amino acid sequence at these two sites agrees well with the substrate specificity of SBT3 that was determined by PICS (proteomic identification of cleavage sites; Ref. 49 and Fig. 9C). Pro-Asn immediately upstream of the first site as well as Ile-Asp and Ser-Xaa-Lys flanking the second are among the residues that are preferred by SBT3 in these positions, and they thus contribute to processing site recognition by the protease (Fig. 9C).

Discussion We could show that the SBT3 propeptide acts as an intramolecular chaperone (IMC) that is required for folding of the protease in the plant secretory pathway and a prerequisite for secretion of mature SBT3 into the extracellular space. During protease maturation, the first autocatalytic cleavage of the PP results in the formation of a stoichiometric, autoinhibited complex of SBT3 and its PP. In this complex the PP acts as a strong inhibitor that renders SBT3 inactive until a second, pH-dependent cleavage event leads to the dissociation of the PP from the active site and results in the release of the active subtilase. SBT3 shares these propeptide functions with prokaryotic and eukaryotic subtilases and combines features that were hitherto considered to be characteristic for either bacterial or for mammalian PPs. The ability of SBT3PP to acquire secondary structure independently of the catalytic domain is reminiscent of mammalian PPs (35, 37). Bacterial PPs, on the other hand, are generally disordered and depend on the interaction with the catalytic domain for the acquisition of secondary structure (38, 47, 50). There are exceptions, however, like the PP of the thermostable subtilisin homologue Aqualysin I from Thermus aquaticus, which develops significant secondary structure in absence of its catalytic domain (41). With respect to primary structure, on the other hand, the PP of SBT3 is more similar to PPs of bacterial subtilisins. A large loop, which is located between strand ␤3 and helix ␣2 of the N2 motive in mammalian PPs, is not found in plants and bacteria. This is the region where secondary cleavage occurs in mammalian PPs, by which the subtilase is released from autoinhibition (29, 35, 48). In SBT3, on the other hand, the first of the two internal PP cleavage sites (Asn-38/Val-39) is located within the first ␤-␣-␤ motive in a loop between strand ␤1 and helix ␣1. Conservation of this loop and the secondary cleavage site among bacterial and plant subtilases indicates similarities with respect to the mechanism of PP degradation and protease activation (35, 48). Similarities with bacterial PPs extend to the mode of interaction between the PP and the catalytic domain, which was shown to differ for the immature and mature states of the protease, respectively. As an IMC, the PP of subtilisin interacts “top-on” and mediates folding of the intermediate, whereas it binds “side-on” when it acts as an inhibitor of the mature enzyme (21). Consequently, the IMC and inhibitor functions of bacterial PPs are not necessarily linked. The PP of Aqualysin I, for example, is a 10-fold more potent inhibitor of subtilisin E than its own PP but shows only half the chaperoning activity (41). Vice versa, the PP may also be a weak inhibitor while retaining high IMC VOLUME 291 • NUMBER 37 • SEPTEMBER 9, 2016

Function of Propeptides in Plant Subtilases TABLE 1 Oligonucleotide primers used in this study Seqences are given in the 5⬘ to 3⬘ orientation; F (forward) and R (reverse) refer to the direction of priming. Two cytosines were added at the 5⬘ end for increased efficiency of restriction. Restriction sites are underlined, and the used restriction enzyme is indicated in the primer name. All oligonucleotides were obtained from Eurofins Genomics GmbH (Ebersberg, Germany). Propeptides amplified for recombinant expression in E. coli lacked the N-terminal signal peptide (⌬SP) and included a tag of six histidine residues (His). Deletions (⌬) and insertions (&) are indicated in the primer name and the name of the product as the range of amino acids given in one letter code with the position counted from the first Met. Primer sequence

Name

Product

ccGGTACCATGGAGTTACTTCATCTTCTGC ccCATATGCACCACCACCACCACCACCAAAGATCCACTTACATTGTC ccGGATCCTCAATGAGGTTCCACAGTTCTATC ccGGTACCATGGAACTCAAATTCCAATTCTATTTT ccCATATGCACCACCACCACCACCACCAAAATTTTCGAACTTATATAGTACAATTACAT ccGGATCCTCATTGAACCTCAAGCTTCCTCTC ccGGTACCATGAAAATATTTTTTGTTATTTTTGCTATACTTG ccCATATGCACCACCACCACCACCACAGCGATTTGGAGACGTAC ccGGATCCTCAATGCAAAGACAATATCCTCTGAG ccGGTACCATGGCTTCGCTTCTTCTTCTGACA ccCATATGCACCACCACCACCACCACGAACTGGAAGCTAAAACTTACATATTC ccGGATCCTCAATGAAGTTGCCTCCGACGATC ccGGTACCATGGGGTTTCCTTATTCTCTTC ccCATATGCACCACCACCACCACCACCAAAGATCCACTTATATTGTCCATTTG ccGGTACCTCAGTCAGGTTCCACAGTTCTATC ccGGTACCATGGGGATGACCGTCGTAATT ccCATATGCACCACCACCACCACCACGAGACCTCTCCTTACATCATC ccGGATCCTCAATGAAGCTTAACCGGTAAATCTT ccATGGAGTTACTTCATCTTCTGCTCTTTTCATGGGCACTTTCTGCT TGGGCACTTTCTGCTCATCTCTTTTTAGCTTTAGCAACTACTCACACATC CGTAACACGAAGGTAATGACGA AGTAAACAAGAGCTTTGATGGAATCAATAGTGGAAGAA CATCAAAGCTCTTGTTTACTCCTATGACAATGTGTTACAT TGAAATCTGTCTACTGATGAAGGAACAGAGTTCACCGGTTCAGTGAACTC ACAGATTTCACTCTGCTCCAAAAATCCTCCATGTTTATGACAATGTTTTT

3-Kpn-ATG-F 3P-Nde-HIS-F 3-Bam-R 1.1-Kpn-F 1.1-Nde-HIS-F 1.1-Bam-R 1.2-Kpn-ATG-F 1.2-Nde-HIS-F 1.2-Bam-R 1.3-Kpn-ATG-F 1.3-Nde-HIS-F 1.3-Bam-R 1.4-Kpn-ATG-F 1.4-Nde-HIS-F 1.4-Bam-R 1.9.-Kpn-ATG-F 1.9.-Nde-HIS-F 1.9.-Bam-R 3⌬PD-ATG-F 3⌬PD-31-F 3⌬PD-672-R 3⌬S57-K70-R 3⌬S57-K70-F 1.3&S57-K70-R 1.3&S57-K70-F

SBT3PP SBT3PP-HIS ⌬SP SBT3PP SBT1.1PP SBT1.1PP-HIS ⌬SP SBT1.1PP SBT1.2PP SBT1.2PP-HIS ⌬SP SBT1.2PP SBT1.3PP SBT1.3PP-HIS ⌬SP SBT1.3PP SBT1.4PP SBT1.4PP-HIS ⌬SP SBT1.4PP At1.9PP At1.9PP-HIS ⌬SP At1.9PP SBT3⌬PP SBT3⌬PP SBT3⌬PP SBT3⌬S57-K70 SBT3⌬S57-K70 SBT1.3&S57-K70 SBT1.3&S57-K70

activity (51). The inhibitor and IMC functions could also be separated in the PP of SBT3. A complete loss of IMC activity was observed when residues Ser-57 to Lys-70 were deleted from SBT3PP, whereas the activity as an inhibitor of mature SBT3 was only marginally impaired (Fig. 8), indicating that two different binding modes exist also in the interaction of SBT3PP with SBT3. In addition to these shared features, SBT3PP also has unique properties. The PPs from both prokaryotic and eukaryotic organisms have been described as quite promiscuous regarding their specificity toward the catalytic domain. Bacterial subtilisins and mammalian PCs alike are inhibited not only by their own, but also by distantly related PPs (28, 41, 42). Similarly in plants, cucumisin is also inhibited by the PPs of ARA12 from Arabidopsis and RSP1 from rice (30). The interaction of SBT3 with its own PP, on the other hand, is quite specific. Of the five tested PPs, only the most closely related one, SBT1.4PP, sharing 90% sequence identity with SBT3PP, could substitute as IMC and inhibitor of SBT3. SBT3 differs from other SBTs as it is active as a homodimer, in which an autoinhibitory ␤-hairpin is immobilized by the PA domain (15). Bacterial and mammalian SBTs lack the PA domain, and in cucumisin the PA domain is not involved in dimerization but may rather contribute to substrate selectivity (17). These differences will affect the interaction of the PP with the active site of the enzyme and are likely to account for the unique specificity of the SBT3-SBT3PP interaction. Another unique feature of the SBT3-SBT3PP interaction is the exceptional stability of the autoinhibited complex. The transition midpoint for unfolding increases from 76 °C for SBT3 to 87 °C upon binding of its PP, which we assume is due to the stabilization of the domain structure in the complex. In bacterial subtilisin, on the other hand, thermodynamic stability SEPTEMBER 9, 2016 • VOLUME 291 • NUMBER 37

of the complex is reduced as compared with the free protease and only slightly higher than that of the folding intermediate (33, 52). Stabilizing a transition state late in the folding pathway, the PP catalyzes the reaction from the molten globule state to the autoinhibited complex as well as the back reaction (20, 24, 46). To prevent the back reaction, the PP needs to be cleaved, which kinetically locks the SBT in its active and stable conformation (52). Subtilisin maturation thus requires active subtilisin to assist in the maturation of other SBT-PP complexes by cleavage of the PPs in trans (46, 47). In the case of SBT3, increased stability of the complex as compared with both the mature protease and the folding intermediate renders the back reaction less favorable and traps the complex thermodynamically. Enhanced stability of the complex is likely to facilitate passage through the secretory pathway and prevent untimely activation until decreasing pH allows the controlled, pH-dependent cleavage of the PP and activation of SBT3.

Experimental Procedures Cloning of Subtilase Propeptides—SBT PPs were cloned by PCR using gene-specific primers (Table 1) for SBT3PP (Sl01g087850), SBT1.1PP (Sl06g083720), SBT1.2PP (Sl08g007670), SBT1.3PP (Sl01g111400), SBT1.4PP (Sl01g087840), and AtSBT1.9PP (At5g67090). All constructs comprising the signal peptide, the propeptides, and flanking KpnI and BamHI restriction sites were cloned into pART7 (53) under the control of the cauliflower mosaic virus (CaMV) 35S promoter and terminator. The entire expression cassette was transferred into pART27 (53) for transient expression in plants. For expression in E. coli, prodomain constructs lacking the signal peptide were generated by PCR, digested with NdeI and BamHI, cloned with an N-terminal (His)6-tag into Novagen’s pET21a vector (Merck), and transformed into E. coli BL21 RIL (Agilent Technologies; Waldbronn, Germany). JOURNAL OF BIOLOGICAL CHEMISTRY

19457

Function of Propeptides in Plant Subtilases Expression constructs were also generated for a SBT3PP deletion mutant, lacking amino acids Ser-57 to Lys-70 (SBT3PP⌬S-K), and SBT1.3PP with an insertion of the respective region (SBT1.3PP&S-K) using PCR-mediated deletion and insertion mutagenesis as described (54). Briefly, two fragments flanking the deletion/insertion-site were amplified in separate PCRs and then joined in a third PCR using the primers at the very 5⬘ and 3⬘ ends. For each mutant PP, two types of expression constructs were generated, one comprising the N-terminal signal peptide and KpnI/BamHI sites for cloning into pART7/27 and expression in N. benthamiana, the other one comprising a (His)6 tag and NdeI/BamHI sites for cloning into pET21a and expression in E. coli. Expression and Purification of Recombinant Propeptides— E. coli cells were grown in LB medium with appropriate antibiotics at 220 rpm and 37 °C to an A600 of 0.6. Protein expression was induced with 1 mM isopropyl-␤-D-thiogalactopyranoside during 16 h at 30 °C. Cells were harvested by centrifugation (5000 ⫻ g, 4 °C, 20 min) and resuspended in 50 mM sodium phosphate buffer, pH 7.5, supplemented with 300 mM NaCl and 5 mM ␤-mercaptoethanol. Cells were lysed by sonication (SONOPULS HB2070 with MS72 sonic needle, Bandelin Electronics; Berlin, Germany) at 4 °C for 3 min. The insoluble fraction was collected by centrifugation (12,000 ⫻ g, 4 °C, 30 min), and proteins were solubilized in buffer A (50 mM sodium phosphate buffer, pH 7.5, 300 mM NaCl, 20 mM imidazole, 8 M urea) for 16 h at 4 °C on an end-over-end shaker. Cell debris was removed by centrifugation as above, and the cleared supernatant was subjected to affinity chromatography on nickel-nitrilotriacetic acid agarose (Qiagen, Hilden, Germany). The column was washed extensively in buffer A, recombinant proteins were eluted in 1.75 column volumes buffer A containing 400 mM imidazole, and their concentration was adjusted to 0.5 mg/ml. Renaturation of PPs was achieved by dialysis against 50 mM HEPES, pH 7.5, supplemented with 50 mM L-arginine hydrochloride and 50 mM L-glutamic acid. Purification of SBT3 and Activity Assay—SBT3 was purified to apparent homogeneity from a tomato cell suspension culture as previously described (27). SBT3 activity was assayed in a total volume of 200 ␮l containing 20 ␮M aminobenzoylSKRDPPKKQTD(NO2)Y (JPT Peptide Technologies; Berlin, Germany) and 90 nM concentrations of purified SBT3 in 50 mM HEPES, pH 7.5, 50 mM L-arginine hydrochloride and 50 mM L-glutamic acid. Cleavage of the internally quenched substrate peptide was monitored over 15 min in a Cary Eclipse spectrofluorimeter (␭ex, 320 nm; ␭em, 420 nm; Agilent). To assay the inhibitory activity of propeptides, SBT3 was preincubated with the propeptide for 10 min at 4 °C before the reaction was started by the addition of the substrate. Propeptide Binding Assays—The interaction of SBT3 with PPs was analyzed by microscale thermophoresis. To this end purified SBT3 (20 ␮M) was labeled using the RED-NHS labeling kit (NanoTemper Technologies; Munich, Germany) at a 2-fold molar excess of the dye according to the manufacturer’s instructions. The labeled protein was separated from the unreacted dye, and the buffer was exchanged with 50 mM HEPES, pH 7.5, using the size-exclusion columns provided with the kit. Labeling efficiency (dye:protein ratio) was 0.8, as calculated

19458 JOURNAL OF BIOLOGICAL CHEMISTRY

from a standard curve ranging from 1.5 to 200 nM concentrations of the free dye. Labeled SBT3 was adjusted to 60 nM in 50 mM HEPES, pH 7.5, supplemented with 0.05% (v/v) Tween 20 and titrated with serial (1:1) dilution of the PPs in 50 mM HEPES, pH 7.5, 50 mM Arg, 50 mM Glu, 0.05% (v/v) Tween 20. Equal volumes of labeled SBT3 and the titrant were mixed, incubated on ice for 10 min, and loaded into Monolith NT Premium Coated Capillaries (NanoTemper Technologies). Microscale thermophoresis was performed in a Monolith NT.115 instrument (NanoTemper Technologies) at 23 °C with 5s/30s/5s laser off/on/off times, 25% LED and 60% microscale thermophoresis power. Fraction bound was calculated from the thermophoresis with T-Jump signal (NT.Analysis software; NanoTemper Technologies) and binding constants were derived from three experiments with independent preparations of the PPs. Binding constants were calculated in GraphPad Prism 6 (GraphPad Software, San Diego, CA) using the following equation (55). Fraction Bound ⫽

1 0 共c ⫹ cA0 ⫹ Kd 2 cA0 T ⫺

冑共cT0 ⫹ cA0 ⫹ Kd兲2 ⫺ 4 cT0 cA0兲

0 where Kd is the dissociation constant, cA is the concentration of labeled SBT3, and cT0 is the concentration of PP. Circular Dichroism (CD) Spectroscopy—SBT3 was denatured by dialysis against 50 mM HEPES, pH 7.5, containing 8 M guanidine hydrochloride or by TCA precipitation. For renaturation, the protein was dialyzed first against 50 mM HEPES pH 7.5, 50 mM Arg, 50 mM Lys, and subsequently against 20 mM sodium phosphate buffer, pH 7.5, in which the CD spectra were acquired. Spectra of 1.25 ␮M SBT3 or 15 ␮M SBT3PP were recorded in a 715 CD spectropolarimeter (Jasco; Hachioji, Japan) at 20 °C in the far UV (190 to 260 nm) with wavelength steps of 0.1 nm and a scan speed of 50 nm/min. The signal was averaged over four scans, and the buffer signal was subtracted. Fluorescence Spectroscopy—Fluorescence spectroscopy was performed at 20 °C in a Horiba Fl-3 Fluorimeter (Jobin-Yvon; Kyoto, Japan). For tryptophan solvent accessibility tests, fluorescence of 1.25 ␮M SBT3 was recorded in 20 mM sodium phosphate buffer, pH 7.4, with excitation at 295 nm (slit 5 mm) and emission from 305 to 450 nm (slit 5 nm). For chemical transition experiments, GuHCl was titrated by stepwise addition to 1.25 ␮M SBT3 in 20 mM sodium phosphate buffer, pH 7.4, with an equilibration period of 3 min after each titration step using the same parameters for fluorescence spectroscopy. The background corrected fluorescence maxima from three independent experiments were plotted against the GuHCl concentration. Data were fitted to the Boltzmann equation using OriginPro 9.0 (OriginLabs; Northampton, MA). Thermal Stability of SBT, SBT3PP, and the SBT3-SBT3PP Complex—Thermal stability of SBT3PP (20 ␮M) in 50 mM HEPES, pH 7.5, 50 mM Arg, and 50 mM Glu was analyzed in a Prometheus NT.48 instrument using the capillaries (10-␮l sample volume) provided by the manufacturer (NanoTemper Technologies). Tryptophan fluorescence was measured at 350 and 330 nm, and the 350/330-nm ratio was plotted against the

VOLUME 291 • NUMBER 37 • SEPTEMBER 9, 2016

Function of Propeptides in Plant Subtilases temperature. Thermal denaturation was measured from 25 to 90 °C in the unfolding phase and from 90 to 25 °C for the refolding phase. Thermal unfolding of SBT3 and the SBT3-SBT3PP complex was recorded in a 715 CD-spectropolarimeter (Jasco) at 220 nm in a thermal gradient with a step size of 0.1 °C and a slope of 1 °C per minute. The data were fitted using the Boltzmann equation to obtain the transition point (OriginPro 9.0, OriginLabs). Identification of the Internal Propeptide Cleavage Site—Purified SBT3 was incubated with a 10-fold molar excess of its PP for 10 min at 4 °C. The SBT3-SBT3PP complex was then separated from excess PP by size exclusion chromatography (Super¨ KTA purifier 900 chromatography dex 200 HR 10/30) on an A system (GE Healthcare). Fractions containing the complex were concentrated by ultrafiltration (Vivaspin, 10 kDa cutoff; Sartorius Stedim; Go¨ttingen, Germany). For propeptide cleavage, ⬃15 ␮g of the SBT3-SBT3PP complex were incubated at 4 °C overnight in a three-component buffer system at pH 5.2 (56), separated by Tricine-SDS-PAGE (57), and blotted to a PVDF membrane (Trans-Blot Semi-Dry System; Bio-Rad). Proteins were visualized using 0.1% (w/v) Coomassie Brilliant Blue R250 in 40% ethanol and 10% acetic acid. Excised protein bands were subjected to N-terminal sequencing by Edman degradation on a Shimadzu PPSQ-33 sequencer (Creative Proteomics; Shirley, NY). Transient Protein Expression in N. benthamiana—The pART27 constructs for transient expression of PPs were described above. Constructs for the expression of wild-type SBT3 and the S538A active-site mutant were described previously (27). An additional construct for a SBT3 mutant lacking the entire prodomain (⌬Q23H112) was generated by PCR using two overlapping 5⬘ primers (Table 1) that comprised the open reading frame (ORF) for the signal peptide and 14 bp matching the 5⬘ end of the catalytic domain. The 3⬘ primer was located just downstream of an internal EcoRI site within the ORF of the catalytic domain. The PCR product was then used to replace the 5⬘ end of wild-type SBT3 to generate SBT3⌬PP. Proteins were transiently expressed in N. benthamiana by co-infiltration of two Agrobacterium tumefaciens strains, one carrying the pART27 expression vector, the other carrying the p19 suppressor of silencing essentially as described (58). The bacterial suspension was infiltrated into the abaxial side of leaves from 6-week-old N. benthamiana plants. Leaves were harvested for protein extraction 4 days after inoculation. Protein Extraction from N. benthamiana Leaves—For total protein extraction, leaf samples were ground in liquid nitrogen to a fine powder and thawed in 50 mM Tris/HCl, pH 7.5, 100 mM NaCl, 10 mM ␤-mercaptoethanol containing 0.5% (v/v) Triton X-100, and a blend of proteinase inhibitors (SERVA Electrophoresis GmbH; Heidelberg, Germany). The extract was cleared by centrifugation (16,000 ⫻ g, 4 °C, 10 min) and kept at 4 °C until further analysis on the same day. The protocol for extraction of apoplastic wash fluids was modified from Rathmell and Sequeira (59). Freshly harvested leaves were rinsed 3 times in ice-cold water and vacuum-infiltrated with 50 mM sodium phosphate buffer, pH 7.0, 300 mM NaCl at 75 mbar. Apoplastic washes were recovered by centrifugation at 1500 ⫻ g at 4 °C for 7 min and used the same day for further analysis. SEPTEMBER 9, 2016 • VOLUME 291 • NUMBER 37

Analysis of SBT3 Substrate Specificity—SBT3 cleavage specificity was analyzed by PICS (49). For this assay total protein extracts from Arabidopsis seedlings were digested with proteomics-grade trypsin or chymotrypsin to generate libraries of several thousand peptides. These peptides were chemically modified to protect free sulfhydryl and amino groups and used as substrate for SBT3. Newly generated N termini were biotinylated, the peptides were isolated on streptavidin beads, and their sequence was determined by mass spectrometry (MS). This identifies the sequences on the carboxyl side (i.e. the prime side according to Schechter and Berger (60)) of all the bonds that were cleaved. With their sequence known, the sequences on the amino side (the non-prime side; Ref. 60) can be deduced and the cleavage sites reconstructed (49). Libraries of tryptic and chymotryptic peptides were generated from protein extracts of 4-week-old Arabidopsis seedlings as described by Marino et al. (61) with minor modifications. 200 ␮g of the peptide libraries were digested with 2 ␮g of SBT3 for 16 h at pH 7.0 at 37 °C. N-terminally biotinylated peptides were purified over streptavidin-Sepharose (GE Healthcare) and analyzed via LC-MS/MS. A 75-␮m analytical C18 column on an EASY-nLC HPLC system (Thermo Scientific) was used for separation with a linear acetonitrile gradient (4 – 64% in 135 min), and a Q-Exactive hybrid Orbitrap (Thermo Scientific) was used for mass analysis. MS/MS data were analyzed with MaxQuant (62). A web-based bioinformatics tool (WebPICS; Ref. 63) was used for reconstruction of cleavage sites. Author Contributions—A. S. conceived and coordinated the study. M. M. and A. S. wrote the paper. M. M. designed, performed, and analyzed the experiments shown in Fig. 2, B and C, Fig. 4, and Figs. 6 –9. M. W. cloned and purified the propeptides (Fig. 2A). S. L. performed and analyzed the experiments shown in Figs. 3, A and B, and 5. All authors reviewed the results and approved the final version of the manuscript. Acknowledgments—We thank Renate Frei and Brigitte Ro¨singh for excellent technical assistance. We also thank Jens Pfannstiel and Iris Klaiber at the University’s Service Unit Mass Spectrometry, Waltraud Schulze (Dept. of Plant Systems Biology; University of Hohenheim) for mass spectral analyses, and Tobias Pflu¨ger from NanoTemper Technologies for help with melting curve analysis using the Prometheus instrument. References 1. Rawlings, N. D., Barrett, A. J., and Bateman, A. (2010) MEROPS: the peptidase database. Nucleic Acids Res. 38, D227–D233 2. Dodson, G., and Wlodawer, A. (1998) Catalytic triads and their relatives. Trends Biochem. Sci. 23, 347–352 3. Siezen, R. J., and Leunissen, J. A. (1997) Subtilases: the superfamily of subtilisin-like serine proteases. Protein Sci 6, 501–523 4. Smith, E. L., Markland, F. S., Kasper, C. B., DeLange, R. J., Landon, M., and Evans, W. H. (1966) The complete amino acid sequence of two types of subtilisin, BPN⬘ and Carlsberg. J. Biol. Chem. 241, 5974 –5976 5. Fuller, R. S., Brake, A. J., and Thorner, J. (1989) Intracellular targeting and structural conservation of a prohormone-processing endoprotease. Science 246, 482– 486 6. Seidah, N. G., Khatib, A. M., and Prat, A. (2006) The proprotein convertases and their implication in sterol and/or lipid metabolism. Biol. Chem. 387, 871– 877

JOURNAL OF BIOLOGICAL CHEMISTRY

19459

Function of Propeptides in Plant Subtilases 7. Schaller, A., Stintzi, A., and Graff, L. (2012) Subtilases: versatile tools for protein turnover, plant development, and interactions with the environment. Physiol. Plant. 145, 52– 66 8. Schaller, A. (2013) Chapter 717; Plant Subtilisins. In Handbook of Proteolytic Enzymes (Rawlings, N. D., and Salvesen, G. eds.), 3 Ed., pp 3247–3254, Academic Press, Inc., Orlando, FL 9. Wong, S. L., and Doi, R. H. (1986) Determination of the signal peptidase cleavage site in the preprosubtilisin of Bacillus subtilis. J. Biol. Chem. 261, 10176 –10181 10. Ikemura, H., Takagi, H., and Inouye, M. (1987) Requirement of pro-sequence for the production of active subtilisin E in Escherichia coli. J. Biol. Chem. 262, 7859 –7864 11. Silen, J. L., and Agard, D. A. (1989) The ␣-lytic protease pro-region does not require a physical linkage to activate the protease domain in vivo. Nature 341, 462– 464 12. van den Hazel, H. B., Kielland-Brandt, M. C., and Winther, J. R. (1993) The propeptide is required for in vivo formation of stable active yeast proteinase A and can function even when not covalently linked to the mature region. J. Biol. Chem. 268, 18002–18007 13. Smith, S. M., and Gottesman, M. M. (1989) Activity and deletion analysis of recombinant human cathepsin L expressed in Escherichia coli. J. Biol. Chem. 264, 20487–20495 14. Shinde, U., and Inouye, M. (1994) The structural and functional organization of intramolecular chaperones: the N-terminal propeptides which mediate protein folding. J. Biochem. 115, 629 – 636 15. Ottmann, C., Rose, R., Huttenlocher, F., Cedzich, A., Hauske, P., Kaiser, M., Huber, R., and Schaller, A. (2009) Structural basis for Ca2⫹ independence and activation by homodimerization of tomato subtilase 3. Proc. Natl. Acad. Sci. U.S.A. 106, 17223–17228 16. Rose, R., Schaller, A., and Ottmann, C. (2010) Structural features of plant subtilases. Plant Signal Behav. 5, 180 –183 17. Murayama, K., Kato-Murayama, M., Hosaka, T., Sotokawauchi, A., Yokoyama, S., Arima, K., and Shirouzu, M. (2012) Crystal structure of cucumisin, a subtilisin-like endoprotease from Cucumis melo L. J. Mol. Biol. 423, 386 –396 18. Alexander, P. A., Ruan, B., and Bryan, P. N. (2001) Cation-dependent stability of subtilisin. Biochemistry 40, 10634 –10639 19. Zhu, X. L., Ohta, Y., Jordan, F., and Inouye, M. (1989) Pro-sequence of subtilisin can guide the refolding of denatured subtilisin in an intermolecular process. Nature 339, 483– 484 20. Baker, D., Sohl, J. L., and Agard, D. A. (1992) A protein-folding reaction under kinetic control. Nature 356, 263–265 21. Shinde, U., and Thomas, G. (2011) Insights from bacterial subtilases into the mechanisms of intramolecular chaperone-mediated activation of furin. (Mbikay, M., and Seidah, N. G., eds) Methods Mol. Biol. 768, 59 –106 22. Bryan, P. N. (2002) Prodomains and protein folding catalysis. Chem. Rev. 102, 4805– 4816 23. Eder, J., Rheinnecker, M., and Fersht, A. R. (1993) Folding of subtilisin BPN⬘: role of the pro-sequence. J. Mol. Biol. 233, 293–304 24. Eder, J., Rheinnecker, M., and Fersht, A. R. (1993) Folding of subtilisin BPN⬘: characterization of a folding intermediate. Biochemistry 32, 18 –26 25. Li, Y., and Inouye, M. (1994) Autoprocessing of prothiolsubtilisin E in which active-site serine 221 is altered to cysteine. J. Biol. Chem. 269, 4169 – 4174 26. Anderson, E. D., Molloy, S. S., Jean, F., Fei, H., Shimamura, S., and Thomas, G. (2002) The ordered and compartment-specific autoproteolytic removal of the furin intramolecular chaperone is required for enzyme activation. J. Biol. Chem. 277, 12879 –12890 27. Cedzich, A., Huttenlocher, F., Kuhn, B. M., Pfannstiel, J., Gabler, L., Stintzi, A., and Schaller, A. (2009) The protease-associated (PA) domain and C-terminal extension are required for zymogen processing, sorting within the secretory pathway, and activity of tomato subtilase 3 (SlSBT3). J. Biol. Chem. 284, 14068 –14078 28. Huang, H.-W., Chen, W.-C., Wu, C.-Y., Yu, H.-C., Lin, W.-Y., Chen, S.-T., and Wang, K.-T. (1997) Kinetic studies of the inhibitory effects of propeptides subtilisin BPN⬘ and Carlsberg to bacterial serine proteases. Protein Eng. 10, 1227–1233 29. Anderson, E. D., VanSlyke, J. K., Thulin, C. D., Jean, F., and Thomas, G.

19460 JOURNAL OF BIOLOGICAL CHEMISTRY

30.

31.

32.

33.

34.

35.

36.

37.

38.

39. 40.

41.

42.

43.

44.

45.

46.

47.

48.

(1997) Activation of the furin endoprotease is a multiple-step process: requirements for acidification and internal propeptide cleavage. EMBO J. 16, 1508 –1518 Nakagawa, M., Ueyama, M., Tsuruta, H., Uno, T., Kanamaru, K., Mikami, B., and Yamagata, H. (2010) Functional analysis of the cucumisin propeptide as a potent inhibitor of its mature enzyme. J. Biol. Chem. 285, 29797–29807 Pei, J., Kim, B.-H., and Grishin, N. V. (2008) PROMALS3D: a tool for multiple protein sequence and structure alignments. Nucleic Acids Res. 36, 2295–2300 Yabuta, Y., Subbian, E., Oiry, C., and Shinde, U. (2003) Folding pathway mediated by an intramolecular chaperone: a functional peptide chaperone designed using sequence databases. J. Biol. Chem. 278, 15246 –15251 Shinde, U., Fu, X., and Inouye, M. (1999) A pathway for conformational diversity in proteins mediated by intramolecular chaperones. J. Biol. Chem. 274, 15615–15621 Gallagher, T., Gilliland, G., Wang, L., and Bryan, P. (1995) The prosegment-subtilisin BPN⬘ complex: crystal structure of a specific “foldase.” Structure 3, 907–914 Tangrea, M. A., Bryan, P. N., Sari, N., and Orban, J. (2002) Solution structure of the pro-hormone convertase 1 pro-domain from Mus musculus. J. Mol. Biol. 320, 801– 812 Shukla, D., and Trout, B. L. (2011) Understanding the synergistic effect of arginine and glutamic acid mixtures on protein solubility. J. Phys. Chem. B 115, 11831–11839 Tangrea, M. A., Alexander, P., Bryan, P. N., Eisenstein, E., Toedt, J., and Orban, J. (2001) Stability and global fold of the mouse prohormone convertase 1 pro-domain. Biochemistry 40, 5488 –5495 Strausberg, S., Alexander, P., Wang, L., Schwarz, F., and Bryan, P. (1993) Catalysis of a protein folding reaction: thermodynamic and kinetic analysis of subtilisin BPN⬘ interactions with its propeptide fragment. Biochemistry 32, 8112– 8119 Eder, J., and Fersht, A. R. (1995) Pro-sequence-assisted protein folding. Mol. Microbiol. 16, 609 – 614 Brodsky, J. L., and Skach, W. R. (2011) Protein folding and quality control in the endoplasmic reticulum: recent lessons from yeast and mammalian cell systems. Curr. Opin. Cell Biol. 23, 464 – 475 Marie-Claire, C., Yabuta, Y., Suefuji, K., Matsuzawa, H., and Shinde, U. (2001) Folding pathway mediated by an intramolecular chaperone: the structural and functional characterization of the aqualysin I propeptide. J. Mol. Biol. 305, 151–165 Fuge`re, M., Limperis, P. C., Beaulieu-Audy, V., Gagnon, F., Lavigne, P., Klarskov, K., Leduc, R., and Day, R. (2002) Inhibitory potency and specificity of subtilase-like pro-protein convertase (SPC) prodomains. J. Biol. Chem. 277, 7648 –7656 Meichtry, J., Amrhein, N., and Schaller, A. (1999) Characterization of the subtilase gene family in tomato (Lycopersicon esculentum Mill.). Plant Mol. Biol. 39, 749 –760 Rautengarten, C., Steinhauser, D., Bu¨ssis, D., Stintzi, A., Schaller, A., Kopka, J., and Altmann, T. (2005) Inferring hypotheses on functional relationships of genes: analysis of the Arabidopsis thaliana subtilase gene family. PLoS Comput. Biol. 1, e40 Luo, Y., Scholl, S., Doering, A., Zhang, Y., Irani, N. G., Di Rubbo, S., Neumetzler, L., Krishnamoorthy, P., Van Houtte, I., Mylle, E., Bischoff, V., Vernhettes, S., Winne, J., Friml, J., Stierhof Y.-D., Schumacher, K., Persson, S., and Russinova, E. (2015) V-ATPase activity in the TGN/EE is required for exocytosis and recycling in Arabidopsis. Nat. Plants 1, 15094 –15103 Yabuta, Y., Takagi, H., Inouye, M., and Shinde, U. (2001) Folding pathway mediated by an intramolecular chaperone: propeptide release modulates activation precision of pro-subtilisin. J. Biol. Chem. 276, 44427– 44434 Subbian, E., Yabuta, Y., and Shinde, U. P. (2005) Folding pathway mediated by an intramolecular chaperone: intrinsically unstructured propeptide modulates stochastic activation of subtilisin. J. Mol. Biol. 347, 367–383 Dillon, S. L., Williamson, D. M., Elferich, J., Radler, D., Joshi, R., Thomas, G., and Shinde, U. (2012) Propeptides are sufficient to regulate organellespecific pH-dependent activation of furin and proprotein convertase 1/3. J. Mol. Biol. 423, 47– 62

VOLUME 291 • NUMBER 37 • SEPTEMBER 9, 2016

Function of Propeptides in Plant Subtilases 49. Schilling, O., and Overall, C. M. (2008) Proteome-derived, databasesearchable peptide libraries for identifying protease cleavage sites. Nat. Biotechnol. 26, 685– 694 50. Buevich, A. V., Shinde, U. P., Inouye, M., and Baum, J. (2001) Backbone dynamics of the natively unfolded pro-peptide of subtilisin by heteronuclear NMR relaxation studies. J. Biomol. NMR 20, 233–249 51. Fu, X., Inouye, M., and Shinde, U. (2000) Folding pathway mediated by an intramolecular chaperone: the inhibitory and chaperone functions of the subtilisin propeptide are not obligatorily linked. J. Biol. Chem. 275, 16871–16878 52. Shinde, U., and Inouye, M. (1995) Folding pathway mediated by an intramolecular chaperone: characterization of the structural changes in pro-subtilisin E coincident with autoprocessing. J. Mol. Biol. 252, 25–30 53. Gleave, A. P. (1992) A versatile binary vector system with a T-DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome. Plant Mol. Biol. 20, 1203–1207 54. Lee, J., Lee, H. J., Shin, M. K., and Ryu, W. S. (2004) Versatile PCR-mediated insertion or deletion mutagenesis. Biotechniques 36, 398 – 400 55. Seidel, S. A., Dijkman, P. M., Lea, W. A., van den Bogaart, G., JerabekWillemsen, M., Lazic, A., Joseph, J. S., Srinivasan, P., Baaske, P., Simeonov, A., Katritch, I., Melo, F. A., Ladbury, J. E., Schreiber, G., Watts, A., Braun, D., and Duhr, S. (2013) Microscale thermophoresis quantifies biomolecular interactions under previously challenging conditions. Methods 59, 301–315

SEPTEMBER 9, 2016 • VOLUME 291 • NUMBER 37

56. Ellis, K. J., and Morrison, J. F. (1982) Buffers of constant ionic strength for studying pH-dependent processes. Methods Enzymol. 87, 405– 426 57. Scha¨gger, H. (2006) Tricine-SDS-PAGE. Nat. Protoc. 1, 16 –22 58. Effenberger, I., Zhang, B., Li, L., Wang, Q., Liu, Y., Klaiber, I., Pfannstiel, J., Wang, Q., and Schaller, A. (2015) Dirigent proteins from cotton (Gossypium sp.) for the atropselective synthesis of gossypol. Angew. Chem. Int. Ed. Engl. 54, 14660 –14663 59. Rathmell, W. G., and Sequeira, L. (1974) Soluble peroxidase in fluid from the intercellular spaces of tobacco leaves. Plant. Physiol. 53, 317–318 60. Schechter, I., and Berger, A. (1967) On the size of the active site in proteases. I. papain. Biochem. Biophys. Res. Commun. 27, 157–162 61. Marino, G., Huesgen, P. F., Eckhard, U., Overall, C. M., Schro¨der, W. P., and Funk, C. (2014) Family-wide characterization of matrix metalloproteinases from Arabidopsis thaliana reveals their distinct proteolytic activity and cleavage site specificity. Biochem. J. 457, 335–346 62. Cox, J., and Mann, M. (2008) MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 26, 1367–1372 63. Schilling, O., auf dem Keller, U., and Overall, C. M. (2011) Factor Xa subsite mapping by proteome-derived peptide libraries improved using WebPICS, a resource for proteomic identification of cleavage sites. Biol. Chem. 392, 1031–1037 64. Petersen, T. N., Brunak, S., von Heijne, G., and Nielsen, H. (2011) SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods 8, 785–786

JOURNAL OF BIOLOGICAL CHEMISTRY

19461