Am. J. Hum. Genet. 51:363-370, 1992

Functional Profile of the Human Fetal y-Globin Gene Upstream Promoter Region Henry J. Lin,* Chun-Ya Han,* and Arthur W. Nienhuist 'Division of Medical Genetics, Department of Pediatrics, Harbor-UCLA Medical Center, Torrance; and TClinical Hematology Branch, National Heart, Lung, and Blood Institute, Bethesda

Summary We performed a systematic functional analysis of the human y-globin promoter to identify its activator domains. We used a panel of truncation and scanning mutants as well as transfection in human K562 fetal erythroid cells. The various mutations produced relatively small changes in promoter function in both transient and stable transfection assays. The CACCC region and the region containing the binding sites for protein GATA-1 behaved as activator domains. We also obtained evidence for a minor activator site in the - 200 to 190 region. The results are consistent with the interpretation that y-globin gene regulation may occur in part through multiple small effects of promoter elements. -

Introduction

The Gy- and A-y-globin genes of the 3-globin gene cluster encode the y chains of fetal hemoglobin, which provides optimum transport of oxygen in utero. Near term, there is a gradual rise in the synthesis of adult P-globin chains and a fall in the production of fetal y chains. The y-to-I switch is normally complete by 16-20 wk of age, when the fetal type usually amounts to only a few percent or less of red cell hemoglobin. The y-globin gene, like other genes, is regulated by specific DNA sequence elements found within promoters (Anagnou et al. 1986), enhancers (Bodine and Ley 1987), and other control regions (Grosveld et al. 1987; Enver et al. 1990). The promoter regions of the A- and y-globin genes contain the TATA box, the CCAAT box, and the CACCC box. Fine mapping of the 13-globin gene promoters (Dierks et al. 1983) has shown that these elements are together required for accurate and efficient transcription of the globin genes, but the role of upstream sequences is less well known. In humans, single-base changes in the Gy or A-y proReceived December 1991; revision received February 3, 1992. Address for correspondence and reprints: Henry J. Lin, M.D., Division of Medical Genetics, Harbor-UCLA Medical Center, Building E-4, 1124 West Carson Street, Torrance, CA 90502. i 1992 by The American Society of Human Genetics. All rights reserved. 0002-9297/92/5102-0016$02.00

moters lead to persistent expression of either the Gy.. or Ay-globin gene during adult life, a condition known as nondeletion hereditary persistence of fetal hemoglobin. Promoter mutations have been found at positions - 202 (Collins et al. 1984; Gilman et al. 1988), - 198 (Tate et al. 1986), - 196 (Giglioni et al. 1984; Gelinas et al. 1986), - 195 (Costa et al. 1990), - 175 (Ottolenghi et al. 1988; Surrey et al. 1988; Stoming et al. 1989), - 161 (Gilman et al. 1987), - 158 (Gilman and Huisman 1985), - 117 (Collins et al. 1985; Gelinas et al. 1985), and -114 (Fucharoen et al. 1990). The mutations are thought to alter binding of regulatory proteins. The - 175 mutation, for example, affects binding of GATA-1, an activator protein (Martin et al. 1989; Tsai et al. 1989) found in erythroid cells. We previously established that sequences from the upstream region of the y promoter have a potential role in developmental stage-specific gene expression. A fragment extending from - 260 to - 137 of the y promoter activated the otherwise silent 3-globin gene promoter in stably transformed human K562 erythroleukemia cells (Lin et al. 1987), a cell line that exhibits an embryonic-fetal phenotype with respect to the pattern of globin gene expression (Rutherford et al. 1979). The work has been confirmed and extended by the observations by Perez-Stable and Costantini (1990) in transgenic mice. 363

364

Lin et al.

The experiments described in the present report aimed to define the sequences in the upstream region that are responsible for activation of the y promoter at the embryonic-fetal stage of development. We used both a combination of transient and stable transfection assays and a series of deletion and internal scanning mutations to detect effects of various sequences on promoter function. Material and Methods y-Globin Promoter Expression Vectors Chloramphenicol acetyltransferase (CAT) expression vectors contained a y promoter fragment joined to a minimal i promoter fragment (fig. 1). The CAT reporter gene in a HindIII-BamHI fragment was joined to the promoter, according to the procedure described by Gorman et al. (1982). A 732-bp HindIII-BglII enhancer fragment from the hypersensitive site 2 region 5' of the 0-globin cluster was attached directly 5' of the promoter (Tuan et al. 1989). Truncation mutations were made by digesting the y promoter with enzyme BAL-3 1, squaring the nibbled end with the large fragment of DNA polymerase I, attaching a linker to the squared end, subcloning the truncated fragment into an intact expression vector, and checking the sequence of the truncated fragment. One truncation mutant ( - 260 to - 190) was made by extending the - 260 to - 200 y promoter fragment with a synthetic oligonucleotide. Scanning mutations were made with synthetic oligonucleotides. Each synthetic fragment had an SphI restriction site at the 5' end and a ClaI site at the 3' end, for cloning into the expression vector, and an XhoI site to aid screening for desired clones. Plasmid clones were sequenced before use. Neomycin-resistance (neoR) expression vectors were made for three scanning mutations. These expression -260 Sm B (Hf)

NY I

vectors were derived from the CAT vectors by replacing the CAT fragment with a fragment containing the bacterial neoR gene (Lin et al. 1987). The erythroid enhancer was removed to simplify the constructions. CAT Expression Vectors The names of the CAT expression vectors for the promoters used in this paper are - 260 to - 137 y / i promoter, plasmid NL-2 and plasmid HL1 65 /clone 2 (lacks the ApaI site in the vector); - 242 to - 137, HL148; - 204 to - 137, HL149; -167 to -137,

HL150; -260 to -219, HL151; -260 to -200, HL152; -260 to -190, WTEX/clone 1; -260 to - 178, HL153; -260 to - 157, HL154; 127-bp I, HL155; UP1, UP1 /clone 2; UP2, UP2/clone 4; UP3, UP3 /clone 2; UP4, UP4/clone 6; UP5, UP5 /clone 6; UP6, UP6/clone 1; UP7, UP7/clone 1; UP8, UP8/ clones 2 and 3; UP9, UP9/clone 1; UP10, UP10/ clone 3; UP11, UP11/clones 1 and 2; UP12.1, UP12.1/clone 2; and UP13, UP13/clone 2. Transfection Assays in Human K562 Erythroleukemia Cells

For CAT assays, cells were grown to a density of 2-4 x 105 cells/ml in RPMI 1640 medium supplemented with 10% FCS (both from GIBCO). Ten micrograms of expression vector DNA and 20 jg of carrier DNA (pUC or pTZ) were added to 3 x 107 cells suspended in 0.3 ml of ice-cold Dulbecco's PBS without calcium or magnesium (D-PBS; GIBCO). The total volume of DNA and cells was approximately 0.36 ml. The mixture was allowed to stand on ice for 10 min and then was pulsed with a field of 200 V at 960 pF (Bio-Rad Gene Pulser). The cells were allowed to stand on ice for an additional 15 min and then quantitatively were transferred to 35 ml of medium for 2 d at 37°C. Cells were pelleted, washed in D-PBS, resuspended in 0.2 ml of 100 mM potassium phosphate buffer (pH 7) with 1 mM DTT, and lysed by three cycles of freezing and thawing. Lysates were collected

-137 -127

Ap

(N)C (R)

Y--InI

+49

CACCAC CAAT

0 00

%-a

%-a

%.a

ATAAA

n

L.J

cap

r-

(N) H

II

I

Figure I Structure of a composite y/13-globin promoter used in one of our expression vectors. Hatched bars indicate y sequences, and solid bars indicate 13 sequences. Conserved elements of the 1 promoter are marked by boxes. The junction sequence between the ClaI and the RsaI sites is 5'-GAG CTT GGC TGC AGG TC-3'. Numbers refer to positions relative to the respective y or 13 cap sites. CAT or neoR gene coding units were joined at the HindIII site as described elsewhere (Gorman et al. 1982; Lin et al. 1987). In the CAT vectors, an erythroid enhancer (Tuan et al. 1989) was joined at the SmaI site in its normal orientation with respect to the promoter. The vectors were constructed in plasmid pUC007, a modified version of pUC9 (Sorrentino et al. 1990). Ap = ApaI; B = BamHI; C = ClaI; H = HindIII; Hf = Hinfl; N = Ncol; R = RsaI; and Sm = SmaI. Parentheses enclose inactivated restriction sites.

The Human y-Globin Promoter by centrifugation (5 min in a microfuge at 40C) and then were heat treated at 650C for 15 min (Tuan et al. 1989). Promoter function was measured by CAT assays (Gorman et al. 1982). Two or more different plasmid preparations were used for each promoter construction. For neoR assays (Rutherford and Nienhuis 1987), DNA was introduced into K562 cells by use of a liposome reagent (Feigner et al. 1987). K562 cells were grown to a density of 5 x 105/ml and were washed twice with D-PBS. For each transfection, 1 x 107 cells were resuspended in 3 ml of serum-free medium in a round-bottom polystyrene tube. Linearized plasmid DNA (5 pg) was mixed with 30 p1 of Lipofectin reagent (Bethesda Research Laboratories) in a total volume of 100 p1 (diluted, as needed, with sterile deionized water), allowed to stand for 15 min at room temperature, and added to the cell suspension. Cells were incubated at 371C for 6-14 h, were transferred to 35 ml of RPMI 1640 medium with 10% FCS, and were incubated for 48 h prior to selection in G418. Viable transfected cells were plated in medium containing 500 pg of active G41 8/ml at a density of 3 x 104/ 1.5 ml in 16-mm tissue-culture wells. G418resistant colonies were counted at 14-15 d after plating. Plates were labeled with a code number, and colony counting was done in a blind fashion, i.e., without knowledge of which expression vector the cells contained. Plates were identified after counting was completed. Four rapidly growing colonies were expanded in medium containing G418 and were used for RNA assays. RNAase Protection Assay

Cytoplasmic RNA was extracted in the presence of vanadyl ribonucleoside complexes. DNA contaminants were removed by digestion with RNAase-free DNAase (RQ1 DNAase; Promega). Total cellular RNA was hybridized to an RNA probe radiolabeled by use of SP6 RNA polymerase (Promega) and was subjected to digestion with RNAases A and T1 (Sambrook et al. 1989). Fragments were electrophoresed on 8% polyacrylamide sequencing gels and were visualized by autoradiography. Results

Experimental Design Truncation mutants and scanning mutants of the human y-globin promoter were first tested in a CAT

365

assay system to look for potential activator regions. An erythroid enhancer was inserted into the expression vectors to boost the CAT signal. The mutations generally had only small effects on promoter function, so putative activator regions were further tested in stable transformants by use of a neoR assay (Rutherford and Nienhuis 1987). The enhancer was omitted from the constructs, to exclude the possibility of associated artifacts. Promoter function was assayed by the frequency of G418-resistant colonies that formed. We attempted to use a luciferase reporter gene to correct for variations in transfection. As we increased the amount of CAT reporter relative to the amount of luciferase reporter, however, luciferase activity fell, reflecting competition between expression vectors for transcription factors. We therefore discontinued use of the internal control and, instead, based our CAT assay results on averages of multiple measurements and t-tests (Croxton et al. 1967; Barford 1985). The data shown below represent approximately 200 transfections. Quantitation of promoter function by CAT activities was made only when conversion of substrate to product was 10%-80%. The normalized CAT activities were fairly reproducible, as shown by the standard error (SE) bars in figures 2 and 3. The results of 16 transfections were not included, because the scatter of CAT activity for the promoter used as the 100% reference was too large. The result of another transfection was discarded by an application of Chauvenet's criterion (Young 1962). We switched to a liposome reagent (Felgner et al. 1987) for transfection in the stable transformation experiments. In duplicate transfections of a placental alkaline phosphatase reporter gene (Henthorn et al. 1988) into K562 cells or fibroblasts, reporter gene activity deviated from the mean by 4%-26%, indicating reproducibility of transfection by this method. Cotransfection controls were therefore not used, again to avoid the potential problem of competition between expression vectors for transcription factors. CAT Assays with Truncation Mutations

CAT activities for the truncation mutants are expressed relative to CAT activities for the - 260 to - 137 y/, promoter (fig. 2). The ypromoter fragment retained full activity when its 5' end was trimmed from - 260 to - 204. Further truncation to - 167 reduced promoter strength to 30%-40%. When our starting 'y fragment was instead trimmed from the 3' end to - 21 9, the fragment had approximately 5% of its original activity, a level lower than that of the 127-bp

366

Lin et al.

-260

-137

.001), and mutations UP12.1 and UP13 (- 197 to - 192; fig. 3) lowered promoter strength to 40%50% of wild type (P < .001 and < .05, respectively). Mutations UP1-UP7 and mutation UP9, in contrast, each raised promoter strength by one-and-a-half to twofold. The gain in promoter strength over wild-type was statistically significant for all mutants (P < .01 or better) except UPS (P < .10).

-137

-242

-137

-204

-167 -137 -260

1

-219

-260

OD

-200

-260

Stable Transfection Assays with Mutants UP8, UP/12. 1, and UP13

-190

-260

-178

-260

-157

....-I II

.... I a

127 bp minimal

B

promoter

0

0.5

1.0

RELATIVE CAT ACTIVITY

Figure 2

Truncated y promoter fragments in composite

y/ 3-globin promoters (left), and CAT activities from these promoters (right). Hatched bars represent the y sequences joined to the 127-bp minimal 13 promoter (blackened bars). The bar graph shows CAT activities relative to that for the - 260 to - 137 y/1 promoter. Error bars indicate 1 SE. The number of transfections for each y/I promoter were (from top to bottom) as follows: - 260 to - 137, 15 transfections; - 242 to - 137, 14; - 204 to - 137, 9; - 167 to - 137,5; - 260 to - 219,8; - 260 to - 200, 12; - 260 to - 190, 5; - 260 to - 178, 4; -260 to - 157, 6; and 127-bp 1, 8.

The effects that these three mutations had on promoter function were checked in the neoR assay. Mutations UP12.1 and UP13 lowered promoter function by up to 50%, compared with that seen with a wild-type promoter. The strength of the - 260 to - 200 promoter was 50% less than that of the - 260 to - 190 promoter, consistent with the scanning mutant results. Mutation UP8, however, did not lower promoter function compared with that of wild type (table 1). mRNA Initiation Sites

RNAase protection assays for a pool of four G418resistant colonies expanded from the above neoR assays showed the major mRNA to be approximately 380 nucleotides (nt) in length, corresponding to correct initiation of the neoR gene from the y/0i-globin promoter (fig. 4). Discussion

minimal i promoter alone (P < .05). Promoter strength increased as the 3' end was extended from 219 to 200, - 190, and 178 but fell with further extension to - 157. The results were consistent with the interpretation that possible activator se190 and between quences lie between -219 and -167 and -137. -

-

-

-

CAT Assays with Scanning Mutations

We scanned the promoter region between 260 and 190 with 13 mutants (fig. 3), in order to more closely examine the 219 to 190 region. This re-

-

-

gion

is of

-

particular interest because it contains four

HPFH (hereditary persistence of fetal hemoglobin) mutations. Three of the scanning mutations reduced promoter function in CAT assays. Mutation UP8, a six-base substitution from 218 to 213, lowered promoter strength to approximately 60% of wild-type (P < -

-

The aim of our work was to conduct a thorough functional survey of the y-globin upstream promoter region to define the activator domains operating in fetal erythroid cells. A 30-bp fragment of the 'y-globin promoter, a fragment that contained the CACCC box, increased expression from the minimal P-globin promoter in our assays ( - 167 to - 137 y/ 3 promoter; fig. 2). The result is consistent with previous demonstrations of the importance of the CACCC region to y-gene expression (Catala et al. 1989; Ulrich and Ley 1990). For example, Catala et al. stably introduced a "minilocus" containing a marked y gene into K562 cells. Deletion of promoter sequences to - 160 reduced function twofold with respect to a 410-bp promoter, and further deletion to remove the CACCC box resulted in a fourfold drop. Within the 'y-promoter fragment from - 260 to - 190, scanning mutations between - 197 and - 192 reduced function of the composite y/I promoter in fetal erythroid cells by up to 50O. The effects were

The Human y-Globin Promoter

367

A 3 cw)

!R0, paO > a: -cr

C.)

0L

cmJ

C'

a. o.. s..

. a. CN SCANNING MUTANTDD ED

a.e

a0 .

0

0

_-

D

D

co

VI

'-

a .-a

D

D

0.

C

X

SCANNING MUTANT

B wr UP1 UP2 UP3 UP4 UP5 UP6

UPA

UP9 uPlO

GAATCGGAACAAGGCAAAGGCTATAAAAAAAATTAAGCAGCAGTATCCTCTTGGGGGCCCC TCCGAT ------------------------------------------------------------TCTTCT------------------------------------------------------------TTACCC--------------------------------------------------------------------------------------------TTAGCG ------------------------ TATTAT -------------------------------------------------------------TTAATT-------------------------

-------------------------------------CACCAC------------------------------------------------------------TGCGAA------------------------------------------------------------GAGGTT----------------------------------------------------------CCCGGG-

WT GAATCGGAACAAGGCAAAGGCTATAAAAAAAATTAAGCAGCAGTATCCTCTTGGGGGCCCCTTCCCCACAC -----------------------AGG --UP1 -----------------------------------UP12.1-- -------------------------------AAA.--

UP33

--------------

-20D

-250

-------------------------------------------------ACA--

-240

-230

-1

210

-20D

-190

Scanning mutation analysis of the y-globin upstream promoter region. A, CAT activities of the yI/1 promoters with scanning Figure 3 mutations. CAT activities were normalized to that obtained with a wild-type promoter of the same length (see below). Error bars indicate 1 SE. Dotted lines indicate 1 SE above and below the CAT activity (normalized to 1.0) for the wild-type reference promoter. The number of transfections for each mutant were as follows: UP1, 8 transfections; UP2, 8; UP3, 8; UP4, 10; UPS, 13; UP6, 7; UP7, 8; UP8, 10; UP9, 8; UP10, 10; UP11, 4; UP12.1, 4; UP13, 4; -260 to -200 wild-type, 13; and -260 to -190 wild-type, 4. B, Sequences of the scanning mutants. Each mutation was a substitution of three or six consecutive bases within the wild-type sequence. Mutations UPl-UP10 were in y fragments extending from - 260 to - 200. Mutations UP1 1 - UP13 were in y fragments extending from - 260 to - 190. Each y fragment was joined to the 127-bp minimal 13 promoter to form a composite y/P promoter.

small but were observed both in transient CAT expression assays and in stable neoR assays. The stable expression assay more closely reproduces genes in normal chromosomes, and correct initiation of mRNA from y/13-globin promoters was observed. Our results, in combination with the work of others, support the interpretation that the upstream portion of the y promoter contains three activator domains in fetal erythroid cells. One region includes the CACCC block, as demonstrated in this research and other work. A second region encompasses the two GATA-1 protein-binding sites between positions

- 190 and - 170. The activator properties of these GATA-1 sites have been shown in promoters with the - 175 mutation (Martin et al. 1989; McDonagh et al. 1991). The third region includes nucleotides in or around - 200 to - 190. This region binds transcriptional activator Spl in promoters with the - 198 mutation (Ronchi et al. 1989; Fischer and Nowock 1990; Sykes and Kaufman 1990; Gumucio et al. 1991). Mutation of nucleotides between - 200 and - 190 had only a small effect on promoter function in our assays, supporting the conclusion that the main activating regions for the y promoter in fetal erythroid cells are the

Lin et al.

368 Table I Function of Mutant and Wild-type y/P-Globin Promoters in Stably Transformed K562 Cells, as Measured by the neoR Colony-counting Assay y Sequence in the

y/D Promoter' Wild-type ( - 260 to - 190)

.......

Plasmid Vector

Total No. of Colonies Countedb

EH17 EH15 EH16 EH18 EH14

67 33 47 35 42

Relative Promoter

Strengthc 1.0 .49 .70 .52 .63

± ± ± ±

.08 .1 .01 .2 a The y/D promoter consisted of the indicated y sequence (fig. 3) joined to the 127-bp minimal 13 promoter. The promoter was joined to the neoR reporter gene (Lin et al. 1987). b The total number of cells plated for each vector was 1.2 x 107. c Values shown are mean ± 1 SE. Relative promoter strength was calculated from the total numbers of colonies counted (e.g., the relative promoter strength for mutant UP12.1 was 33/67, or .49). The SE was obtained from the relative promoter strengths from two independent experiments by use of the formula (81 + 8J)½/(2)½, where 81 and 82 are the differences between the mean and the measurement from each of the two experiments.

Mutant UP12.1 ....................... Mutant UP13 ........................ Wild-type(-260to -200) ....... Mutant UP8 ........................

M

A

_I

1 I

2

II

I

1353 _1078 872 603

310 281 N_27 1

-O

CACCC and GATA-1 domains. No other up-regulating domains were found. At least five proteins-GATA-1, Spl, Oct-i, a CACCC-binding protein, and a protein with an affinity for the - 200 region -have been shown to bind to the 'y-globin promoter between - 260 and - 137 (Gumucio et al. 1991). The contributions of these proteins to the developmental regulation of the gene remain to be defined. Our functional study, in which the various mutations produced relatively small changes in promoter function, supports the interpretation that regulation involves small but cooperative effects of promoter-binding proteins. The close arrangement of the CACCC block and the GATA-1 motifs in the upstream y-promoter paral-

234

194-

B

-127 +1 +49 Hindm PvuI[ BglH 230 /,7ZII'll ~ -dzneoR SP6 promoter /2 389nt l

J__-9-? _

_

Figure 4 Correct initiation of neoR transcripts from a y/13globin promoter, as shown by RNAase protection assays. A, Lane M, Radiolabeled HaeIII digest of cX174 DNA. Sizes of the fragments are indicated. Lane 1, Probe "hybridized" to 10 gg of tRNA. Lane 2, Probe hybridized to 10 fig of cytoplasmic RNA obtained from G418-resistant K562 cells after stable introduction of a neoR gene driven by a composite yy/ 0-globin promoter. The arrow indicates the major band, interpreted to represent the correctly initiated 389-nt transcript. Its size was estimated to be 380 nt, on the basis of interpolation of the logarithms of the mobilities of the size standards. B, Diagram of the RNA probe, indicating the endpoints of the correctly initiated mRNA, three restriction-enzyme sites, and radiolabeling by use of SP6 RNA polymerase. A polylinker of 18 bp joins the 13 sequences to the neoR sequences.

The Human y-Globin Promoter lels the organization of the rat tryptophan oxidase gene promoter, where a canonical CACCC block lies 20 bp upstream of two glucocorticoid-responsive elements (Danesch et al. 1987). Both the CACCC block and the glucocorticoid-responsive elements were needed for full steroid induction of recombinant promoters in mouse fibroblasts. The cooperativity between the two elements was hypothesized to result from protein-protein interaction, because protein binding at the CACCC site and at the glucocorticoidresponsive sites were independent (Schule et al. 1988). This example of cooperativity involving a CACCC block is a precedent for a similar mechanism in the human y-globin promoter. A few of our scanning mutations increased promoter function by twofold or more over that in wildtype, suggesting regions of negative regulation. Such interpretations are tentative, however, because characterization of repressor regions are better done in nonexpressing cells. In conclusion, there is evidence for two major and one minor activator domains in the fetal y-globin gene upstream promoter region. These results may aid study of the function of proteins that bind to these promoter regions. Understanding these regulatory factors may provide insight into therapeutic augmentation of fetal hemoglobin levels.

Acknowledgments We thank Ms. A. Moulton for preparation of the oligonucleotides. Dr. H. Fujii provided his computer program for analyzing CAT assay data; Dr. T. Kadesch provided plasmid pSV2Apap and the "PAP" assay protocol; and Dr. 0. Smithies provided the DNA clone from which the enhancer fragment was derived. H.J.L. gratefully acknowledges a Research Fellowship Award from the Cooley's Anemia Foundation, a Basil O'Connor Award from the March of Dimes, and a grant from the Harbor-UCLA Research and Education Institute.

References Anagnou NP, Karlsson S, Moulton AD, Keller G, Nienhuis AW (1986) Promoter sequences required for function of the human y globin gene in erythroid cells. EMBO J 5: 121-126

Barford NC (1985) Experimental measurements: precision, error, and truth, 2d ed. John Wiley & Sons, New York Bodine DM, Ley TJ (1987) An enhancer element lies 3' to the human Ay globin gene. EMBO J 6:2997-3004 Catala F, deBoer E, Habets G, Grosveld F (1989) Nuclear

369 protein factors and erythroid transcription of the human gene. Nucleic Acids Res 17:3811-3827 Collins FS, Metherall JE, Yamakawa M, Pan J, Weissman SM, Forget BG (1985) A point mutation in the Ay-globin gene promoter in Greek hereditary persistence of fetal haemoglobin. Nature 313:325-326 Collins FS, Stoeckert CJ Jr, Sergeant GR, Forget BG, Weissman SM (1984) Gyp + hereditary persistence of fetal hemoglobin: cosmid cloning and identification of a specific mutation 5' to the Gy gene. Proc Natl Acad Sci USA 81: 4894-4898 Costa FF, Zago MA, Cheng G, Nechtman JF, Stoming TA, Huisman THJ (1990) The Brazilian type of nondeletional Ay-fetal hemoglobin has a C-OG substitution at nucleotide - 195 of the Ay-globin gene. Blood 76:1896-1897 Croxton FE, Cowden DJ, Klein S (1967) Applied general statistics. Prentice-Hall, Englewood Cliffs, NJ Danesch U, Gloss B, Schmid W, Schutz G, Schule R, Renkawitz R (1987) Glucocorticoid induction of the rat tryptophan oxygenase gene is mediated by two widely separated glucocorticoid-responsive elements. EMBO J 6: 625-630 Dierks P, van Ooyen A, Cochran MD, Dobkin C, Reiser J, Weissmann C (1983) Three regions upstream from the cap site are required for efficient and accurate transcription of the rabbit 3-globin gene in mouse 3T6 cells. Cell 32:695-706 Enver T. Raich N, Ebens AJ, Papayannopoulou T, Costantini F, Stamatoyannopoulos G (1990) Developmental regulation of human fetal-to-adult globin gene switching in transgenic mice. Nature 344:309-313 FeIgner PL, Gadek TR, Holm M, Roman R, Chan HW, Wenz M, Northrop JP, et al (1987) Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure. Proc Natl Acad Sci USA 84:7413-7417 Fischer K-D, Nowock J (1990) The T-IoC substitution at - 198 of the Ay-globin gene associated with the British form of HPFH generates overlapping recognition sites for two DNA-binding proteins. Nucleic Acids Res 18:56855693 Fucharoen S, Shimizu K, Fukumaki Y (1990) A novel C-T transition within the distal CCAAT motif of the Gy-globin gene in the Japanese HPFH: implication of factor binding in elevated fetal globin expression. Nucleic Acids Res 18: 5245-5253 Gelinas R, Bender M, Lotshaw C, Waber P, Kazazian H Jr, Stamatoyannopoulos G (1986) Chinese Ay fetal hemoglobin: C to T substitution at position - 196 of the Ay gene promoter. Blood 67:1777-1779 Gelinas R. Endlich B, Pfeiffer C, Yagi M, Stamatoyannopoulos G (1985) G to A substitution in the distal CCAAT box of the A y-globin gene in Greek hereditary persistence of fetal haemoglobin. Nature 313:323-325 Giglioni B, Casini C, Mantovani R, Merli S, Comi P, Ottolenghi S, Saglio G, et al (1984) A molecular study of a

Ayy-globin

370 family with Greek hereditary persistence of fetal hemoglobin and ,B-thalassemia. EMBO J 3:2641-2645 Gilman JG, Huisman THJ (1985) DNA sequence variation associated with elevated fetal Gy globin production. Blood 66:783-787 Gilman JG, Kutlar F, Johnson ME, Huisman THJ (1987) A G to A nucleotide substitution 161 base pairs 5' of the Gy globin gene cap site (- 161) in a high Gy non-anemic person. In: Stamatoyannopoulos G, Nienhuis AW (eds) Developmental control of globin gene expression. Alan R Liss, New York, pp 383-390 Gilman JG, Mishima N, Wen XJ, Kutlar F, Huisman THJ (1988) Upstream promoter mutation associated with a modest elevation of fetal hemoglobin expression in human adults. Blood 72:78-81 Gorman CM, Moffat LF, Howard BH (1982) Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044-1051 Grosveld F, van Assendelft GB, Greaves DR, Kollias G (1987) Position-independent, high-level expression of the human 0-globin gene in transgenic mice. Cell 51:975-985 Gumucio DL, Rood KL, Blanchard-McQuate KL, Gray TA, Saulino A, Collins FS (1991) Interactions of Spl with the human -y globin promoter: binding and transactivation of normal and mutant promoters. Blood 78:1853-1863 Henthorn P, Zervos P, Raducha M, Harris H, Kadesch T (1988) Expression of a human placental alkaline phosphatase gene in transfected cells: use as a reporter for studies of gene expression. Proc Natl Acad Sci USA 85: 6342-6346 Lin HJ, Anagnou NP, Rutherford TR, Shimada T, Nienhuis AW (1987) Activation of the human 0-globin promoter in K562 cells by DNA sequences 5' to the fetal y- or embryonic zeta-globin genes. J Clin Invest 80:374-380 McDonagh KT, Lin HJ, Lowrey CH, Bodine DM, Nienhuis AW (1991) The upstream region of the human gamma globin gene promoter: identification and functional analysis of nuclear protein binding sites. J Biol Chem 266: 11965-11974 Martin DIK, Tsai S-F, Orkin SH (1989) Increased y-globin expression in a nondeletion HPFH mediated by an erythroid-specific DNA-binding factor. Nature 338:435438

Ottolenghi S, Nicolis S, Taramelli R, Malgaretti N, Mantovani R, Comi P, Giglioni B, et al (1988) Sardinian Gy-HPFH: a T- C substitution in a conserved "octamer" sequence in the Gy-globin promoter. Blood 71:815-817 Perez-Stable C, Costantini F (1990) Roles of the fetal Gy.glo_ bin promoter elements and the adult ,B-globin 3' enhancer in the stage-specific expression of globin genes. Mol Cell Biol 10:1116-1125

Lin et al. Ronchi A, Nicolis S, Santoro C, Ottolenghi S (1989) Increased Spi binding mediates erythroid-specific overexpression of a mutated (HPFH) y-globin promoter. Nucleic Acids Res 17:10231-10241 Rutherford TR, Clegg JB, Weatherall DJ (1979) K562 human leukaemic cells synthesize embryonic haemoglobin in response to haemin. Nature 280:164-165 Rutherford T, Nienhuis AW (1987) Human globin gene promoter sequences are sufficient for specific expression of a hybrid gene transfected into tissue culture cells. Mol Cell Biol 7:398-402 SambrookJ, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. 2d ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Schule R, Muller M, Otsuka-Murakami H, Renkawitz R (1988) Cooperativity of the glucocorticoid receptor and the CACCC-box binding factor. Nature 332:87-90 Sorrentino B. Ney P, Bodine D, Nienhuis AW (1990) A 46 base pair enhancer sequence within the locus activating region is required for induced expression of the gammaglobin gene during erythroid differentiation. Nucleic Acids Res 18:2721-2731 Stoming TA, Stoming GS, Lanclos KD, Fei YJ, Altay C, Kutlar F. Huisman THJ (1989) An Ay type of nondeletional hereditary persistence of fetal hemoglobin with a T--SC mutation at position - 175 to the cap site of the Ay globin gene. Blood 73:329-333 Surrey S, Delgrosso K, Malladi P, Schwartz E (1988) A single-base change at position - 175 in the 5' flanking region of the Gy-globin gene from a Black with Gyi + HPFH. Blood 71:807-810 Sykes K, Kaufman R (1990) A naturally occurring gamma globin gene mutation enhances Spl binding activity. Mol Cell Biol 10:95-102 Tate VE, Wood WG, Weatherall DJ (1986) The British form of hereditary persistence of fetal hemoglobin results from a single base mutation adjacent to an S1 hypersensitive site 5' to the Ay globin gene. Blood 68:1389-1393 Tsai S-F, Martin DIK, Zon LI, D'Andrea AD, Wong GG, Orkin SH (1989) Cloning of cDNA for the major DNAbinding protein of the erythroid lineage through expression in mammalian cells. Nature 339:446-451 Tuan DYH, Solomon WB, London IM, Lee DP (1989) An

erythroid-specific, developmental-stage-independent enhancer far upstream of the human 'i-like globin" genes. Proc Natl Acad Sci USA 86:2554-2558 Ulrich MJ, Ley TJ (1990) Function of normal and mutated y-globin gene promoters in electroporated K562 erythroleukemic cells. Blood 75:990-999 Young HD (1962) Statistical treatment of experimental data. McGraw-Hill, New York