G-quadruplex horseradish peroxidase-mimicking DNAzyme nanowires.

G Model ACA 233246 No. of Pages 7

Analytica Chimica Acta xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Analytica Chimica Acta journal homepage: www.elsevier.com/locate/aca

A novel electrochemical aptasensor for highly sensitive detection of thrombin based on the autonomous assembly of hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme nanowires Shunbi Xie, Yaqin Chai *, Yali Yuan, Lijuan Bai, Ruo Yuan * Key Laboratory of Luminescent and Real-Time Analytical Chemistry (Southwest University), Ministry of Education, College of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715, PR China

H I G H L I G H T S

G R A P H I C A L A B S T R A C T

This assay is label-free, the signal can be read out by measuring the electrochemical signal of hemin. The hemin/G-quadruplex HRP-DNAzyme nanowires were formed via EXPAR reaction and HCR. The prepared aptasensor exhibited low detection limit and wide linear range to TB.

A R T I C L E I N F O

A B S T R A C T

Article history: Received 31 August 2013 Received in revised form 28 April 2014 Accepted 30 April 2014 Available online xxx

In this work, a new signal amplified strategy was constructed based on isothermal exponential amplification reaction (EXPAR) and hybridization chain reaction (HCR) generating the hemin/Gquadruplex horseradish peroxidase-mimicking DNAzyme (HRP-mimicking DNAzyme) nanowires as signal output component for the sensitive detection of thrombin (TB). We employed EXPAR’s ultra-high amplification efficiency to produce a large amount of two hairpin helper DNAs within a minutes. And then the resultant two hairpin helper DNAs could autonomously assemble the hemin/G-quadruplex HRPmimicking DNAzymes nanowires as the redox-active reporter units on the electrode surface via hybridization chain reaction (HCR). The hemin/G-quadruplex structures simultaneously served as electron transfer medium and electrocatalyst to amplify the signal in the presence of H2O2. Specifically, only when the EXPAR reaction process has occurred, the HCR could be achieved and the hemin/Gquadruplex complexes could be formed on the surface of an electrode to give a detectable signal. The proposed strategy combines the amplification power of the EXPAR, HCR, and the inherent high sensitivity of the electrochemical detection. With such design, the proposed assay showed a good linear relationship within the range of 0.1 pM–50 nM with a detection limit of 33 fM (defined as S/N = 3) for TB. ã 2014 Elsevier B.V. All rights reserved.

Keywords: Exponential isothermal amplification Hybridization chain reaction Hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme Thrombin Electrochemical aptasensor

1. Introduction

* Corresponding authors. Tel.: +86 23 68252277; fax: +86 23 68253172. E-mail addresses: [email protected] (S. Xie), [email protected] (Y. Chai), [email protected] (R. Yuan).

In various DNA devices, movements were powered by DNAzymes [1]. DNAzymes are a kind of artificial enzyme, which exhibit surprising potential as new biocatalysts [2]. The hemin/G-quadruplex DNAzyme that consists of hemin intercalated in a G-quadruplex structure is the most frequently used biocatalytic

http://dx.doi.org/10.1016/j.aca.2014.04.065 0003-2670/ ã 2014 Elsevier B.V. All rights reserved.

Please cite this article in press as: S. Xie, et al., A novel electrochemical aptasensor for highly sensitive detection of thrombin based on the autonomous assembly of hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme nanowires, Anal. Chim. Acta (2014), http://dx. doi.org/10.1016/j.aca.2014.04.065


2

S. Xie et al. / Analytica Chimica Acta xxx (2014) xxx–xxx

DNAzyme label for amplified biosensing [3–6]. The hemin/Gquadruplex DNAzyme can not only act as an electrocatalyst based on the horseradish peroxidase (HRP)-mimicking activity but also use as an electron transfer medium based on the reversible redox of Fe (III)/Fe(II) of hemin [7,8]. Owing to these remarkable features, the hemin/G-quadruplex DNAzyme complexe is extensively used in colorimetric [9,10] chemiluminescence [11], electrocatalytic [12], and optical [13] detection of various targets. Most of these systems, the hemin/G-quadruplex plays, however, just a single electrocatalyst or electron transfer medium role. Using the catalytic and redox properties of hemin/G-quadruplex DNAzyme simultaneously could get rid of the addition of electron transfer medium and protein enzymes in a catalytic amplification-based electrochemical assay, which constructed a sample method for electrochemical signal generation and amplification. Signal amplification is an efficient way to improve the sensitivity of a biosensor. Many signal amplification approaches based on DNA machines such as polymerase chain reaction (PCR) [14,15], rolling circle amplification (RCA) [16,17], loop-mediated isothermal amplification (LAMP) [18,19], nicking endonuclease signal amplification [20,21], strand displacement amplification (SDA) [22,23], hybridization chain reaction (HCR) [24,25], and the isothermal exponential amplification reaction (EXPAR) [26,27] have been reported. Among these methods, the HCR and EXPAR attracted researchers’ considerable attention to design sensitive assays for the analysis of targets. HCR is an enzyme-free process where a hybridization event is triggered by an initiator and leads to the polymerization of oligonucleotides into a long nicked dsDNA molecule [28]. HCR amplification shows great potential in signal amplification output based on the advantages of remarkable amplified efficiency, enzyme-free process, and mild operation conditions. Very recently, Shimron et al. [29] described a colorimetric DNA detection system which combined the amplification capability of HCR with the hemin/G-quadruplex DNAzyme nanowires and showed promising results. Moreover, the EXPAR, first devised by Van Ness et al. [30] has shown a great potential for “on the spot’’ testing ascribing to the operation at constant temperature. More importantly, this strategy has distinct advantages of ultra-high amplification efficiency (106–109 fold amplification) and rapid amplification kinetics, which can rapidly amplify short oligonucleotides within minutes [31]. Wang et al. [32] described a colorimetric microRNAs detection system which combined the amplification capability of EXPAR with the hemin/G-quadruplex DNAzyme and got an ultra-low detection limit. However, in such strategies, the HRP-mimicking DNAzyme was just used as catalytic label for the colorimetric amplified detection of DNA or MicroRNAs, which presented some limitations for their practical implementation. Thus, it is a highly desirable project to carry out a strategy which could combine more technology and detect more types of targets. In this work, we combined the virtues of HCR (enzyme-free, mild operation conditions) and EXPAR (constant temperature, ultra-high amplification efficiency) together with electrochemical technology (high sensitivity) to develop a bioassay for the sensitive detection of protein. As a model system, the TB was used as the interest target. Thrombin binding aptamer (TBA) and its complementary DNA (cDNA) were immobilized onto Fe3O4@Au magnetic beads (GMB). In the presence of TB, cDNA was dissociated and released from the GMB. The released cDNA then hybridized with the amplification template and initiated the efficient synthesis of two helper DNAs (named as H1 and H2) in the continuous cycle of the polymerization, nicking and displacement reactions, by means of thermostable polymerase and nicking endonuclease. The resultant two helper DNAs could form a stable hairpin structure in the presence of Mg2+. And at the end of the two helper DNAs, three-fourths and one-fourth of G-quadruplex sequences were

designed for the HCR and the formation of hemin/G-quadruplex. The capture DNA on the electrode surface could trigger the HCR and lead to the formation of the DNA nanowires containing a great number of hemin/G-quadruplex DNAzymes in the presence of the two helper DNAs and hemin. Finally, the formed hemin/Gquadruplex DNAzymes structure catalyzes the reduction of the H2O2 in electrolytic cell to amplify the current signal and achieved the purpose of the highly sensitive detection of TB. 2. Experimental 2.1. Reagents and apparatus Thrombin (TB), hemoglobin (HB), hexanethiol (96%, HT), hemin, gold chloride (HAuCl4), bovine serum albumin (BSA), human IgG and lysozyme were purchased from Sigma (St. Louis, MO). The nicking endonuclease (Nt.Bst.NBI) and VentRs (exo-) DNApolymerase, the deoxynucleotide triphosphates (dNTPs), and diethylpyrocarbonate (DEPC)-treated water were purchased from New England Biolabs Ltd. (Beijing, China). Fe3O4@Au (core/shell) magnetic beads (50 nm in diameter) were bought from Xi’an GoldMag Nanobiotech Co., Ltd. (Xi’an, China). Tris–hydroxymethylaminomethane hydrochloride (tris) was obtained from Roche (Switzerland). K3[Fe(CN)6] were purchased from Beijing Chemical Reagent Co. (Beijing, China). All HPLC-purified DNA oligonucleotides were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). The sequences of the oligonucleotides are listed as follows: 1. Thrombin binding aptamer (TBA): 50 -NH2-(CH2)6-GGT TGG

TGT GGT TGG-30

2. Complementary DNA (c DNA): 50 -CCAACCACACCAACC-30 3. Capture DNA: 50 -SH-(CH2)6-AGAAGAAGGTGTTTAAGTA-30

The template DNA was synthesized by integrated DNA Technologies, Inc. (IDT, USA) template (CXBXA):):50 CCCGCCCTACCCAACTTAAACACCTTCTTCTAGTTTAAGTGGTAGAATTGACCCATCTTGACTCACCCAAGAAGAAGGTGTTTAAGTACAATTCTCCAACTTAAACACCCACCCGCCCTTCTTGACTCGGTTGGTGTGGTTGGP-30 (Underlined with the solid line domains B and C in template are complementary to the oligonucleotide H1 and H2; Underlined with the dotted line domain X is the complementary strand for the nicking enzyme recognition site; bold font domain A is the complementary sequence to the cDNA). 20 mM Tris–HCl buffer (pH 7.4) containing 140 mM NaCl, 5 mM KCl, 1 mM CaCl2, and 1 mM MgCl2 was used as a binding buffer. Phosphate-buffered solution (PBS) (pH 7.0, 0.1 M) containing 10 mM KCl, 2 mM MgCl2 was used as working buffer solution. All other chemicals were of analytical grade and used as received. All electrochemical measurements, including cyclic voltammetry (CV), differential pulse voltammograms (DPV) were performed with a CHI 660D electrochemical workstation (Shanghai Chenhua Instrument, China). The pH measurements were finished with a pH meter (MP 230, Mettler-Toledo, Switzerland). Transmission electron microscopy (TEM) images were obtained with a JEOLJEM2000CX transmission electron microscope (H600, Hitachi, Japan). The scanning electron micrographs were taken with scanning electron microscope (SEM, S-4800, Hitachi). A threeelectrode system contained a modified glassy carbon electrode (GCE, F = 4 mm) as working electrode, a platinum wire as auxiliary electrode, and a saturated calomel electrode (SCE) as a reference electrode. 2.2. Electrochemical measurements All electrochemical experiments were carried out in a conventional electrochemical cell containing a three-electrode




arrangement. CVs of the electrode fabrication were performed in 2 mL 5 mM K3[Fe(CN)6] solution containing 0.2 M KCl, scanning from 0.6 V to 0.2 V at a scan rate of 50 mV s1. DPV was performed in 2 mL 0.1 M PBS (pH 7.0) containing 1.05 mM H2O2 to investigate the performance of the aptasensor. The DPV measurement was taken: the potential range was from 0.5 to 0 V, modulation amplitude was 0.05 V, pulse width was 0.05 s, and sample width was 0.0167 s. 2.3. The EXPAR reaction The steps of EXPAR reaction for electrochemical detection of TB are illustrated in Scheme 1. First, 20 mL of 5 mg mL1 of GMB from the stock solution was transferred into a 1.5 mL eppendorf tube and washed three times with 0.1 M PBS buffer. Then, the GMB was incubated with 200 mL of 1 mM amino group modified thrombin binding aptamer (TBA) at room temperature for 16 h. Excess reagents were removed by magnetic force, followed by adding 200 mL of 1 mM cDNA solution and incubating at 37 C for 2 h to obtain the GMB-TBA-cDNA biocomplex. After magnetic separation, the GMB-TBA-cDNA biocomplex was incubated with 20 mL of Tris– HCl solution containing different concentration of TB at room temperature for 50 min. The cDNA released into the solution was separated from the biocomplex with a magnetic field (Scheme 1A). The EXPAR reaction was carried out according to the literature [33,34]. First, a volume of 50 mL mixture containing amplification template, 10 Nicking endonuclease buffer (25 mM Tris–HNO3, pH 7.9 at 25 C, 50 mM NaNO3, 5 mM Mg(NO3)2, 0.5 mM dithiothreitol) and the released cDNA was incubated at 37 C for 2 h and then cooled to room temperature. Subsequently, 20 mL 1 ThermaoPol buffer (10 mM Tris–HCl, pH 8.8, 5 mM KCl, 5 mM (NH4)2SO4, 0.05% Triton X-100), 10 mL DEPC-treated water, 6 mL dNTPs mixture (1 mM), 10 mL MgSO4 (1 mM), 2 mL Nt.Bst.NBI (0.5 U mL1), and 2 mL VentRs (exo-) polymerase (0.1 U mL1) were added into the above mixture to yield a total volume of 100 mL. After incubating at 53 C for 2 h, the mixture was heated at 90 C for 5 min to inactivate the enzymes. The above reaction mixture was added into 20 mL hemin stock solution (1 mM), agitating the solution to mix well and then stored at 4 C for further use. Scheme 1B shows the working principle of EXPAR reaction. The amplification template contains four domains. Domain A includes the cDNA binding sequence. Domain B and domain C include the sequences that are complementary to the helper DNA (named as H1 and H2), which act as a scaffold for the formation of nanowires consisting of the HRP-mimicking DNAzyme. Three domains are separated by two

3

nicking endonuclease recognition sites domain X. The polymerization reaction is initiated upon the hybridization between the cDNA and domain A at its 30 terminus in the presence of polymerase and dNTPs. Following the polymerization, a DNA duplex is produced, and the replicated strand includes two sequence specific nicking sites for the nicking endonuclease Nt. Bst.NBI. The nicking endonuclease nicks the upper replicated strand to release two short fragments (H1 and H2) from the amplification template under the strand-displacement activity of polymerase. It should be noted that the cleaved upper replicated strand proceeds to maintain as a primer to extend again. Thus, once initiated, the polymerization, nicking, and displacement reactions are continuously repeated to produce a large amount of H1 and H2. In order to prevent the nonspecific extension of the amplification template, it should be modified with phosphate group at its 30 terminus. H1 and H2 could form a stable hairpin structure in the presence of Mg2+, and at the end of H1 and H2, three-fourths and one-fourth of G-quadruplex sequences were designed for the HCR and the formation of hemin/G-quadruplex. 2.4. Fabrication of the modified electrodes Prior to use, GCE was polished carefully with 0.05 and 0.3 mm alumina powder on fine abrasive paper sequentially and then washed ultrasonically in water and ethanol for a few minutes. Firstly, AuNPs were deposited onto the GCE in 1% HAuCl4 solutions at the potential of 0.2 V for 30 s. Then, 20 mL of 2.5 mM capture DNA was coated on the AuNPs modified electrode at 4 C for 16 h. To eliminate nonspecific binding effects, the modified electrode was followed by incubating with 20 mL of 1.0 mM HT for 45 min at room temperature. Finally, the modified electrode was immersed in the hemin/helper DNAs solution for HCR amplification at 37 C for 2 h. The capture DNA on the electrode surface could trigger the HCR and lead to the formation of the DNA nanowires containing a great number of hemin/G-quadruplex DNAzymes the presence of the two helper DNAs and hemin. Thereafter, the electrodes were washed extensively to remove unbounded labels for electrochemical measurement, the hemin/G-quadruplex structures simultaneously served as electron transfer medium and electrocatalyst to amplify the signal in the presence of H2O2. Scheme 1C showed the schematic illustration of the stepwise procedure of the aptasensor fabrication and the corresponding catalysis amplifying principle. 2.5. Gel electrophoresis All the hairpin oligonucleotides were heated to 95 C for 2 min and then allowed to cool to room temperature for 1 h before use. Then different concentration of capture DNA was incubated with the EXPAR reaction solution in reaction buffer for 12 h. Thereafter, the prepared DNA samples solution were transformed into our freshly prepared 16% non-denaturing polyacrylamide gels and performed in 1 TBE buffer (pH 8.3) at a 100 V constant voltage for 150 min for gel electrophoresis separation. Finally, gels were stained with ethidium bromide and photographed with a digital camera under the UV light illumination. 3. Results and discussion 3.1. Characterization of the hemin/G-quadruplex HRP-DNAzyme nanowires

Scheme 1. Schematic illustration of TB detection based on isothermal exponential amplification and hybridization chain reaction generating the hemin/G-quadruplex HRP-mimicking DNAzymes nanowires.

As described above, the amplification of the electrochemical signal was implemented by the formation of the long nicked DNA polymers between H1 and H2. To realize our design, we used TEM to characterize the solution after incubation with H1, H2 and hemin. As seen from Fig. 1A, many long nanowires were observed



4


Fig. 1. TEM image of the hemin/G-quadruplex HRP-DNAzyme nanowires (A); Agarose gel electrophoresis demonstration of the capture DNA initiated HCR: lane 1, the EXPAR reaction solution (contain H1 and H2); lanes 2 and 3, the presence of the capture DNA (from left to right, 1 mM, 2 mM) with mixture of the EXPAR reaction solution. HCR time: 12 h (B).

indicating that the capture DNA could trigger a chain reaction of hybridization events between H1and H2. It should be noted that many of the nanowires form bundles. This is attributed to the intercrossing of polymer chains by the formation of interchain Gquadruplexes. The HCR between the capture DNA and the resultant two hairpin helper DNAs was further examined by gel electrophoresis. In the absence of capture DNA, the EXPAR reaction solution (contain H1 and H2) observed two emission bands after 150 min of gel electrophoresis (shown in Fig. 1B, lane 1). This UV bands locate at a comparable distant place from the notch, indicating a lighter molecular weight and the non-HCR process between the H1 and H2 monomer hairpins. Once capture DNA is introduced, it pairs with of H1, opens its hairpin structure via the strand-displacement interaction, and exposes a new terminus of H1 to further react with H2. In this way, each target DNA can trigger the HCR between H1 and H2 to form a long dsDNA polymer. In this case, the emission bands of high-molecular weight structures can be observed (displayed in Fig. 1B, lane 2 and 3), indicating the successful growth of dsDNA polymer. 3.2. The electrochemical characterization of the stepwise modified electrodes To characterize the modified electrode, the assembly steps of the sensing interface were investigated by CV measurements. The CVs of the fabricated aptasensor during stepwise modification conducted in 5 mM K3[Fe(CN)6] solution with a scan rate of

50 mV s1 are shown in Fig. 2A. As can be seen, a well-defined redox peak of [Fe(CN)6]3/4 was observed at the bare electrode (curve a). Curve b shows the electrodeposition of AuNPs on the GCE, the peak current was markedly increased, indicating that the AuNPs could greatly promote the electron transfer. After the thiolmodified capture DNA was immobilized on the modified electrode, the redox peak current decreased (curve c), which was attributed to the capture DNA block the electron transfer on the electrode surface. Subsequently, the modified electrode was treated with HT to block nonspecific site, a further decrease of peak current (curve d) was observed. After the assembly of the MnTMPyP-dsDNA complex (curve e), the peak current continuously decreased, indicating that the hemin/G-quadruplex HRP-DNAzyme nanowires were assembled successfully. The differences of the CVs in different modified stages clearly reflected the changes in each stage of the electrode surface. The curve a in Fig. 2B showed the CV current of the modified GCE/Au/ capture DNA/HT in PBS at 100 mV s1 (pH 7.0). After the prepared electrode being incubated with the mixture solution of H1, H2 and hemin, a stable and obvious reduction peak (b) of hemin was obtained, indicating that the signal was ascribed to the hemin/ G-quadruplex DNAzyme nanowires in our system. The electrochemical characteristics and amplification performance of the aptasensor were investigated by DPV measurements in 2 mL PBS solution. Fig. 3A showed the DPV wave of the GCE/Au/ capture DNA/HT modified electrode. No peak was observed because of the lack of substance with electrochemical activity in the working potential range, which provided a low background

Fig. 2. The electrochemical characterization of the stepwise modified electrodes: CVs of bare GCE (a); GCE/Au (b); GCE/Au/capture DNA (c); GCE/Au/capture DNA/HT (d); GCE/ Au/capture DNA/HT/hemin/G-quadruplex HRP-DNAzyme nanowires (e) in 5 mM K3[Fe(CN)6], scan rate: 50 mV s1 (A); CVs of GCE/Au/capture DNA/HT (a); GCE/Au/capture DNA/HT/hemin/G-quadruplex HRP-DNAzyme nanowires (b) in 2 mL PBS (pH 7.0) (B).




5

Fig. 3. The modified electrode with GCE/Au/capture DNA/HT (A); the proposed aptasensor investigated in PBS only (B) and PBS containing 1.05 mM H2O2 (C).

current. When the hemin/G-quadruplex HRP-DNAzyme nanowires were formed via HCR, an obvious DPV peak was obtained (Fig. 3B), indicating that the signal is ascribed to the redox reaction of the hemin/G-quadruplex structure in our system and efficient redox activity of the DNA nanowires. After H2O2 was added into the solution, seen from Fig. 3C, an obvious catalytic process appeared with a distinct increase of the reduction current upon the addition of H2O2, indicating a typical electrocatalytic reduction process of H2O2. Thus, this result suggested that the hemin/G-quadruplex HRP-DNAzyme nanowires not only showed favorable electrochemical activity, but also exhibited excellent electrocatalytic activity and effectively amplified the response signals.

3.3. The detection of thrombin based on DPV The sensitivity of the described strategy towards the target TB was examined. Under the optimal conditions (see the Supporting information), the aptasensors were incubated in solutions of different concentrations of TB and the DPV responses of the proposed aptasensor were recorded. From Fig. 4A we could see that the reduction peak current increased with the increasing concentration of TB. The standard calibration curve for TB detection is shown in Fig. 4B. The dose response curve showed a strong linear dependence of current on the logarithm (log) of TB concentration in the range from 0.1 pM to 50 nM with a detection

Fig. 4. (A) DPVs of electrochemical aptasenor for thrombin detection at different concentrations: 0 nM, 0.0001 nM, 0.001 nM, 0.01 nM, 0.1 nM, 1 nM, 10 nM, 20 nM and 50 nM. Detection buffer: PBS (pH 7.0) containing 1.05 mM H2O2. (B) The calibration plot of current intensity vs log cTB. (C) DPVs of electrochemical aptasenor for thrombin detection at different concentrations: 0.001 nM, 0.01 nM, 0.1 nM, 1 nM, 10 nM, 30 nM. Detection buffer: PBS (pH 7.0). (D)The calibration plot of current intensity vs log cTB investigated in PBS only.



6


and relative standard deviation values are ranging from 94.2% to 102.9% and 3.68% to 6.67%, respectively, which clearly indicated the potentiality of this aptasensor for the analytical application in real biological samples. 4. Conclusions

Fig. 5. Specificity of the aptasensor toward TB. Sensor current for: (a) zero analyte, (b) 10 nM BSA, (c) 10 nM HB, (d) 10 nM IgG, (e) 10 nM Iysozyme, (f) 1.0 nM TB, (g) 1.0 nM TB + 10 nM BSA, (h) 1.0 nM TB + 10 nM HB, (i)1.0 nM TB + 10 nM IgG, (j)1.0 nM TB + 10 nM Iysozyme.

limit of 33 fM. For comparison, the current density of the proposed aptasenor investigated in PBS only was also recorded. The aptasensor showed a linear range from 1 pM to 30 nM for TB (Fig. 4C and D). Thus, an improved electrochemical signal is achieved by the developed aptasensor, which exhibits satisfactory performance as expected. In addition, the analytical performance of the developed aptasensor has been compared with other detection methodologies for thrombin detection. The results were summarized in Table S1 (see the Supporting information). 3.4. Specificity, reproducibility, stability, and applicability of the aptasensor To test the specificity of the proposed strategy for TB detection, the influences of some other proteins such as bovine serum albumin (BSA), human IgG, hemoglobin (HB), and lysozyme were examined under the same experimental conditions. As shown in Fig. 5, all of the tested proteins have no significant effect on the current intensity compared with the absence of TB. In addition, the presence of high concentration (10 nM) of BSA, IgG, HB did not interfere with the assay for TB (1 nM). It shows that our assay is specific for TB detection. The reproducibility of the aptasensor was evaluated using the following method: five proposed aptasensors associated with 1 nM TB, all aptasensors exhibited similar electrochemical response and the relative standard deviation (RSD) of the five aptasensor was 5.12%. This result suggested acceptable reproducibility of the proposed aptasensor. The stability of the aptasensor was evaluated every 5 days for long-term storage at 4 C. The aptasensor retained 96% of its initial current after 5 days storage and 93% after 20 days storage, which indicated the aptasensor had good stability. To evaluate the applicability and reliability of the proposed biosensor, the recovery experiments for real samples at various concentrations were carried out, where each sample was analyzed three times. The data are given in Table 1. It was found that the recovery Table 1 Determination of thrombin added in human blood serum (n = 3) with the proposed aptasensor. Serum sample

Concentration of thrombin added (nM)

Concentration obtained with aptasensor (nM)

Recovery/ RSD/% %

1 2 3 4 5

0.001 0.01 1 10 30

0.00957 0.0942 1.005 10.29 30.25

95.7 94.2 100.5 102.9 100.8

3.68 4.59 4.74 6.67 5.51

In summary, we have introduced a strategy to detect TB using electrochemical technique with the hemin/G-quadruplex HRPDNAzyme nanowires formed via EXPAR reaction and HCR as electrochemical probes. This proposed assay possesses a number of unique features. First, it offers a high sensitivity with a low detection limit of 33 fM, attributed to the EXPAR reaction and HCR strategies for the synthesis of hemin/G-quadruplex HRP-DNAzyme nanowires. Second, this assay is label-free, in which the signal could be easily read out by measuring the electrochemical signal of hemin. Third, large numbers of hemin/G-quadruplex units on the DNA nanowire simultaneously act as electrocatalyst greatly amplifying the current signal in the presence of H2O2. In addition, taking advantages of the magnetic microbeads for aptamers immobilization to avoid cross reaction in the assays, the separation procedures were greatly simplified and the sensitivity was improved. Specifically, only when the EXPAR reaction process has occurred, the HCR could be achieved and the hemin/Gquadruplex complexes could be formed on the surface of an electrode to give a detectable signal. In view of these advantages, we expect that this method can be expanded readily in clinical applications. Acknowledgements This work was financially supported by the NNSF of China (21075100, 21275119, 21105081), Ministry of Education of China (Project 708073), Research Fund for the Doctoral Program of Higher Education (RFDP) (20110182120010), Natural Science Foundation of Chongqing City (CSTC-2011BA7003, CSTC2010BB4121), State Key Laboratory of Silkworm Genome Biology (sklsgb2013012) and the Fundamental Research Funds for the Central Universities (XDJK2013A008, XDJK2013A27, XDJK2014C138), China Postdoctoral Science Foundation (2014M550454), China. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.aca.2014.04.065. References [1] Y. Tian, Y. He, Y. Chen, P. Yin, C. Mao, A DNAzyme that walks processively and autonomously along a one-dimensional trac, Angew. Chem. Int. Ed. 44 (2005) 4355–4358. [2] C. Teller, S. Shimron, I. Willner, Aptamer-DNAzyme hairpins for amplified biosensing, Anal. Chem. 81 (2009) 9114–9119. [3] D.M. Kong, J. Xu, H.X. Shen, Positive effects of ATP on G-quadruplex-hemin DNAzyme-mediated reactions, Anal. Chem. 82 (2010) 6148–6153. [4] M.G. Deng, D. Zhang, Y.Y. Zhou, X. Zhou, Highly effective colorimetric and visual detection of nucleic acids using an asymmetrically split peroxidase DNAzyme, J. Am. Chem. Soc. 130 (2008) 13095–13102. [5] S. Bi, L. Li, S.S. Zhang, Triggered polycatenated DNA scaffolds for DNA sensors and aptasensors by a combination of rolling circle amplification and DNAzyme amplification, Anal. Chem. 82 (2010) 9447–9454. [6] V. Pavlov, Y. Xiao, R. Gill, A. Dishon, M. Kotler, I. Willner, Amplified chemiluminescence surface detection of DNA and telomerase activity using catalytic nucleic acid labels, Anal. Chem. 76 (2004) 2152–2156. [7] Y.Q. Lai, Y.Y. Ma, L.P. Sun, J. Jia, J. Weng, N. Hu, W. Yang, Q.Q. Zhang, A highly selective electrochemical biosensor for Hg2+ using hemin as a redox indicator, Electrochim. Acta 56 (2011) 3153–3158. [8] Y.J. Guo, J. Li, S.J. Dong, Hemin functionalized graphene nanosheets-based dual biosensor platforms for hydrogen peroxide and glucose, Sens. Actuators B 1 (2011) 295–300.



S. Xie et al. / Analytica Chimica Acta xxx (2014) xxx–xxx [9] Y. Xiao, V. Pavlov, T. Niazov, A. Dishon, M. Kotler, I. Willner, Catalytic beacons for the detection of DNA and telomerase activity, J. Am. Chem. Soc. 126 (2004) 7430–7431. [10] Y. Li, X. Li, X. Ji, Formation of G-quadruplex-hemin DNAzyme based on human telomere elongation and its application in telomerase activity detection, Biosens. Bioelectron 26 (2011) 4095–4098. [11] R. Freeman, X. Liu, I. Willner, Chemiluminescent and chemiluminescence resonance energy transfer (CRET) detection of DNA, metal ions, and aptamersubstrate complexes using hemin/G-quadruplexes and CdSe/ZnS quantum dots, J. Am. Chem. Soc. 133 (2011) 11597–11604. [12] G. Pelossof, R. Tel-Vered, J. Elbaz, I. Willner, Amplified biosensing using the horseradish peroxidase-mimicking DNAzyme as an electrocatalyst, Anal. Chem. 82 (2010) 4396–4402. [13] G. Pelossof, R. Tel-Vered, X. Liu, I. Willner, Amplified surface plasmon resonance based DNA biosensors, aptasensors, and Hg2+ sensors using hemin/ G-quadruplexes and Au nanoparticles, Chem. Eur. J. 17 (2011) 8904–8912. [14] R.T. Ranasinghe, T. Brown, Fluorescence based strategies for genetic analysis, Chem. Commun. 44 (2005) 5487–5502. [15] A. Marx, M. Strerath, Genotyping-from genomic DNA to genotype in a single tube, Angew. Chem. Int. Ed. 44 (2005) 7842–7849. [16] J.S. Li, W.W. Zhong, Typing of multiple single-nucleotide polymorphisms by a microsphere-based rolling circle amplification assay, Anal. Chem. 79 (2007) 9030–9038. [17] J.S. Li, T. Deng, X. Chu, R.H. Yang, J.H. Jiang, G.L. Shen, R.Q. Yu, Rolling circle amplification combined with gold nanoparticle aggregates for highly sensitive identification of single-nucleotide polymorphisms, Anal. Chem. 82 (2010) 2811–2816. [18] H. Wang, J.S. Li, Y.X. Wang, J.Y. Jin, R.H. Yang, K.M. Wang, W.H. Tan, Combination of DNA ligase reaction and gold nanoparticle-quenched fluorescent oligonucleotides: a simple and efficient approach for fluorescent assaying of singlenucleotide polymorphisms, Anal. Chem. 82 (2010) 7684–7960. [19] X.E. Fang, H. Chen, S.N. Yu, X.Y. Jiang, J.L. Kong, Predicting viruses accurately by a multiplex microfluidic loop-mediated isothermal amplification chip, Anal. Chem. 83 (2011) 690–695. [20] X. Hun, H.C. Cheng, W. Wang, Design of ultrasensitive chemiluminescence detection of lysozyme in cancer cells based on nicking endonuclease signal amplification technology, Biosens. Bioelectron 26 (2010) 248–254. [21] G.F. Jie, L. Wang, J.X. Yuan, S.S. Zhang, Versatile electrochemiluminescence assays for cancer cells based on dendrimer/CdSe–ZnS-quantum dot nanoclusters, Anal. Chem. 83 (2011) 3873–3880.

7

[22] Q.H. Chen, Z.H. Bian, M. Chen, X. Hua, C.Y. Yao, H. Xia, H. Kuang, X. Zhang, J.F. Huang, G.R. Cai, W.L. Fu, Real-time monitoring of the strand displacement amplification (SDA) of human cytomegalovirus by a new SDA-piezoelectric DNA sensor system, Biosens. Bioelectron 24 (2009) 3412–3418. [23] Y. Weizmann, M.K. Beissenhirtz, Z. Cheglakov, R. Nowarski, M. Kotler, I. Willner, A virus spotlighted by an autonomous DNA machine, Angew. Chem. 118 (2006) 7544–7548. [24] J. Huang, Y.R. Wu, Y. Chen, Z. Zhu, X.H. Yang, C.Y.J. Yang, K. Wang, W.H. Tan, Pyrene-excimer probes based on the hybridization chain reaction for the detection of nucleic acids in complex biological fluids, Angew. Chem. Int. Ed. 50 (2011) 401–404. [25] B. Zhang, B.Q. Liu, D.P. Tang, R. Niessner, G.N. Chen, D. Knopp, DNA-based hybridization chain reaction for amplified bioelectronic signal and ultrasensitive detection of proteins, Anal. Chem. 84 (2012) 5392–5399. [26] Y.Q. Liu, M. Zhang, B.C. Yin, B.C. Ye, Sensitive detection of microRNAs with hairpin probe-based circular exponential amplification assay, Anal. Chem. 84 (2012) 7037–7042. [27] H. Jia, Z. Li, C. Liu, Y. Cheng, Ultrasensitive detection of microRNAs by exponential isothermal amplification, Angew. Chem. Int. Ed. 49 (2010) 5498– 5501. [28] Y. Chen, J. Xu, J. Su, Y. Xiang, R. Yuan, Y.Q. Chai, In situ hybridization chain geaction amplification for universal and highly sensitive electrochemiluminescent detection of DNA, Anal. Chem. 84 (2012) 7750–7755. [29] S. Shimron, F. Wang, R. Orbach, I. Willner, Amplified detection of DNA through the enzyme-free autonomous assembly of hemin/G-Quadruplex DNAzyme nanowires, Anal. Chem. 84 (2012) 1042–1048. [30] J. Van Ness, L.K. Van Ness, D.J. Galas, Isothermal reactions for the amplification of oligonucleotides, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 4504–4509. [31] Y.Q. Liu, M. Zhang, B.C. Yin, B.C. Ye, Attomolar ultrasensitive microRNA detection by DNA-scaffolded silver-nanocluster probe based on isothermal amplification, Anal. Chem. 84 (2012) 5165–5169. [32] X.P. Wang, B.C. Yin, P. Wang, B.C. Ye, Highly sensitive detection of microRNAs based on isothermal exponential amplification-assisted generation of catalytic G-quadruplexDNAzyme, Biosens. Bioelectron 42 (2013) 131–135. [33] S. Bi, J.L. Zhang, S.S. Zhang, Ultrasensitive and selective DNA detection based on nicking endonuclease assisted signal amplification and its application in cancer cell detection, Chem. Commun. 46 (2010) 5509–5511. [34] X. Hun, H.C. Chen, W. Wang, Design of ultrasensitive chemiluminescence detection of lysozyme in cancer cells based on nicking endonuclease signal amplification technology, Biosens. Bioelectron 26 (2010) 248–254.


G-quadruplex horseradish peroxidase-mimicking DNAzyme.

DNAzyme-based biosensors and nanodevices.

Catalytic molecular logic devices by DNAzyme displacement.

Transformation of Ag nanowires into semiconducting AgFeS2 nanowires.

Chromogenic substrates for horseradish peroxidase.

DNAzyme cascades by the reconfiguration of DNA nanostructures.

DNAzyme switches for molecular computation and signal amplification.

Design and biosensing of Mg²⁺-dependent DNAzyme-triggered ratiometric electrochemiluminescence.

Immunocytological localization of estrogen in human mammary carcinoma cells by horseradish--anti-horseradish peroxidase complex.

Photocurrent limit in nanowires.

DNAzyme-Based Logic Gate-Mediated DNA Self-Assembly.

A smart DNAzyme-MnO₂ nanosystem for efficient gene silencing.

A microRNA-initiated DNAzyme motor operating in living cells.

Ultrasensitive DNAzyme beacon for lanthanides and metal speciation.

DNAzyme-based probe for circulating microRNA detection in peripheral blood.

Horseradish peroxidase transport from primate dental pulps.

Recombinant horseradish peroxidase: production and analytical applications.

Infrared spectroscopic studies of carbonyl horseradish peroxidases.

Sensitized photooxidation of low spin horseradish peroxidase.

Magnetic circular dichroism studies on horseradish peroxidase.

Renal reabsorption and excretion of horseradish peroxidase.

GaP-ZnS pseudobinary alloy nanowires.

The Mechanical Properties of Nanowires.

G-quadruplex-based DNAzyme concatamers for in situ amplified impedimetric sensing of copper(II) ion coupling with DNAzyme-catalyzed precipitation strategy.