Neuroscience 298 (2015) 137–144
GABAA RECEPTOR a2 SUBTYPE ACTIVATION SUPPRESSES RETINAL SPREADING DEPRESSION M. WANG, a,b* Y. LI a AND Y. LIN c
and retina. Cortical SD is generally regarded as the underlying mechanisms of migraine (Lauritzen, 1994, 2001; Ayata, 2010; Bhaskar et al., 2013; Karatas et al., 2013) and it was evidenced that cortical SD wave propagation coincides with the visual scotoma progression in migraine patients with aura (Hadjikhani et al., 2001). Further, chronic daily administration of migraine prophylactic drugs dose-dependently suppressed the frequency of cortical SD (Ayata et al., 2006) and cortical SD may lead to migraine headache involving the activation of a gap junction protein, PANX1 (Karatas et al., 2013). Inhibition of cortical SD could therefore form a preventative strategy against migraine. Evidence showed that topiramate that has function to positively modulate the inhibitory c-aminobutyric acid type A (GABAA) receptors (Kawasaki et al., 1998; Braga et al., 2009) elevates cortical SD threshold (Green et al., 2013) and reduces cortical SD frequency and propagation (Unekawa et al., 2012). The important function of GABAA receptor in SD was supported by the fact that GABAA receptor inhibition by bicuculline prevented the reduction of cortical SD amplitudes by tumor necrosis factor (Richter et al., 2014). Furthermore, topiramate was reported to relieve migraine headache (Braga et al., 2009) and inflammatory or neuropathic pain (Munro et al., 2009, 2013). The fact that the potentiated GABAA receptor current modulates neuronal instability during cortical SD that is associated with migraine, suggests GABAA receptor as a promising target for prophylactic treatment of migraine. GABAA receptor is a pentameric ligand-gated ion channel composed of a1–6, b1–3, c1–3, q1–3, e, p, d or h subtypes while the most common combination is two a, two b and two c subtypes (Hevers and Luddens, 1998; Sieghart, 2006). Variations in the gene expression of different GABAA receptor subtype isoforms were found in migraine patients, suggesting that specific subtypes of the receptor may play a key role in migraine pathology (Plummer et al., 2011). Furthermore, GABAA receptor function related to neuropathic pain, anxiety and epilepsy was reported to involve a subtypes and drugs targeting some of these receptor subtypes have been developed (Griebel et al., 2003; Atack et al., 2006; Mirza et al., 2008; Munro et al., 2008). At this point, whether a subtypes of GABAA receptor activation contribute to suppression of SD remains unknown. Dissecting out how GABAA receptor a subtypes that do not work differ mechanistically from those that do will provide avenues through which one can develop new
a
Centre for Neuroscience, Xi’an Jiaotong-Liverpool University (XJTLU), Suzhou 215123, China b
Department of Biological Sciences, XJTLU, Suzhou 215123, China
c
Department of Applied Chemistry, XJTLU, Suzhou 215123, China
Abstract—Cortical spreading depression (SD) is a transient propagating neuronal excitation followed by depression, which is generally accepted as the underlying cause of migraine. The inhibitory c-aminobutyric acid type A (GABAA) receptor activation not only reduces cortical SD frequency and propagation, but also relieves migraine headache. This study aims to determine the role of major a subtypes of GABAA receptor in mediating SD genesis and propagation using an efficient in vitro chick retinal model. We firstly demonstrated that abundant a2, and to a lesser extent, a5 of GABAA receptor expression in the chick retina, enabled the tissue useful for studying GABAA receptor pharmacology and SD. Marked suppression of SD by SL651498 and TPA023 was observed at 10 lmol L1 and 50 lmol L1, respectively, suggesting a critical role of GABAA receptor a subtypes, in particular a2, in modulating retinal SD elicitation and propagation. The negative data on NS11394 at 3 lmol L1 on SD and the little positive selectivity of TPA023 for a5 did not support that a5 subtype is involved in SD genesis and propagation. Our data provide strong evidence that a2, but not a5 is involved in the early stage of migraine, indicating that a2 subtype is a possible drug target related to migraine with aura. Ó 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Key words: GABAA receptor, a2, TPA023, migraine, cortical spreading depression, chick retina.
INTRODUCTION Spreading depression (SD) is a transient neuronal excitation followed by depression that can propagate slowly across the cerebral cortex, sub-cortical regions *Correspondence to: M. Wang, SA451, Department of Biological Sciences, Xi’an Jiaotong-Liverpool University, 111 Ren Ai Road, Suzhou 215123, China. Tel: +86-512-8816-1662. E-mail addresses: [email protected] (M. Wang), yanli. [email protected] (Y. Li), [email protected] (Y. Lin). Abbreviations: AOI, area of interest; cDNA, complementary deoxyribonucleic acid; DMSO, dimethyl sulfoxide; GABAA, c-aminobutyric acid type A; RNA, ribonucleic acid; RT-PCR, real-time polymerase chain reaction; SD, spreading depression; TBST, TrisBuffered Saline with Tween-20. http://dx.doi.org/10.1016/j.neuroscience.2015.04.016 0306-4522/Ó 2015 IBRO. Published by Elsevier Ltd. All rights reserved. 137
138
M. Wang et al. / Neuroscience 298 (2015) 137–144
treatments to treat patients with migraine. The primary aim of the present study was to identify the role of major a subtypes: a2-, a3- and a5-containing GABAA receptors in SD, by investigating the effects of a subtype-selective and positive modulators in an effective in vitro chick retinal model (Wang et al., 2012). To this end, three drugs with a specific subtype selectivity were chosen: (i) SL651498, a selective agonist at a2/a3 subtypes of GABAA receptors and a partial agonist at a1and a5-containing GABAA receptor subtypes (Sans et al., 2000; Griebel et al., 2003; de Haas et al., 2009). (ii) TPA023, a novel a2/a3-selective containing GABAA receptor agonist (Atack et al., 2006; Munro et al., 2009); and (iii) NS11394 (a positive a5/a3 preferring GABAA receptor allosteric modulator with a notably higher a5and a3-containing GABAA receptor efficacy (Mirza et al., 2008). Expression of corresponding GABAA receptor subtypes in the chick retina was also thoroughly confirmed and the model was also validated with topiramate.
EXPERIMENTAL PROCEDURES All animals were housed in an animal unit of Soochow University with food and water available ad libitum. Male Hyline Brown chicks (n = 37, purchased at 1-day old, Wuxi poultry Ltd, Jiangsu, China) were housed for at least 1 week before use (aged 8–28 days). Adult, male Sprague–Dawley rats (n = 3, Shanghai SLAC Laboratory Animal Corporation Ltd, China) were housed to 300–400 g. All animal procedures were approved by the Ethics Review Panels of Xi’an Jiaotong-Liverpool University (XJTLU) and Soochow University and performed in accordance with the relevant national guidelines. Real-time polymerase chain reaction (RT-PCR) RT-PCR was performed to detect a2, a3, a5 messenger ribonucleic acid (mRNA) transcripts using chick genespecific primers together with SYBR Green (TaKaRa Biotechnology Co. Ltd., Dalian, China). The primer sequences of a2, a3 and a5 are shown in Table 1. Following rapid dissection, vitreous was taken away, chick retina peeled away from the eye cup and immediately frozen in liquid nitrogen, stored at 80 °C until further use. Chick retina was homogenized and total RNA was extracted using UNIQ-10 column trizol total RNA isolation kit (SK1321, Sangon Biotech, Shanghai, China). Complementary deoxyribonucleic
acids (cDNA) were prepared using AMV First Strand cDNA Synthesis Kit (SK2445, Sangon Biotech, Shanghai, China). The resulting cDNA samples (n = 3) were analyzed and quantitative PCR was performed using a RT-PCR Detection System (LightCycler480, Roche Applied Science, Indianapolis, IN, USA) following the manufacturer’s instruction. Threshold cycle was automatically calculated by the instrument. All mRNA expression data were expressed as a normalized target, b-actin, ratio in experimental samples.
Western blot Western blot was used to examine whether GABAA receptor a2, a3, a5 proteins are expressed in chick retina. Membrane protein was extracted from the homogenized chick retina using membrane protein extraction kit (Beyotime Institute of Biotechnology, Shanghai, China) by following the manufacturer’s instruction with minor modifications. Protein samples (200 lg) were separated by 10% sodium dodecyl sulfate–polyacrylamide loading buffer (NuPAGEÒ LDS Sample Buffer 4X, Invitrogen, Carlsbad, CA, USA), transferred onto nitrocellulose membranes. Non-specific binding was blocked with 5% milk in Tris-Buffered Saline with Tween-20 (TBST, 20 mM Tris, 150 mM NaCl, 0.1% Tween-20, pH 7.6). The membranes were then exposed to rabbit polyclonal anti-GABAA receptor a2 (ab72445), a3 (ab72446), a5 (ab83003) antibodies (Abcam, Cambridge, UK) respectively and incubated overnight at 4 °C. Once excess primary antibodies were washed by TBST, membranes were incubated with goat anti-rabbit horseradish peroxidase-labeled secondary antibody (Sangon Biotech, Shanghai, China). Protein bands were detected by incubating the membrane with Western Bright enhanced chemiluminescence working solution (Advansta, Menlo Park, CA, USA) and using Kodak medical X-ray film (Kodak XBT-1, Carestream, Xiamen, China). The film was scanned and analyzed with Bio-rad Gel Doc XR+ with Image Lab 2.0 Software (BIO-RAD, Shanghai, China). The same procedure was applied to rat cortex samples and results were used as positive controls. Both rat cortex and retinal samples were run in the same gel for comparison. Detection of membrane NR2A using rabbit polyclonal anti-NR2A receptor (ab106957, Abcam) was also analyzed as positive controls and the 2nd antibody only was used as a negative control.
Table 1. Summary of specific primer sequences for real-time PCR GABAAR gene
NCBI ref. (Gallus gallus)
Primer sequence (50 –30 )
b-Actin
L08165.1 (Gene bank)
a2
XM_001233849.1
a3
XM_420268.2
a5
XM_416880.3
F: AGTGTCTTTTTGTATCTTCCGCC R: CCACATACTGGCACTTTACTCCTA F: CAGAACCCAACAAGGCAAAA R: GCCAAGTAAGACAGGCTCCC F: TCTGTCGCTTTCTCCTGTCTTT R: TTCCCAACTCTACTCTTACTACTTCTG F: CATCAGTACCAGTACAGGCGAATA R: TGTCACTCCAAAGACAGTCCG
139
M. Wang et al. / Neuroscience 298 (2015) 137–144
retinal SD. These series were: (i) Ringer’s solution (control, n = 6); (ii) topiramate (Sigma, St. Louis, Missouri, USA, n = 6). This drug was applied in order to validate whether retinal SD was suitable for GABAA receptor pharmacology as topiramate has known antiCSD effect (Braga et al., 2009; Green et al., 2013); (iii) dimethyl sulfoxide (DMSO) vehicle group (diluted in Ringer’s solution, 0.01%, 0.03%, 0.1%, n = 6); and three drug groups (each diluted in 0.01%, 0.03%, 0.1% DMSO): (iv) SL651498 (Axon, Groningen, Netherlands, n = 6); (v) TPA023 (n = 7); (vi) NS11394 (Axon, Groningen, Netherlands, n = 6). The concentration range of each drug to be tested was carefully selected on the basis of their GABAA receptor subtype selectivity reported in the literature (Atack et al., 2006; Mirza et al., 2008; Munro et al., 2008; de Haas et al., 2009; Unekawa et al., 2012). A detailed summary on affinity and selectivity of each drug applied under study is summarized in Table 2. For each group tested, ten SDs in total were elicited in each experiment, with two separate SDs for each of the different and consecutive tests: (i) initial Ringer’s control; (ii) low concentration of drug or vehicle; (iii) medium concentration of drug or vehicle; (iv) high concentration of drug or vehicle; and (v) post-treatment with Ringer’s control (i.e. drug removal). A recovery time of 20 min was applied between each two SD elicitation. For each test sequence (i.e. elicitation of two SD), the perfusion medium was changed immediately after the end of the 2nd, 4th, 6th and 8th SD recording when required, such that the preparation was adequately perfused with the proper drug or Ringer’s medium for the subsequent test.
Chick retinal SD using intrinsic optical imaging Retinal SD was induced as previously described (Farkas et al., 2008; Wang et al., 2012). Briefly, chicks were killed by cervical dislocation; posterior eyecup with retina attached was submerged in a perfusion medium in a tissue chamber. Unless otherwise stated, the chamber was perfused with Ringer’s solution (mmol L1 concentrations: 100 NaCl, 6 KCl, 1 MgSO4, 30 NaHCO3, 1 NaH2PO3, 1 CaCl2 and 20 glucose; bubbled with 95% O2 and 5% CO2; pH 7.4) at the perfusion rate of 0.5 ml min1 at 32 °C. The tissue was stabilized for at least 30 min before elicitation of the first SD. Ten repeated SDs were induced at the edge of the eyecup by ejection of 1 ll of 0.1 mol L1 KCl with 20min interval for tissue recovery. The retina preparation was illuminated for 25 milli-seconds (ms) every one second with 1-Hz frequency using a high-power LED spotlight (625 nm peak wavelength, SLS-0307-A, Mightex, Pleasanton, CA, USA) and intrinsic optical signal of the tissue under interest was simultaneously recorded with a monochrome camera (QIC-F-M-12, Media Cybernetics, Marlow, UK) used at maximal spatial resolution. Image sequences were recorded at one frame per second over a 3-min period. Camera exposure and illumination were synchronized using the same external trigger. Image acquisition, storage and analysis were through Image Pro Plus software (IPP7; Media Cybernetics, UK). Synthesis of TPA023 Starting from 3,6-dichloropyridazine and 1,2,4-triazole, TPA023 was synthesized in five steps according to the literature (Carling et al., 2005). The final product was characterized by nuclear magnetic resonance NMR (Bruker, Avance III 400 MHz) and mass spectrometer (Brucker, MicroTOF-Q). 1H NMR: 7.982 (s, ArH); 7.926 (s, ArH); 7.873 (dt, ArH); 7.534–7.590 (m, ArH); 7.350 (dt, ArH); 7.276 (t, ArH); 5.522 (s, 2H, OCH2); 4.146 (q, 2H, CH2CH3); 1.422 (t, 3H, CH2CH3); 1.400 (s, 9H, C(CH3)3). Mass calculated for C20H22FN7O 395.18, found 396 (ESI, [M+H]+). Both analyses approve the correct structure of TPA023.
Data and statistical analysis An area of interest (AOI) parallel to the SD wave front was delineated manually for each image sequence. For each picture within the sequence, the gray levels of the pixels constituting the AOI were averaged as intrinsic optical signal changes in this value were then plotted against time as an indication to characterize SD (Wang et al., 2012). As reported earlier (Wang et al., 2012), for each SD wave, the area under the curve (AUC, Gray levels second) of the transient cellular depolarization associated with propagating SD was calculated and used as an index of its magnitude. In each image sequence related to a given SD, propagation rate of the wave was also calculated as previously described (Wang et al., 2012) to reflect tissue excitability.
EXPERIMENTAL DESIGN FOR DRUG TESTING Six series of experiments were carried out to examine the effects of different drugs on GABAA receptor subtype in
Table 2. Summary of drugs showing their binding affinity and selectivity for GABAA receptor a subtypes from the literature Drug Topiramate SL651498
TPA023
NS11394
GABAA receptor selectivity GABAA receptor positive allosteric modulator (PAM) PAM: a2, a3 selective
PAM: a2, a3 selective; Antagonist: a1, a5 selective PAM: a3, a5 selective
Affinity and efficacy
Reference 1
50, 100, 200, 600 mg kg , peroral, rat (plasma concentration: 50– 200 lmol L1) in CSD model Affinity (nmol L1, recombinant rat GABAA receptor in HEK293 cell): a1 (17) > a2 (73) > a3 (80) > a5 (215); efficacy (%, 1 lmol L1 of the drug): a2 (115) > a3 (85) > a5 (50) > a1 (45) Affinity (nmol L1, recombinant human GABAA receptor in mouse L cells): a3 (0.19) > a1 (0.27) > a2 (0.31) > a5 (0.41); efficacy (%, 1 lmol L1 drug): a3 (33) > a2 (12) > a5 (6) > a1 (1) Affinity (nmol L1, recombinant human GABAA receptor in HEK293 cell): a5 (0.1) > a1 (0.4) > a3 (0.5) > a2 (0.8); efficacy (%, 0.5 lmol L1 drug): a3 (78) > a5 (52) > a2 (26) a1 (7.8)
Unekawa et al. (2012) de Haas et al. (2009) Atack et al. (2006)
Mirza et al. (2008), Munro et al. (2008)
140
M. Wang et al. / Neuroscience 298 (2015) 137–144
As preliminary study showed that all drugs tested reached a maximum effect with 20-min incubation and there was no difference of the drug response on the two consecutive SDs at one condition, the calculated values within each different test were averaged and all corresponding data were given as mean ± SD in percentage of their respective baselines (averaged value for the first two K+ stimuli). Kruskal–Wallis oneway analysis and paired t-test were used for comparison of each parameter between the drug and respective control group and between the last two tests within each group against the averaged value for the last two K+ stimuli (i.e. effect of drug removal), respectively.
RESULTS GABAA receptor a2, a3 and a5 mRNA expression in chick retina The RT-PCR results revealed that normalized a2, a3 and a5 mRNAs of GABAA receptor were detected in chick retina as shown in Fig. 1 (n = 3). Among them, a2 mRNA had the highest expression, followed by a3, while a5 had the minimum expression (Fig. 1). GABAA receptor a2 and a5 protein expression in chick retina As reported earlier (Pirker et al., 2000), a2, a3 and a5 subtypes of GABAA receptor were detected with specific intense bands in the rat cortex (Fig. 2, n = 3). In chick retina, a2 (51 kDa), and to a lesser level, a5 (52 kDa) subtypes of GABAA receptor was expressed in chick retina; while a3 was not detected (Fig. 2, lane 2, n = 3).
Suppression of SD in chick retina by topiramate To validate that our retinal SD was suitable for a subtypecontaining GABAA receptor pharmacology, we examined the effect of topiramate, a a subtype-selective GABAA receptor-positive modulator (Kawasaki et al., 1998) that was previously reported to elevate the cortical SD threshold (Green et al., 2013) and to reduce cortical SD frequency and propagation in rats (Unekawa et al., 2012). In the Ringer’s group, both the magnitude and propagation rate were not altered over 10 repeated SDs. In agreement with that reported previously in rats (Unekawa et al., 2012), topiramate significantly reduced the propagation rate of retinal SD in a concentration-dependent manner (0.03, 0.1 and 0.3 mmol L1) comparing with its respective Ringer’s control. At the highest concentration tested (0.3 mmol L1), the propagation rate was reduced to 71.3% of its initial value (average data of 7th and 8th SD) (Fig. 3C, n = 6). Topiramate also gradually reduced the magnitude of SD, although this reduction did not reach significance at any concentration of the drug applied comparing with its respective Ringer’s control (Fig. 3A, n = 6), possibly because of a large variability of the data within groups. The magnitude and propagation rate recovered to 84.3% and 86.7%, respectively, after topiramate removal. These results are in accordance with the inhibitory effects of topiramate on CSD propagation velocity in vivo (Unekawa et al., 2012) and its application for chronic migraine medication (Hoffmann et al., 2014). Taking into account the expression of a2 and a5 proteins in chick retina reported herein (Fig. 2), the retinal SD model turned out to be an efficient in vitro pharmacology tool for studying functions of specific a subtype-containing GABAA receptors in addition to other classification of drug target (Wang et al., 2012; Wiedemann et al., 2012). Suppression of SD by SL651498 and TPA023, but not NS11394
Fig. 1. Real-time PCR analysis of GABAA receptor a2, a3, a5 subtypes in the chick retina. Normalized mRNA expression is shown as mean ± SD (reference to b-actin, 2DCT, n = 3 in each group).
In the vehicle (DMSO) group, no significant changes of the magnitude and propagation rate of retinal SD were detected when compared with relative initial controls throughout the experiment. The magnitude and propagation rate remained at 90.8% and 99.9% at the highest concentration of DMSO (0.1%), respectively (Fig. 3B, D, n = 6). Both SL651498 and TPA023 were found to suppress the magnitude (Fig. 3B, n = 6) and propagation rate (Fig. 3D, n = 7) of SD in a concentration-dependent manner. At the maximum concentration tested (10 lmol L1), SL651498 reduced the magnitude and propagation rate to 68.7% and 89.2% of its initial value respectively (average data of
Fig. 2. Immunoblotting detection of GABAA receptor a2 (right, lane 1), a3 (right, lane 2), and a5 (right, lane 3) subunits in the chick retina and detection of membrane protein from the adult rat cortex was analyzed as positive controls as shown in the left of each lane. Membrane NR2A (lane 4) detection was also used as positive controls.
M. Wang et al. / Neuroscience 298 (2015) 137–144
141
Fig. 3. Comparison of the effects of SL651498, TPA023 and NS11394 on the magnitude (area under the curve, A and B) and propagation rate (C and D) of SD induced by K+ in the chick retina. One control group (Ringer’s solution, n = 6); one vehicle group (DMSO, n = 6) and four drug treatment groups (Topiramate, n = 6; SL651498, n = 6; TPA023, n = 7; NS11394, n = 6) were considered. Ten SDs in total were elicited and five successive perfusion media tested in each experiment: initial Ringer’s solution, four different drug concentrations and Ringer’s solution (i.e. after drug removal). Data (mean ± SD) are plotted as percentage of their initial levels. Kruskal–Wallis test, with subsequent Dunn’s test for significance between specific independent data sets. ⁄p < 0.05, ⁄⁄p < 0.01 vs Ringer’s control; #p < 0.05, ##p < 0.01 vs DMSO vehicle control.
7th and 8th SD). Similarly, TPA023 also suppressed the magnitude and propagation rate of SD to 66.8% and 86.4% at the highest concentration applied (50 lmol L1), respectively (Fig. 3B, D, n = 7). The inhibitory effect of SL651498 and TPA023 on the magnitude and propagation rate of SD was persistent after the drug removal (Fig. 3B, D). On the contrary, NS11394 did not alter both magnitude and propagation rate of SD wave at all concentrations tested (up to 3 lmol L1, Fig. 3B, D).
DISCUSSION AND CONCLUSION GABAA receptor a2, a3 and a5 expression in chick retina Our results demonstrated abundant gene expression of
a2, to a lesser extent, a3, followed by a5 in the chick retina (Fig. 1). The findings also revealed that GABAA
a2 and a5 proteins were expressed in the chick retina (Fig. 1). This data point that a2- and a5-containing GABAA receptors may have important functions in the chick retina. Unlike a3 gene that was expressed in the
chick retina that was in line with those previously reported in the tissue (Ring et al., 2010), a3 protein was not observed (Fig. 2). The lack of a3 protein in the tissue is probably due to a relatively low cross-reactivity of the primary antibody applied (84% homology) between rat and chick (Table 3). Therefore, the existence of a3 protein in the chick retina cannot be excluded. Further investigation using specific antibodies raised against chicks is required. All together, these data complement previous findings that GABAA a1 protein was expressed in the retina of chicks (Cheng et al., 2012, 2013). The important feature of GABAA a subtype expression in the chick retina, together with the N-methyl-D-aspartate receptor subtype expression reported previously (Wang et al., 2012), enables chick retina a useful tissue for studying functions of specific excitatory (Wang et al., 2012) and inhibitory neurotransmitter receptor subtypes and extrapolating pharmacological data obtained in the retina to the cortex. Using this tissue, we then tested drugs selectively modulating GABAA receptor a subtypes in SD, the findings of which is discussed below.
142
M. Wang et al. / Neuroscience 298 (2015) 137–144
Table 3. Homology blast comparison of GABAA receptor a2, a3, a5 subtypes between rat and chick and cross reactivity of primary antibodies applied under study GABAA a subtype
Catalog number (Abcam)
NCBI RefSeq.
Homology (%)
Antibody cross activity (Rabbit polyclonal)
a2
ab72445
94
Mouse, Rat
a3
ab72446
84
Mouse, Rat
a5
ab83003
Rat: NP_001129251.1 Chick: XP_001233850.1 Rat: NP_058765.3 Chick: XP_420268.2 Rat: NP_058991.1 Chick: XP_416880.2
88
Human; Mouse, Rat, Chick, Cow, Dog (Predicted)
Activation GABAA receptor a subtypes suppresses retinal SD SL651498 is a selective agonist at a2/a3 subtypes of GABAA receptors, which also has partial a1 and a5 efficacy (Griebel et al., 2003; de Haas et al., 2009). The marked suppression of SD magnitude and propagation rate in the chick retina (Fig. 3B, D) may be attributed to a functional role of all a2/a5/a1/a3 subtypes of GABAA receptor in mediating retinal SD for the following reasons. Firstly, chick retina contains abundant expression of a2, to a lesser extent, a5 proteins (Fig. 2), in addition to a1 (Cheng et al., 2012, 2013). Secondly, although detectable a3 proteins were not seen in the chick retina (Fig. 2), the role of a3 subtypes in retinal SD under SL651498 application cannot be ruled out without further investigation. Thirdly, at the concentration (10 lmol L1) applied, SL651498 should exhibit efficacy to all a2/a5/a1/a3 subtypes as it was reported that the drug at 1 lmol L1, has efficacy (in%) in the order of a2 (115) > a3 (85) > a5 (50) > a1 (45) in HEK293 cells (de Haas et al., 2009). Taken together, these data suggest a key role of GABAA receptor major a subtypes in modulating retinal SD elicitation and propagation. Suppression of retinal SD is attributed to GABAA receptor a2 subtype The critical role of a subtype in mediating retinal SD was confirmed by TPA023 as the drug also significantly suppressed the magnitude and propagation rate of SD waves in the chick retina at 15 and 50 lmol L1, respectively (Fig. 3B, D). The fact that TPA023 is a2/a3 selective, while has no positive a1 or a5 activity (Munro et al., 2009), suggests a key role of a2 and/or a3 subtypes, but not a1 and a5 in mediating retinal SD. However, as discussed above, a possible involvement of a3 subtypes in SD needs further confirmation in tissue containing a3 proteins. This finding indicates that TPA023 may be a promising drug for the preventive treatment of migraine in addition to functioning against inflammatory and neuropathic pain (Munro et al., 2011, 2013). It is interesting to note that the magnitude of SD remained low (67.4%) after the removal of TPA023 and SL651498, indicating possible long-term efficacy against CSD (Fig. 3B).
NS11394 exhibits the highest efficacy to a5 (Munro et al., 2008) and a5 is present in chick retina (Figs. 1 and 2); therefore, the lack of inhibitory effect on SD by the drug at the concentration applied does not support that a5 is involved in mediating retinal SD elicitation and propagation. Furthermore, as NS11394 has relatively low a2 efficacy (26% at 0.5 lmol L1 in HEK293 cells) (Munro et al., 2008), the lack of retinal SD suppression (Fig. 3) does not suggest a lack of role of a2 in mediating retinal SD. On the contrary, the important function of a2 in retinal SD was demonstrated by the marked suppression of SD under TPA023 and SL651498 application discussed above. It is noteworthy to mention that the role of a1 subtype in retinal SD is not conclusive under study. As a1 protein is abundant in the chick retina (Cheng et al., 2012, 2013) and NS11394 has little a1 efficacy, it would be interesting to investigate whether a1 may be involved in mediating cortical SD using subtype-selective partial agonist modulator or a1-mutated rodent in the future.
CONCLUSIONS Findings from this study demonstrated that GABAA receptor a2, a5 are expressed in the chick retina and revealed that the activation of a subtype-containing GABAA receptors, in particular a2, suppresses retinal SD, suggesting a key role of a2 in the early stage of migraine. The negative data on NS11394 do not support an involvement of a5 in SD genesis and propagation. Selectively targeting GABAA receptor a subtype may lead to drugs with increased clinical specificity, which would present a promising alternative to agents currently used for prophylactic treatment of migraine without the major side effects seen with classical GABAA receptor benzodiazepine binding site. This finding suggests that a subtype, at least a2, could be a possible drug target related to migraine with aura while with lower neuronal toxic effects. Further studies are necessary to confirm the role of a3 protein expression in SD in chick retina. In addition, monitoring tissue excitability (Ayata et al., 2006; Unekawa et al., 2012; Green et al., 2013) under a2-containing GABAA receptor inhibition and establish TPA023 is effective against cortical SD in vivo will help better understand the role of a2containing GABAA receptor in migraine prophylaxis.
Activation of a5 subtype receptor may not contribute to retinal SD suppression Unlike SL651498 and TPA023, NS11394 did not alter the magnitude and propagation rate of retinal SD (Fig. 3B, D).
CONFLICT OF INTEREST The authors declare there is no conflict of interest.
M. Wang et al. / Neuroscience 298 (2015) 137–144 Acknowledgments—We greatly thank Chengpei Ni and Qiu Meng at XJTLU for their assistance on making TPA023 and Liji Huang for her technical support on TPA023 pharmacology. This work was funded by WangWenLi Education Charitable Foundation (Ref: RD006), China.
REFERENCES Atack JR, Wafford KA, Tye SJ, Cook SM, Sohal B, Pike A, Sur C, Melillo D, Bristow L, Bromidge F, Ragan I, Kerby J, Street L, Carling R, Castro JL, Whiting P, Dawson GR, McKernan RM (2006) TPA023 [7-(1,1-dimethylethyl)-6-(2-ethyl-2H-1,2,4-triazol3-ylmethoxy)-3-(2-fluorophenyl)-1,2,4-triazolo[4,3-b]pyridazine], an agonist selective for alpha2- and alpha3-containing GABAA receptors, is a nonsedating anxiolytic in rodents and primates. J Pharmacol Exp Ther 316:410–422. Ayata C (2010) Cortical spreading depression triggers migraine attack: pro. Headache 50:725–730. Ayata C, Jin H, Kudo C, Dalkara T, Moskowitz MA (2006) Suppression of cortical spreading depression in migraine prophylaxis. Ann Neurol 59:652–661. Bhaskar S, Saeidi K, Borhani P, Amiri H (2013) Recent progress in migraine pathophysiology: role of cortical spreading depression and magnetic resonance imaging. Eur J Neurosci 38:3540–3551. Braga MF, Aroniadou-Anderjaska V, Li H, Rogawski MA (2009) Topiramate reduces excitability in the basolateral amygdala by selectively inhibiting GluK1 (GluR5) kainate receptors on interneurons and positively modulating GABAA receptors on principal neurons. J Pharmacol Exp Ther 330:558–566. Carling RW, Madin A, Guiblin A, Russell MG, Moore KW, Mitchinson A, Sohal B, Pike A, Cook SM, Ragan IC, McKernan RM, Quirk K, Ferris P, Marshall G, Thompson SA, Wafford KA, Dawson GR, Atack JR, Harrison T, Castro JL, Street LJ (2005) 7-(1,1Dimethylethyl)-6-(2-ethyl-2H-1,2,4-triazol-3-ylmethoxy)-3-(2fluorophenyl)-1,2,4-triazolo[4,3-b]pyridazine: a functionally selective gamma-aminobutyric acid(A) (GABA(A)) alpha2/ alpha3-subtype selective agonist that exhibits potent anxiolytic activity but is not sedating in animal models. J Med Chem 48:7089–7092. Cheng ZY, Chebib M, Schmid KL (2012) Identification of GABA receptors in chick cornea. Mol Vis 18:1107–1114. Cheng ZY, Wang XP, Schmid KL, Liu L (2013) Identification of GABA receptors in chick retinal pigment epithelium. Neurosci Lett 539:43–47. de Haas SL, Franson KL, Schmitt JA, Cohen AF, Fau JB, Dubruc C, van Gerven JM (2009) The pharmacokinetic and pharmacodynamic effects of SL65.1498, a GABA-A alpha2,3 selective agonist, in comparison with lorazepam in healthy volunteers. J Psychopharmacol (Oxford, England) 23:625–632. Farkas E, Pratt R, Sengpiel F, Obrenovitch TP (2008) Direct, live imaging of cortical spreading depression and anoxic depolarisation using a fluorescent, voltage-sensitive dye. J Cereb Blood Flow Metab 28:251–262. Green AL, Gu P, De Felice M, Dodick D, Ossipov MH, Porreca F (2013) Increased susceptibility to cortical spreading depression in an animal model of medication-overuse headache. Cephalalgia 34:594–604. Griebel G, Perrault G, Simiand J, Cohen C, Granger P, Depoortere H, Francon D, Avenet P, Schoemaker H, Evanno Y, Sevrin M, George P, Scatton B (2003) SL651498, a GABAA receptor agonist with subtype-selective efficacy, as a potential treatment for generalized anxiety disorder and muscle spasms. CNS Drug Rev 9:3–20. Hadjikhani N, Sanchez Del Rio M, Wu O, Schwartz D, Bakker D, Fischl B, Kwong KK, Cutrer FM, Rosen BR, Tootell RB, Sorensen AG, Moskowitz MA (2001) Mechanisms of migraine aura revealed
143
by functional MRI in human visual cortex. Proc Natl Acad Sci USA 98:4687–4692. Hevers W, Luddens H (1998) The diversity of GABAA receptors. Pharmacological and electrophysiological properties of GABAA channel subtypes. Mol Neurobiol 18:35–86. Hoffmann J, Akerman S, Goadsby PJ (2014) Efficacy and mechanism of anticonvulsant drugs in migraine. Expert Rev Clin Pharmacol 7:191–201. Karatas H, Erdener SE, Gursoy-Ozdemir Y, Lule S, Eren-Kocak E, Sen ZD, Dalkara T (2013) Spreading depression triggers headache by activating neuronal Panx1 channels. Science (New York, NY) 339:1092–1095. Kawasaki H, Tancredi V, D’Arcangelo G, Avoli M (1998) Multiple actions of the novel anticonvulsant drug topiramate in the rat subiculum in vitro. Brain Res 807:125–134. Lauritzen M (1994) Pathophysiology of the migraine aura. The spreading depression theory. Brain 117(Pt 1):199–210. Lauritzen M (2001) Cortical spreading depression in migraine. Cephalalgia 21:757–760. Mirza NR, Larsen JS, Mathiasen C, Jacobsen TA, Munro G, Erichsen HK, Nielsen AN, Troelsen KB, Nielsen EO, Ahring PK (2008) NS11394 [30 -[5-(1-hydroxy-1-methyl-ethyl)-benzoimidazol-1-yl]biphenyl-2-carbonitrile], a unique subtype-selective GABAA receptor positive allosteric modulator: in vitro actions, pharmacokinetic properties and in vivo anxiolytic efficacy. J Pharmacol Exp Ther 327:954–968. Munro G, Lopez-Garcia JA, Rivera-Arconada I, Erichsen HK, Nielsen EO, Larsen JS, Ahring PK, Mirza NR (2008) Comparison of the novel subtype-selective GABAA receptor-positive allosteric modulator NS11394 [30 -[5-(1-hydroxy-1-methyl-ethyl)benzoimidazol-1-yl]-biphenyl-2-carbonitrile] with diazepam, zolpidem, bretazenil, and gaboxadol in rat models of inflammatory and neuropathic pain. J Pharmacol Exp Ther 327:969–981. Munro G, Ahring PK, Mirza NR (2009) Developing analgesics by enhancing spinal inhibition after injury: GABAA receptor subtypes as novel targets. Trends Pharmacol Sci 30:453–459. Munro G, Erichsen HK, Rae MG, Mirza NR (2011) A question of balance – positive versus negative allosteric modulation of GABA(A) receptor subtypes as a driver of analgesic efficacy in rat models of inflammatory and neuropathic pain. Neuropharmacology 61:121–132. Munro G, Hansen RR, Mirza NR (2013) GABA(A) receptor modulation: potential to deliver novel pain medicines? Eur J Pharmacol 716:17–23. Pirker S, Schwarzer C, Wieselthaler A, Sieghart W, Sperk G (2000) GABA(A) receptors: immunocytochemical distribution of 13 subunits in the adult rat brain. Neuroscience 101:815–850. Plummer PN, Colson NJ, Lewohl JM, MacKay RK, Fernandez F, Haupt LM, Griffiths LR (2011) Significant differences in gene expression of GABA receptors in peripheral blood leukocytes of migraineurs. Gene 490:32–36. Richter F, Lutz W, Eitner A, Leuchtweis J, Lehmenkuhler A, Schaible HG (2014) Tumor necrosis factor reduces the amplitude of rat cortical spreading depression in vivo. Ann Neurol 76:43–53. Ring H, Boije H, Daniel C, Ohlson J, Ohman M, Hallbook F (2010) Increased A-to-I RNA editing of the transcript for GABAA receptor subunit alpha3 during chick retinal development. Vis Neurosci 27:149–157. Sans N, Petralia RS, Wang YX, Blahos 2nd J, Hell JW, Wenthold RJ (2000) A developmental change in NMDA receptor-associated proteins at hippocampal synapses. J Neurosci 20: 1260–1271. Sieghart W (2006) Structure, pharmacology, and function of GABAA receptor subtypes. Adv Pharmacol (San Diego, Calif) 54:231–263. Unekawa M, Tomita Y, Toriumi H, Suzuki N (2012) Suppressive effect of chronic peroral topiramate on potassium-induced cortical spreading depression in rats. Cephalalgia 32:518–527.
144
M. Wang et al. / Neuroscience 298 (2015) 137–144
Wang M, Chazot PL, Ali S, Duckett SF, Obrenovitch TP (2012) Effects of NMDA receptor antagonists with different subtype selectivities on retinal spreading depression. Br J Pharmacol 165:235–244.
Wiedemann M, Lyhs B, Bartels JP, Sieber M (2012) The pharmacological control of neuronal excitability in the retinal spreading depression model of migraine. Curr Med Chem 19:298–302.
(Accepted 8 April 2015) (Available online 18 April 2015)
GABAA RECEPTOR a2 SUBTYPE ACTIVATION SUPPRESSES RETINAL SPREADING DEPRESSION M. WANG, a,b* Y. LI a AND Y. LIN c
and retina. Cortical SD is generally regarded as the underlying mechanisms of migraine (Lauritzen, 1994, 2001; Ayata, 2010; Bhaskar et al., 2013; Karatas et al., 2013) and it was evidenced that cortical SD wave propagation coincides with the visual scotoma progression in migraine patients with aura (Hadjikhani et al., 2001). Further, chronic daily administration of migraine prophylactic drugs dose-dependently suppressed the frequency of cortical SD (Ayata et al., 2006) and cortical SD may lead to migraine headache involving the activation of a gap junction protein, PANX1 (Karatas et al., 2013). Inhibition of cortical SD could therefore form a preventative strategy against migraine. Evidence showed that topiramate that has function to positively modulate the inhibitory c-aminobutyric acid type A (GABAA) receptors (Kawasaki et al., 1998; Braga et al., 2009) elevates cortical SD threshold (Green et al., 2013) and reduces cortical SD frequency and propagation (Unekawa et al., 2012). The important function of GABAA receptor in SD was supported by the fact that GABAA receptor inhibition by bicuculline prevented the reduction of cortical SD amplitudes by tumor necrosis factor (Richter et al., 2014). Furthermore, topiramate was reported to relieve migraine headache (Braga et al., 2009) and inflammatory or neuropathic pain (Munro et al., 2009, 2013). The fact that the potentiated GABAA receptor current modulates neuronal instability during cortical SD that is associated with migraine, suggests GABAA receptor as a promising target for prophylactic treatment of migraine. GABAA receptor is a pentameric ligand-gated ion channel composed of a1–6, b1–3, c1–3, q1–3, e, p, d or h subtypes while the most common combination is two a, two b and two c subtypes (Hevers and Luddens, 1998; Sieghart, 2006). Variations in the gene expression of different GABAA receptor subtype isoforms were found in migraine patients, suggesting that specific subtypes of the receptor may play a key role in migraine pathology (Plummer et al., 2011). Furthermore, GABAA receptor function related to neuropathic pain, anxiety and epilepsy was reported to involve a subtypes and drugs targeting some of these receptor subtypes have been developed (Griebel et al., 2003; Atack et al., 2006; Mirza et al., 2008; Munro et al., 2008). At this point, whether a subtypes of GABAA receptor activation contribute to suppression of SD remains unknown. Dissecting out how GABAA receptor a subtypes that do not work differ mechanistically from those that do will provide avenues through which one can develop new
a
Centre for Neuroscience, Xi’an Jiaotong-Liverpool University (XJTLU), Suzhou 215123, China b
Department of Biological Sciences, XJTLU, Suzhou 215123, China
c
Department of Applied Chemistry, XJTLU, Suzhou 215123, China
Abstract—Cortical spreading depression (SD) is a transient propagating neuronal excitation followed by depression, which is generally accepted as the underlying cause of migraine. The inhibitory c-aminobutyric acid type A (GABAA) receptor activation not only reduces cortical SD frequency and propagation, but also relieves migraine headache. This study aims to determine the role of major a subtypes of GABAA receptor in mediating SD genesis and propagation using an efficient in vitro chick retinal model. We firstly demonstrated that abundant a2, and to a lesser extent, a5 of GABAA receptor expression in the chick retina, enabled the tissue useful for studying GABAA receptor pharmacology and SD. Marked suppression of SD by SL651498 and TPA023 was observed at 10 lmol L1 and 50 lmol L1, respectively, suggesting a critical role of GABAA receptor a subtypes, in particular a2, in modulating retinal SD elicitation and propagation. The negative data on NS11394 at 3 lmol L1 on SD and the little positive selectivity of TPA023 for a5 did not support that a5 subtype is involved in SD genesis and propagation. Our data provide strong evidence that a2, but not a5 is involved in the early stage of migraine, indicating that a2 subtype is a possible drug target related to migraine with aura. Ó 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Key words: GABAA receptor, a2, TPA023, migraine, cortical spreading depression, chick retina.
INTRODUCTION Spreading depression (SD) is a transient neuronal excitation followed by depression that can propagate slowly across the cerebral cortex, sub-cortical regions *Correspondence to: M. Wang, SA451, Department of Biological Sciences, Xi’an Jiaotong-Liverpool University, 111 Ren Ai Road, Suzhou 215123, China. Tel: +86-512-8816-1662. E-mail addresses: [email protected] (M. Wang), yanli. [email protected] (Y. Li), [email protected] (Y. Lin). Abbreviations: AOI, area of interest; cDNA, complementary deoxyribonucleic acid; DMSO, dimethyl sulfoxide; GABAA, c-aminobutyric acid type A; RNA, ribonucleic acid; RT-PCR, real-time polymerase chain reaction; SD, spreading depression; TBST, TrisBuffered Saline with Tween-20. http://dx.doi.org/10.1016/j.neuroscience.2015.04.016 0306-4522/Ó 2015 IBRO. Published by Elsevier Ltd. All rights reserved. 137
138
M. Wang et al. / Neuroscience 298 (2015) 137–144
treatments to treat patients with migraine. The primary aim of the present study was to identify the role of major a subtypes: a2-, a3- and a5-containing GABAA receptors in SD, by investigating the effects of a subtype-selective and positive modulators in an effective in vitro chick retinal model (Wang et al., 2012). To this end, three drugs with a specific subtype selectivity were chosen: (i) SL651498, a selective agonist at a2/a3 subtypes of GABAA receptors and a partial agonist at a1and a5-containing GABAA receptor subtypes (Sans et al., 2000; Griebel et al., 2003; de Haas et al., 2009). (ii) TPA023, a novel a2/a3-selective containing GABAA receptor agonist (Atack et al., 2006; Munro et al., 2009); and (iii) NS11394 (a positive a5/a3 preferring GABAA receptor allosteric modulator with a notably higher a5and a3-containing GABAA receptor efficacy (Mirza et al., 2008). Expression of corresponding GABAA receptor subtypes in the chick retina was also thoroughly confirmed and the model was also validated with topiramate.
EXPERIMENTAL PROCEDURES All animals were housed in an animal unit of Soochow University with food and water available ad libitum. Male Hyline Brown chicks (n = 37, purchased at 1-day old, Wuxi poultry Ltd, Jiangsu, China) were housed for at least 1 week before use (aged 8–28 days). Adult, male Sprague–Dawley rats (n = 3, Shanghai SLAC Laboratory Animal Corporation Ltd, China) were housed to 300–400 g. All animal procedures were approved by the Ethics Review Panels of Xi’an Jiaotong-Liverpool University (XJTLU) and Soochow University and performed in accordance with the relevant national guidelines. Real-time polymerase chain reaction (RT-PCR) RT-PCR was performed to detect a2, a3, a5 messenger ribonucleic acid (mRNA) transcripts using chick genespecific primers together with SYBR Green (TaKaRa Biotechnology Co. Ltd., Dalian, China). The primer sequences of a2, a3 and a5 are shown in Table 1. Following rapid dissection, vitreous was taken away, chick retina peeled away from the eye cup and immediately frozen in liquid nitrogen, stored at 80 °C until further use. Chick retina was homogenized and total RNA was extracted using UNIQ-10 column trizol total RNA isolation kit (SK1321, Sangon Biotech, Shanghai, China). Complementary deoxyribonucleic
acids (cDNA) were prepared using AMV First Strand cDNA Synthesis Kit (SK2445, Sangon Biotech, Shanghai, China). The resulting cDNA samples (n = 3) were analyzed and quantitative PCR was performed using a RT-PCR Detection System (LightCycler480, Roche Applied Science, Indianapolis, IN, USA) following the manufacturer’s instruction. Threshold cycle was automatically calculated by the instrument. All mRNA expression data were expressed as a normalized target, b-actin, ratio in experimental samples.
Western blot Western blot was used to examine whether GABAA receptor a2, a3, a5 proteins are expressed in chick retina. Membrane protein was extracted from the homogenized chick retina using membrane protein extraction kit (Beyotime Institute of Biotechnology, Shanghai, China) by following the manufacturer’s instruction with minor modifications. Protein samples (200 lg) were separated by 10% sodium dodecyl sulfate–polyacrylamide loading buffer (NuPAGEÒ LDS Sample Buffer 4X, Invitrogen, Carlsbad, CA, USA), transferred onto nitrocellulose membranes. Non-specific binding was blocked with 5% milk in Tris-Buffered Saline with Tween-20 (TBST, 20 mM Tris, 150 mM NaCl, 0.1% Tween-20, pH 7.6). The membranes were then exposed to rabbit polyclonal anti-GABAA receptor a2 (ab72445), a3 (ab72446), a5 (ab83003) antibodies (Abcam, Cambridge, UK) respectively and incubated overnight at 4 °C. Once excess primary antibodies were washed by TBST, membranes were incubated with goat anti-rabbit horseradish peroxidase-labeled secondary antibody (Sangon Biotech, Shanghai, China). Protein bands were detected by incubating the membrane with Western Bright enhanced chemiluminescence working solution (Advansta, Menlo Park, CA, USA) and using Kodak medical X-ray film (Kodak XBT-1, Carestream, Xiamen, China). The film was scanned and analyzed with Bio-rad Gel Doc XR+ with Image Lab 2.0 Software (BIO-RAD, Shanghai, China). The same procedure was applied to rat cortex samples and results were used as positive controls. Both rat cortex and retinal samples were run in the same gel for comparison. Detection of membrane NR2A using rabbit polyclonal anti-NR2A receptor (ab106957, Abcam) was also analyzed as positive controls and the 2nd antibody only was used as a negative control.
Table 1. Summary of specific primer sequences for real-time PCR GABAAR gene
NCBI ref. (Gallus gallus)
Primer sequence (50 –30 )
b-Actin
L08165.1 (Gene bank)
a2
XM_001233849.1
a3
XM_420268.2
a5
XM_416880.3
F: AGTGTCTTTTTGTATCTTCCGCC R: CCACATACTGGCACTTTACTCCTA F: CAGAACCCAACAAGGCAAAA R: GCCAAGTAAGACAGGCTCCC F: TCTGTCGCTTTCTCCTGTCTTT R: TTCCCAACTCTACTCTTACTACTTCTG F: CATCAGTACCAGTACAGGCGAATA R: TGTCACTCCAAAGACAGTCCG
139
M. Wang et al. / Neuroscience 298 (2015) 137–144
retinal SD. These series were: (i) Ringer’s solution (control, n = 6); (ii) topiramate (Sigma, St. Louis, Missouri, USA, n = 6). This drug was applied in order to validate whether retinal SD was suitable for GABAA receptor pharmacology as topiramate has known antiCSD effect (Braga et al., 2009; Green et al., 2013); (iii) dimethyl sulfoxide (DMSO) vehicle group (diluted in Ringer’s solution, 0.01%, 0.03%, 0.1%, n = 6); and three drug groups (each diluted in 0.01%, 0.03%, 0.1% DMSO): (iv) SL651498 (Axon, Groningen, Netherlands, n = 6); (v) TPA023 (n = 7); (vi) NS11394 (Axon, Groningen, Netherlands, n = 6). The concentration range of each drug to be tested was carefully selected on the basis of their GABAA receptor subtype selectivity reported in the literature (Atack et al., 2006; Mirza et al., 2008; Munro et al., 2008; de Haas et al., 2009; Unekawa et al., 2012). A detailed summary on affinity and selectivity of each drug applied under study is summarized in Table 2. For each group tested, ten SDs in total were elicited in each experiment, with two separate SDs for each of the different and consecutive tests: (i) initial Ringer’s control; (ii) low concentration of drug or vehicle; (iii) medium concentration of drug or vehicle; (iv) high concentration of drug or vehicle; and (v) post-treatment with Ringer’s control (i.e. drug removal). A recovery time of 20 min was applied between each two SD elicitation. For each test sequence (i.e. elicitation of two SD), the perfusion medium was changed immediately after the end of the 2nd, 4th, 6th and 8th SD recording when required, such that the preparation was adequately perfused with the proper drug or Ringer’s medium for the subsequent test.
Chick retinal SD using intrinsic optical imaging Retinal SD was induced as previously described (Farkas et al., 2008; Wang et al., 2012). Briefly, chicks were killed by cervical dislocation; posterior eyecup with retina attached was submerged in a perfusion medium in a tissue chamber. Unless otherwise stated, the chamber was perfused with Ringer’s solution (mmol L1 concentrations: 100 NaCl, 6 KCl, 1 MgSO4, 30 NaHCO3, 1 NaH2PO3, 1 CaCl2 and 20 glucose; bubbled with 95% O2 and 5% CO2; pH 7.4) at the perfusion rate of 0.5 ml min1 at 32 °C. The tissue was stabilized for at least 30 min before elicitation of the first SD. Ten repeated SDs were induced at the edge of the eyecup by ejection of 1 ll of 0.1 mol L1 KCl with 20min interval for tissue recovery. The retina preparation was illuminated for 25 milli-seconds (ms) every one second with 1-Hz frequency using a high-power LED spotlight (625 nm peak wavelength, SLS-0307-A, Mightex, Pleasanton, CA, USA) and intrinsic optical signal of the tissue under interest was simultaneously recorded with a monochrome camera (QIC-F-M-12, Media Cybernetics, Marlow, UK) used at maximal spatial resolution. Image sequences were recorded at one frame per second over a 3-min period. Camera exposure and illumination were synchronized using the same external trigger. Image acquisition, storage and analysis were through Image Pro Plus software (IPP7; Media Cybernetics, UK). Synthesis of TPA023 Starting from 3,6-dichloropyridazine and 1,2,4-triazole, TPA023 was synthesized in five steps according to the literature (Carling et al., 2005). The final product was characterized by nuclear magnetic resonance NMR (Bruker, Avance III 400 MHz) and mass spectrometer (Brucker, MicroTOF-Q). 1H NMR: 7.982 (s, ArH); 7.926 (s, ArH); 7.873 (dt, ArH); 7.534–7.590 (m, ArH); 7.350 (dt, ArH); 7.276 (t, ArH); 5.522 (s, 2H, OCH2); 4.146 (q, 2H, CH2CH3); 1.422 (t, 3H, CH2CH3); 1.400 (s, 9H, C(CH3)3). Mass calculated for C20H22FN7O 395.18, found 396 (ESI, [M+H]+). Both analyses approve the correct structure of TPA023.
Data and statistical analysis An area of interest (AOI) parallel to the SD wave front was delineated manually for each image sequence. For each picture within the sequence, the gray levels of the pixels constituting the AOI were averaged as intrinsic optical signal changes in this value were then plotted against time as an indication to characterize SD (Wang et al., 2012). As reported earlier (Wang et al., 2012), for each SD wave, the area under the curve (AUC, Gray levels second) of the transient cellular depolarization associated with propagating SD was calculated and used as an index of its magnitude. In each image sequence related to a given SD, propagation rate of the wave was also calculated as previously described (Wang et al., 2012) to reflect tissue excitability.
EXPERIMENTAL DESIGN FOR DRUG TESTING Six series of experiments were carried out to examine the effects of different drugs on GABAA receptor subtype in
Table 2. Summary of drugs showing their binding affinity and selectivity for GABAA receptor a subtypes from the literature Drug Topiramate SL651498
TPA023
NS11394
GABAA receptor selectivity GABAA receptor positive allosteric modulator (PAM) PAM: a2, a3 selective
PAM: a2, a3 selective; Antagonist: a1, a5 selective PAM: a3, a5 selective
Affinity and efficacy
Reference 1
50, 100, 200, 600 mg kg , peroral, rat (plasma concentration: 50– 200 lmol L1) in CSD model Affinity (nmol L1, recombinant rat GABAA receptor in HEK293 cell): a1 (17) > a2 (73) > a3 (80) > a5 (215); efficacy (%, 1 lmol L1 of the drug): a2 (115) > a3 (85) > a5 (50) > a1 (45) Affinity (nmol L1, recombinant human GABAA receptor in mouse L cells): a3 (0.19) > a1 (0.27) > a2 (0.31) > a5 (0.41); efficacy (%, 1 lmol L1 drug): a3 (33) > a2 (12) > a5 (6) > a1 (1) Affinity (nmol L1, recombinant human GABAA receptor in HEK293 cell): a5 (0.1) > a1 (0.4) > a3 (0.5) > a2 (0.8); efficacy (%, 0.5 lmol L1 drug): a3 (78) > a5 (52) > a2 (26) a1 (7.8)
Unekawa et al. (2012) de Haas et al. (2009) Atack et al. (2006)
Mirza et al. (2008), Munro et al. (2008)
140
M. Wang et al. / Neuroscience 298 (2015) 137–144
As preliminary study showed that all drugs tested reached a maximum effect with 20-min incubation and there was no difference of the drug response on the two consecutive SDs at one condition, the calculated values within each different test were averaged and all corresponding data were given as mean ± SD in percentage of their respective baselines (averaged value for the first two K+ stimuli). Kruskal–Wallis oneway analysis and paired t-test were used for comparison of each parameter between the drug and respective control group and between the last two tests within each group against the averaged value for the last two K+ stimuli (i.e. effect of drug removal), respectively.
RESULTS GABAA receptor a2, a3 and a5 mRNA expression in chick retina The RT-PCR results revealed that normalized a2, a3 and a5 mRNAs of GABAA receptor were detected in chick retina as shown in Fig. 1 (n = 3). Among them, a2 mRNA had the highest expression, followed by a3, while a5 had the minimum expression (Fig. 1). GABAA receptor a2 and a5 protein expression in chick retina As reported earlier (Pirker et al., 2000), a2, a3 and a5 subtypes of GABAA receptor were detected with specific intense bands in the rat cortex (Fig. 2, n = 3). In chick retina, a2 (51 kDa), and to a lesser level, a5 (52 kDa) subtypes of GABAA receptor was expressed in chick retina; while a3 was not detected (Fig. 2, lane 2, n = 3).
Suppression of SD in chick retina by topiramate To validate that our retinal SD was suitable for a subtypecontaining GABAA receptor pharmacology, we examined the effect of topiramate, a a subtype-selective GABAA receptor-positive modulator (Kawasaki et al., 1998) that was previously reported to elevate the cortical SD threshold (Green et al., 2013) and to reduce cortical SD frequency and propagation in rats (Unekawa et al., 2012). In the Ringer’s group, both the magnitude and propagation rate were not altered over 10 repeated SDs. In agreement with that reported previously in rats (Unekawa et al., 2012), topiramate significantly reduced the propagation rate of retinal SD in a concentration-dependent manner (0.03, 0.1 and 0.3 mmol L1) comparing with its respective Ringer’s control. At the highest concentration tested (0.3 mmol L1), the propagation rate was reduced to 71.3% of its initial value (average data of 7th and 8th SD) (Fig. 3C, n = 6). Topiramate also gradually reduced the magnitude of SD, although this reduction did not reach significance at any concentration of the drug applied comparing with its respective Ringer’s control (Fig. 3A, n = 6), possibly because of a large variability of the data within groups. The magnitude and propagation rate recovered to 84.3% and 86.7%, respectively, after topiramate removal. These results are in accordance with the inhibitory effects of topiramate on CSD propagation velocity in vivo (Unekawa et al., 2012) and its application for chronic migraine medication (Hoffmann et al., 2014). Taking into account the expression of a2 and a5 proteins in chick retina reported herein (Fig. 2), the retinal SD model turned out to be an efficient in vitro pharmacology tool for studying functions of specific a subtype-containing GABAA receptors in addition to other classification of drug target (Wang et al., 2012; Wiedemann et al., 2012). Suppression of SD by SL651498 and TPA023, but not NS11394
Fig. 1. Real-time PCR analysis of GABAA receptor a2, a3, a5 subtypes in the chick retina. Normalized mRNA expression is shown as mean ± SD (reference to b-actin, 2DCT, n = 3 in each group).
In the vehicle (DMSO) group, no significant changes of the magnitude and propagation rate of retinal SD were detected when compared with relative initial controls throughout the experiment. The magnitude and propagation rate remained at 90.8% and 99.9% at the highest concentration of DMSO (0.1%), respectively (Fig. 3B, D, n = 6). Both SL651498 and TPA023 were found to suppress the magnitude (Fig. 3B, n = 6) and propagation rate (Fig. 3D, n = 7) of SD in a concentration-dependent manner. At the maximum concentration tested (10 lmol L1), SL651498 reduced the magnitude and propagation rate to 68.7% and 89.2% of its initial value respectively (average data of
Fig. 2. Immunoblotting detection of GABAA receptor a2 (right, lane 1), a3 (right, lane 2), and a5 (right, lane 3) subunits in the chick retina and detection of membrane protein from the adult rat cortex was analyzed as positive controls as shown in the left of each lane. Membrane NR2A (lane 4) detection was also used as positive controls.
M. Wang et al. / Neuroscience 298 (2015) 137–144
141
Fig. 3. Comparison of the effects of SL651498, TPA023 and NS11394 on the magnitude (area under the curve, A and B) and propagation rate (C and D) of SD induced by K+ in the chick retina. One control group (Ringer’s solution, n = 6); one vehicle group (DMSO, n = 6) and four drug treatment groups (Topiramate, n = 6; SL651498, n = 6; TPA023, n = 7; NS11394, n = 6) were considered. Ten SDs in total were elicited and five successive perfusion media tested in each experiment: initial Ringer’s solution, four different drug concentrations and Ringer’s solution (i.e. after drug removal). Data (mean ± SD) are plotted as percentage of their initial levels. Kruskal–Wallis test, with subsequent Dunn’s test for significance between specific independent data sets. ⁄p < 0.05, ⁄⁄p < 0.01 vs Ringer’s control; #p < 0.05, ##p < 0.01 vs DMSO vehicle control.
7th and 8th SD). Similarly, TPA023 also suppressed the magnitude and propagation rate of SD to 66.8% and 86.4% at the highest concentration applied (50 lmol L1), respectively (Fig. 3B, D, n = 7). The inhibitory effect of SL651498 and TPA023 on the magnitude and propagation rate of SD was persistent after the drug removal (Fig. 3B, D). On the contrary, NS11394 did not alter both magnitude and propagation rate of SD wave at all concentrations tested (up to 3 lmol L1, Fig. 3B, D).
DISCUSSION AND CONCLUSION GABAA receptor a2, a3 and a5 expression in chick retina Our results demonstrated abundant gene expression of
a2, to a lesser extent, a3, followed by a5 in the chick retina (Fig. 1). The findings also revealed that GABAA
a2 and a5 proteins were expressed in the chick retina (Fig. 1). This data point that a2- and a5-containing GABAA receptors may have important functions in the chick retina. Unlike a3 gene that was expressed in the
chick retina that was in line with those previously reported in the tissue (Ring et al., 2010), a3 protein was not observed (Fig. 2). The lack of a3 protein in the tissue is probably due to a relatively low cross-reactivity of the primary antibody applied (84% homology) between rat and chick (Table 3). Therefore, the existence of a3 protein in the chick retina cannot be excluded. Further investigation using specific antibodies raised against chicks is required. All together, these data complement previous findings that GABAA a1 protein was expressed in the retina of chicks (Cheng et al., 2012, 2013). The important feature of GABAA a subtype expression in the chick retina, together with the N-methyl-D-aspartate receptor subtype expression reported previously (Wang et al., 2012), enables chick retina a useful tissue for studying functions of specific excitatory (Wang et al., 2012) and inhibitory neurotransmitter receptor subtypes and extrapolating pharmacological data obtained in the retina to the cortex. Using this tissue, we then tested drugs selectively modulating GABAA receptor a subtypes in SD, the findings of which is discussed below.
142
M. Wang et al. / Neuroscience 298 (2015) 137–144
Table 3. Homology blast comparison of GABAA receptor a2, a3, a5 subtypes between rat and chick and cross reactivity of primary antibodies applied under study GABAA a subtype
Catalog number (Abcam)
NCBI RefSeq.
Homology (%)
Antibody cross activity (Rabbit polyclonal)
a2
ab72445
94
Mouse, Rat
a3
ab72446
84
Mouse, Rat
a5
ab83003
Rat: NP_001129251.1 Chick: XP_001233850.1 Rat: NP_058765.3 Chick: XP_420268.2 Rat: NP_058991.1 Chick: XP_416880.2
88
Human; Mouse, Rat, Chick, Cow, Dog (Predicted)
Activation GABAA receptor a subtypes suppresses retinal SD SL651498 is a selective agonist at a2/a3 subtypes of GABAA receptors, which also has partial a1 and a5 efficacy (Griebel et al., 2003; de Haas et al., 2009). The marked suppression of SD magnitude and propagation rate in the chick retina (Fig. 3B, D) may be attributed to a functional role of all a2/a5/a1/a3 subtypes of GABAA receptor in mediating retinal SD for the following reasons. Firstly, chick retina contains abundant expression of a2, to a lesser extent, a5 proteins (Fig. 2), in addition to a1 (Cheng et al., 2012, 2013). Secondly, although detectable a3 proteins were not seen in the chick retina (Fig. 2), the role of a3 subtypes in retinal SD under SL651498 application cannot be ruled out without further investigation. Thirdly, at the concentration (10 lmol L1) applied, SL651498 should exhibit efficacy to all a2/a5/a1/a3 subtypes as it was reported that the drug at 1 lmol L1, has efficacy (in%) in the order of a2 (115) > a3 (85) > a5 (50) > a1 (45) in HEK293 cells (de Haas et al., 2009). Taken together, these data suggest a key role of GABAA receptor major a subtypes in modulating retinal SD elicitation and propagation. Suppression of retinal SD is attributed to GABAA receptor a2 subtype The critical role of a subtype in mediating retinal SD was confirmed by TPA023 as the drug also significantly suppressed the magnitude and propagation rate of SD waves in the chick retina at 15 and 50 lmol L1, respectively (Fig. 3B, D). The fact that TPA023 is a2/a3 selective, while has no positive a1 or a5 activity (Munro et al., 2009), suggests a key role of a2 and/or a3 subtypes, but not a1 and a5 in mediating retinal SD. However, as discussed above, a possible involvement of a3 subtypes in SD needs further confirmation in tissue containing a3 proteins. This finding indicates that TPA023 may be a promising drug for the preventive treatment of migraine in addition to functioning against inflammatory and neuropathic pain (Munro et al., 2011, 2013). It is interesting to note that the magnitude of SD remained low (67.4%) after the removal of TPA023 and SL651498, indicating possible long-term efficacy against CSD (Fig. 3B).
NS11394 exhibits the highest efficacy to a5 (Munro et al., 2008) and a5 is present in chick retina (Figs. 1 and 2); therefore, the lack of inhibitory effect on SD by the drug at the concentration applied does not support that a5 is involved in mediating retinal SD elicitation and propagation. Furthermore, as NS11394 has relatively low a2 efficacy (26% at 0.5 lmol L1 in HEK293 cells) (Munro et al., 2008), the lack of retinal SD suppression (Fig. 3) does not suggest a lack of role of a2 in mediating retinal SD. On the contrary, the important function of a2 in retinal SD was demonstrated by the marked suppression of SD under TPA023 and SL651498 application discussed above. It is noteworthy to mention that the role of a1 subtype in retinal SD is not conclusive under study. As a1 protein is abundant in the chick retina (Cheng et al., 2012, 2013) and NS11394 has little a1 efficacy, it would be interesting to investigate whether a1 may be involved in mediating cortical SD using subtype-selective partial agonist modulator or a1-mutated rodent in the future.
CONCLUSIONS Findings from this study demonstrated that GABAA receptor a2, a5 are expressed in the chick retina and revealed that the activation of a subtype-containing GABAA receptors, in particular a2, suppresses retinal SD, suggesting a key role of a2 in the early stage of migraine. The negative data on NS11394 do not support an involvement of a5 in SD genesis and propagation. Selectively targeting GABAA receptor a subtype may lead to drugs with increased clinical specificity, which would present a promising alternative to agents currently used for prophylactic treatment of migraine without the major side effects seen with classical GABAA receptor benzodiazepine binding site. This finding suggests that a subtype, at least a2, could be a possible drug target related to migraine with aura while with lower neuronal toxic effects. Further studies are necessary to confirm the role of a3 protein expression in SD in chick retina. In addition, monitoring tissue excitability (Ayata et al., 2006; Unekawa et al., 2012; Green et al., 2013) under a2-containing GABAA receptor inhibition and establish TPA023 is effective against cortical SD in vivo will help better understand the role of a2containing GABAA receptor in migraine prophylaxis.
Activation of a5 subtype receptor may not contribute to retinal SD suppression Unlike SL651498 and TPA023, NS11394 did not alter the magnitude and propagation rate of retinal SD (Fig. 3B, D).
CONFLICT OF INTEREST The authors declare there is no conflict of interest.
M. Wang et al. / Neuroscience 298 (2015) 137–144 Acknowledgments—We greatly thank Chengpei Ni and Qiu Meng at XJTLU for their assistance on making TPA023 and Liji Huang for her technical support on TPA023 pharmacology. This work was funded by WangWenLi Education Charitable Foundation (Ref: RD006), China.
REFERENCES Atack JR, Wafford KA, Tye SJ, Cook SM, Sohal B, Pike A, Sur C, Melillo D, Bristow L, Bromidge F, Ragan I, Kerby J, Street L, Carling R, Castro JL, Whiting P, Dawson GR, McKernan RM (2006) TPA023 [7-(1,1-dimethylethyl)-6-(2-ethyl-2H-1,2,4-triazol3-ylmethoxy)-3-(2-fluorophenyl)-1,2,4-triazolo[4,3-b]pyridazine], an agonist selective for alpha2- and alpha3-containing GABAA receptors, is a nonsedating anxiolytic in rodents and primates. J Pharmacol Exp Ther 316:410–422. Ayata C (2010) Cortical spreading depression triggers migraine attack: pro. Headache 50:725–730. Ayata C, Jin H, Kudo C, Dalkara T, Moskowitz MA (2006) Suppression of cortical spreading depression in migraine prophylaxis. Ann Neurol 59:652–661. Bhaskar S, Saeidi K, Borhani P, Amiri H (2013) Recent progress in migraine pathophysiology: role of cortical spreading depression and magnetic resonance imaging. Eur J Neurosci 38:3540–3551. Braga MF, Aroniadou-Anderjaska V, Li H, Rogawski MA (2009) Topiramate reduces excitability in the basolateral amygdala by selectively inhibiting GluK1 (GluR5) kainate receptors on interneurons and positively modulating GABAA receptors on principal neurons. J Pharmacol Exp Ther 330:558–566. Carling RW, Madin A, Guiblin A, Russell MG, Moore KW, Mitchinson A, Sohal B, Pike A, Cook SM, Ragan IC, McKernan RM, Quirk K, Ferris P, Marshall G, Thompson SA, Wafford KA, Dawson GR, Atack JR, Harrison T, Castro JL, Street LJ (2005) 7-(1,1Dimethylethyl)-6-(2-ethyl-2H-1,2,4-triazol-3-ylmethoxy)-3-(2fluorophenyl)-1,2,4-triazolo[4,3-b]pyridazine: a functionally selective gamma-aminobutyric acid(A) (GABA(A)) alpha2/ alpha3-subtype selective agonist that exhibits potent anxiolytic activity but is not sedating in animal models. J Med Chem 48:7089–7092. Cheng ZY, Chebib M, Schmid KL (2012) Identification of GABA receptors in chick cornea. Mol Vis 18:1107–1114. Cheng ZY, Wang XP, Schmid KL, Liu L (2013) Identification of GABA receptors in chick retinal pigment epithelium. Neurosci Lett 539:43–47. de Haas SL, Franson KL, Schmitt JA, Cohen AF, Fau JB, Dubruc C, van Gerven JM (2009) The pharmacokinetic and pharmacodynamic effects of SL65.1498, a GABA-A alpha2,3 selective agonist, in comparison with lorazepam in healthy volunteers. J Psychopharmacol (Oxford, England) 23:625–632. Farkas E, Pratt R, Sengpiel F, Obrenovitch TP (2008) Direct, live imaging of cortical spreading depression and anoxic depolarisation using a fluorescent, voltage-sensitive dye. J Cereb Blood Flow Metab 28:251–262. Green AL, Gu P, De Felice M, Dodick D, Ossipov MH, Porreca F (2013) Increased susceptibility to cortical spreading depression in an animal model of medication-overuse headache. Cephalalgia 34:594–604. Griebel G, Perrault G, Simiand J, Cohen C, Granger P, Depoortere H, Francon D, Avenet P, Schoemaker H, Evanno Y, Sevrin M, George P, Scatton B (2003) SL651498, a GABAA receptor agonist with subtype-selective efficacy, as a potential treatment for generalized anxiety disorder and muscle spasms. CNS Drug Rev 9:3–20. Hadjikhani N, Sanchez Del Rio M, Wu O, Schwartz D, Bakker D, Fischl B, Kwong KK, Cutrer FM, Rosen BR, Tootell RB, Sorensen AG, Moskowitz MA (2001) Mechanisms of migraine aura revealed
143
by functional MRI in human visual cortex. Proc Natl Acad Sci USA 98:4687–4692. Hevers W, Luddens H (1998) The diversity of GABAA receptors. Pharmacological and electrophysiological properties of GABAA channel subtypes. Mol Neurobiol 18:35–86. Hoffmann J, Akerman S, Goadsby PJ (2014) Efficacy and mechanism of anticonvulsant drugs in migraine. Expert Rev Clin Pharmacol 7:191–201. Karatas H, Erdener SE, Gursoy-Ozdemir Y, Lule S, Eren-Kocak E, Sen ZD, Dalkara T (2013) Spreading depression triggers headache by activating neuronal Panx1 channels. Science (New York, NY) 339:1092–1095. Kawasaki H, Tancredi V, D’Arcangelo G, Avoli M (1998) Multiple actions of the novel anticonvulsant drug topiramate in the rat subiculum in vitro. Brain Res 807:125–134. Lauritzen M (1994) Pathophysiology of the migraine aura. The spreading depression theory. Brain 117(Pt 1):199–210. Lauritzen M (2001) Cortical spreading depression in migraine. Cephalalgia 21:757–760. Mirza NR, Larsen JS, Mathiasen C, Jacobsen TA, Munro G, Erichsen HK, Nielsen AN, Troelsen KB, Nielsen EO, Ahring PK (2008) NS11394 [30 -[5-(1-hydroxy-1-methyl-ethyl)-benzoimidazol-1-yl]biphenyl-2-carbonitrile], a unique subtype-selective GABAA receptor positive allosteric modulator: in vitro actions, pharmacokinetic properties and in vivo anxiolytic efficacy. J Pharmacol Exp Ther 327:954–968. Munro G, Lopez-Garcia JA, Rivera-Arconada I, Erichsen HK, Nielsen EO, Larsen JS, Ahring PK, Mirza NR (2008) Comparison of the novel subtype-selective GABAA receptor-positive allosteric modulator NS11394 [30 -[5-(1-hydroxy-1-methyl-ethyl)benzoimidazol-1-yl]-biphenyl-2-carbonitrile] with diazepam, zolpidem, bretazenil, and gaboxadol in rat models of inflammatory and neuropathic pain. J Pharmacol Exp Ther 327:969–981. Munro G, Ahring PK, Mirza NR (2009) Developing analgesics by enhancing spinal inhibition after injury: GABAA receptor subtypes as novel targets. Trends Pharmacol Sci 30:453–459. Munro G, Erichsen HK, Rae MG, Mirza NR (2011) A question of balance – positive versus negative allosteric modulation of GABA(A) receptor subtypes as a driver of analgesic efficacy in rat models of inflammatory and neuropathic pain. Neuropharmacology 61:121–132. Munro G, Hansen RR, Mirza NR (2013) GABA(A) receptor modulation: potential to deliver novel pain medicines? Eur J Pharmacol 716:17–23. Pirker S, Schwarzer C, Wieselthaler A, Sieghart W, Sperk G (2000) GABA(A) receptors: immunocytochemical distribution of 13 subunits in the adult rat brain. Neuroscience 101:815–850. Plummer PN, Colson NJ, Lewohl JM, MacKay RK, Fernandez F, Haupt LM, Griffiths LR (2011) Significant differences in gene expression of GABA receptors in peripheral blood leukocytes of migraineurs. Gene 490:32–36. Richter F, Lutz W, Eitner A, Leuchtweis J, Lehmenkuhler A, Schaible HG (2014) Tumor necrosis factor reduces the amplitude of rat cortical spreading depression in vivo. Ann Neurol 76:43–53. Ring H, Boije H, Daniel C, Ohlson J, Ohman M, Hallbook F (2010) Increased A-to-I RNA editing of the transcript for GABAA receptor subunit alpha3 during chick retinal development. Vis Neurosci 27:149–157. Sans N, Petralia RS, Wang YX, Blahos 2nd J, Hell JW, Wenthold RJ (2000) A developmental change in NMDA receptor-associated proteins at hippocampal synapses. J Neurosci 20: 1260–1271. Sieghart W (2006) Structure, pharmacology, and function of GABAA receptor subtypes. Adv Pharmacol (San Diego, Calif) 54:231–263. Unekawa M, Tomita Y, Toriumi H, Suzuki N (2012) Suppressive effect of chronic peroral topiramate on potassium-induced cortical spreading depression in rats. Cephalalgia 32:518–527.
144
M. Wang et al. / Neuroscience 298 (2015) 137–144
Wang M, Chazot PL, Ali S, Duckett SF, Obrenovitch TP (2012) Effects of NMDA receptor antagonists with different subtype selectivities on retinal spreading depression. Br J Pharmacol 165:235–244.
Wiedemann M, Lyhs B, Bartels JP, Sieber M (2012) The pharmacological control of neuronal excitability in the retinal spreading depression model of migraine. Curr Med Chem 19:298–302.
(Accepted 8 April 2015) (Available online 18 April 2015)
