RESEARCH LETTER
gadA gene locus in Lactobacillus brevis NCL912 and its expression during fed-batch fermentation Haixing Li, Wenming Li, Xiaohua Liu & Yusheng Cao Sino-German Joint Research Institute, Nanchang University, Nanchang, China
Correspondence: Yusheng Cao, SinoGerman Joint Research Institute, Nanchang University, Nanchang 330047, China. Tel.: +86 13907093454; fax: +86 791 88333708; e-mail: [email protected] Received 23 September 2013; accepted 16 October 2013. Final version published online 6 November 2013. DOI: 10.1111/1574-6968.12301 Editor: Wolfgang Kneifel
MICROBIOLOGY LETTERS
Keywords cloning and expression; gadA locus genes; gamma-aminobutyric acid; Lactobacillus brevis NCL912.
Abstract Normally, Lactobacillus brevis has two glutamate decarboxylase (GAD) genes; gadA and gadB. Using PCR, we cloned the gadA gene from L. brevis strain NCL912, a high yield strain for the production of gamma-aminobutyric acid (GABA). However, despite using 61 different primer pairs, including degenerate primers from conserved regions, we were unable to use PCR to clone gadB from the NCL912 strain. Furthermore, we could not clone it by genomic walking over 3000 bp downstream of the aldo-keto reductase gene, a single-copy gene that is located 1003 bp upstream of gadB in L. brevis ATCC367. Altogether, the data suggest that L. brevis NCL912 does not contain a gadB gene. By genomic walking, we cloned regions upstream and downstream of the gadA gene to obtain a 4615 bp DNA fragment that included the complete gadA locus. The locus contained the GAD gene (gadA) and the glutamate:GABA antiporter gene (gadC), which appear to be transcribed in an operon (gadCA), and a transcriptional regulator (gadR) of gadCA. During whole fed-batch fermentation, the expression of gadR, gadC and gadA was synchronized and correlated well with GABA production. The gadA locus we cloned from NCL912 has reduced homology compared with gadA loci of other L. brevis strains, and these differences might explain the ability of NCL912 to produce higher levels of GABA in culture.
Introduction Gamma-aminobutyric acid (GABA) is a major inhibitory neurotransmitter in the mammalian central nervous system (Jakobs et al., 1993; Ueno, 2000) and has several well characterized physiological functions (Wong et al., 2003; Hayakawa et al., 2004; Chuang et al., 2011; Al-Wadei et al., 2012). GABA is also a functionally bioactive component in foods and pharmaceuticals. The production of lactic acid bacterial (LAB) GABA has been actively pursued due to its natural characteristics and safety profile (Komatsuzaki et al., 2005; Siragusa et al., 2007; Li & Cao, 2010; Barrett et al., 2012; Ratanaburee et al., 2013). An intracellular glutamate decarboxylase (GAD) system, which is composed of GAD and the glutamate: GABA antiporter, is responsible for the production of GABA. Glutamate is imported into cells by the antiporter, then decarboxylated by intracellular GAD to produce GABA. Subsequently, the GABA is exported from the cells via the antiporter (Sanders et al., 1998; Small & Waterman, ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
1998). In Lactococcus lactis, the GAD encoding gene (gadB) and the glutamate:GABA antiporter encoding gene (gadC) form an operon called gadCB. This operon is positively regulated by the GadR protein (encoded by gadR), which recognizes the presence of glutamate and induces the expression of the gadCB genes (Sanders et al., 1998). Two different GAD encoding genes have been characterized from several L. brevis stains. However, they have often been considered the same gene (mostly referred to as gadB) and therefore frequently have been aligned together and thought to be poorly conserved (Kim et al., 2007; Park & Oh, 2007; Li & Cao, 2010). In fact, each of the genes is highly conserved, but complete data have not been available for an entire L. brevis gad locus up to now. In the genome (CP000416) of L. brevis ATCC367, there are two GAD encoding genes, gadA and gadB, separated by c. 1.7 Mb. gadA is located adjacent to, and downstream of, the glutamate:GABA antiporter gene (gadC). They are collectively referred to as gadCA and, similar to L. lactis, may form an operon. gadR, which lies FEMS Microbiol Lett 349 (2013) 108–116
109
gadA locus and expression in L. brevis NCL912
immediately upstream of gadCA, encodes a transcriptional regulator of gadCA. The gadB gene is located separately from the other gad genes and it is not known whether it is transcriptionally regulated by GadR. Lactobacillus brevis NCL912 is a strain isolated from fermented food in our laboratory (Li et al., 2008) that can produce high levels of GABA (102 g L 1 after 48 h) in fed-batch fermentation (Li et al., 2010). Understanding the mechanism for the high GABA yield and the ability of NCL912 to synthesize elevated levels of GABA is very important because this may involve genetically manipulating the NCL912 strain to increase GABA production further. To facilitate our research, this study focused on cloning and analyzing the GAD gene loci from L. brevis NCL912, and the expression of GAD genes during the fed-batch fermentation.
Materials and methods Strains, plasmids, media and cultivation
NCL912, a high-level GABA-producing strain of L. brevis, was isolated from paocai, a Chinese traditional fermented vegetable (Li et al., 2008). The pMD18-T Vector or pMD19-T Simple Vector (TaKaRa, Dalian, China) and Escherichia coli DH5a were used for cloning DNA. The seed medium of strain NCL912 was composed of (g L 1): glucose, 50; soya peptone, 25; MnSO44H2O, 0.01; L-glutamate, 150 mM; and Tween 80, 2 mL L 1; pH 5.0. The GABA fermentation medium was composed of (g L 1): glucose, 35; soya peptone, 25; L-glutamate, 400 mM; MnSO44H2O, 0.01; and Tween 80, 2 mL L 1; pH 5.0. Seed culture preparation and fed-batch fermentation of L. brevis NCL912 were carried out as previously described (Li et al., 2010, 2011) and samples were withdrawn every 12 h for up to 48 h after beginning the fermentation experiment. Escherichia coli DH5a was routinely grown at 37 °C in Luria–Bertani (LB) medium; E. coli DH5a cells containing recombinant DNA plasmids were grown in LB medium supplemented with ampicillin (100 lg mL 1) at 37 °C. Genomic DNA isolation and purification
Genomic DNA was extracted from NCL912 cells and purified by a modification of the method described by Barney et al. (2001). Logarithmic phase cells were harvested from 8 mL of culture by centrifugation at 5000 g for 5 min, rinsed once with TE (Tris/EDTA) buffer, and then resuspended in 1.07 mL of TES buffer [10 mM TrisHCl, 1 mM EDTA, and 0.35 M sucrose (pH 8.0)]. After adding 0.2 mL 50 mg mL 1 of lysozyme, samples were incubated at 37 °C for 3 h, and then 2.6 mL of CTAB FEMS Microbiol Lett 349 (2013) 108–116
buffer [100 mM Tris-HCl, 1.5 M NaCl, 10 mM EDTA, 2% cetyltrimethyl ammonium bromide (CTAB), pH 8.0] and 30 lL 20 mg mL 1 of proteinase K were added. Samples were incubated a further 2 h at 50 °C and the mixture then extracted with 1.95 mL of Tris-saturated phenol (pH 7.8) by vortexing for 2 min. An equal volume of 1.95 mL of chloroform-isoamyl alcohol (24 : 1, v/v) was added, the sample vortexed a further 2 min, and then the phases separated by centrifuging at 5000 g for 5 min. The aqueous phase was removed and extracted one more time with chloroform-isoamyl alcohol (24 : 1, v/v) and then precipitated by adding two volumes of isopropanol and incubating at 4 °C for 10 min. The DNA was pelleted by centrifuging at 10 000 g for 10 min, and rinsed twice with 70% ethanol and once with anhydrous alcohol. After drying, the DNA pellet was dissolved in 200 lL of TE buffer containing 250 lg of RNase A per mL and incubated at 37 °C for 2 h. The DNA was then reprecipitated by adding 300 lL of TE buffer, 50 lL of 3 M sodium acetate (pH 5.2) and two volumes of ethanol and incubated at 20°C for 30 min. The DNA was collected by centrifuging at 15 000 g for 10 min at 4 °C. After rinsing twice with 70% ethanol and once with anhydrous alcohol, the pellet was dried and then resuspended in 600 lL of ddH2O. Total RNA extraction
Total RNA was extracted from NCL912 cells using an RNAprep pure Cell/Bacteria Kit (Tiangen Biotech Co., Ltd, Beijing, China) according to the manufacturer’s instructions. DNAse I was added during the extraction process to remove DNA contamination. Amplification of gadA, gadB and the genes flanking gadB
Eleven (3 9 3 + 2) (Supporting Information, Table S1), 61 (2 9 2 + 3 9 3 + 5 9 5 + 3 9 3 + 2 9 2 + 2 9 3 + 2 9 2) (Table S2), four (2 9 2), four (2 9 2) and six (3 9 2) (Table S3) pairs of primers derived from gadA, gadB, aldo/keto reductase of the diketogulonic reductase gene (akr), a hypothetical protein gene, and the NCAIR mutase (PurE)-related protein gene in L. brevis ATCC367, respectively, were used to amplify the corresponding genes from strain NCL912. The PCR reaction mixture for all primer pairs was 19 PCR buffer containing 1.5–5.0 mM MgCl2, 0.2 mM dNTP, 0.2 lM each primer (or 0.4 lM if the primers were degenerate), 20 ng genomic DNA, and 2.5 U Taq polymerase in a 50-lL reaction volume. The PCR program was 94 °C for 2 min; 30–40 cycles of 94 °C for 30 s, 40–60 °C for 30 s, 72 °C for 0.5–3 min. ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
110
Walking into regions that flanked gadA using single primer PCR
To isolate the full-length gadA and its flanking regions, single primer PCR (SP-PCR) was carried out using annealing control primers (ACP) (Hwang et al., 2003). Each ACP primer was designed as follows: a 36-bp conventional primer which exactly matched the known sequence of the region was first selected, then five continuous nucleotides (22nd to 26th nucleotides, from 5′ end to 3′ end) in the sequence was replaced by five continuous deoxyinosines (dI) to produce an ACP primer with a 21-bp 5′ end region and a 10-bp 3′ end region. For example, five dITPs were used to substitute the five underlined nucleotides in the conventional primer CGTGTTC GTTGGCAATGACTTCCGGCCTTCAACGCT to produce the ACP primer CGTGTTCGTTGGCAATGACTT(dI)5CT TCAACGCT (Table S4). The ACP primer system can improve the specificity of PCR amplification. Here we used each ACP primer simultaneously as a specific and an arbitrary primer (walking primer) for genomic DNA walking. The PCR reaction mixture used for all primers was 19 PCR buffer that contained 1.5–5.0 mM MgCl2, 0.2 mM dNTP, 0.4 lM of ACP primer, and 2.5 U Taq polymerase in a 50-lL reaction volume. The PCR program was three cycles of 94 °C for 30 s, 40–60 °C for 3 min, 72 °C for 2 min, and 40 cycles of 94 °C for 30 s, 68 °C for 3 min. The main DNA band was isolated, cloned and sequenced. Walking of regions upstream of gadA or downstream of akr by thermal asymmetric interlaced PCR (TAIL-PCR)
The regions upstream of gadA or downstream of akr in NCL912 were obtained by TAIL-PCR (Liu & Whittier, 1995). The primers used for this procedure are shown in Table S5. The PCR reaction mixtures and thermal cycling conditions were similar to those described by Liu & Whittier (1995) with some modifications. The PCR reaction mixture (50 lL) was: 1 lL plate DNA, 0.4 mM dNTP, 19 LA PCR buffer II (Mg2+ plus), 2.5 U TaKaRa LA Taq, 12.5 lL of an arbitrary primer, 0.2 lM of a specific primer. The thermal cycling conditions are summarized in Table S6. The main DNA band in each reaction was isolated, cloned and sequenced. DNA purification
PCR products were purified with the Agarose Gel DNA Purification Kit Ver.2.0 (TaKaRa). and ligated into pMDTM18-T Vector or pMDTM19-T Simple Vector. The
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
H. Li et al.
plasmids were transformed into E. coli DH5a cells according to the TaKaRa guidelines and sequenced by Sangon Biotech Co., Ltd (Shanghai, China). Sequence analysis
DNA or protein homology searches against the GenBank were carried out using the BLAST program. Sequence alignments were conducted using the MegAlign program in the LASERGENE software (DM version 3.3.8). qPCR
Real-time fluorescence quantitative PCR was used to analyze the transcription levels of gadA, gadC and gadR in NCL912 during the fed-batch fermentation process. The primers and probes used for qPCR are shown in Table S7. Fluorescent probes were 5′ labeled with 6-carboxyfluorescein (FAM; Generay Biotech Co., Ltd, Shanghai, China). Unless otherwise stated, all the primers and probes were made to a concentration of 10 lM in nuclease-free ddH2O before use. Single-strand cDNA was synthesized from total RNA using the reverse transcription kit (Bio-serve Co., Ltd, Shanghai, China) according to the manufacturer’s instructions and the 16S rRNA gene was used as the reference gene (Li et al., 2008). qPCR reactions were conducted in a SLAN-96P Real-Time PCR Detection System (Hongshi Medical Technology Co., Ltd, Shanghai, China). The cycling profile used for qPCR was as follows: a predenaturation step at 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s; and a final elongation at 72 °C for 15 min. The relative transcription level was calculated using the 2 DCt method (Pfaffl, 2001). Nucleotide sequence accession number
The sequence of the gadA locus was deposited in GenBank database under accession number JX074764.
Results and discussion Lactobacillus brevis may normally have two GAD genes
Three genes in the L. brevis ATCC367 genome have been reported to encode GADs: LVIS_0079, LVIS_1847 and LVIS_2213. The protein sequence (ABJ63253) deduced from LVIS_0079 shares 99% identity with the well-characterized GAD (AB258458) of L. brevis IFO12005 (Hiraga et al., 2008); and the protein sequence (ABJ64910) deduced from LVIS_1847 shares over 98% identity with
FEMS Microbiol Lett 349 (2013) 108–116
gadA locus and expression in L. brevis NCL912
the well-characterized GAD of L. brevis BH2 (EU084998) (Kim et al., 2007) and L. brevis OPK-3 GAD (DQ168031) (Park & Oh, 2007). However, the protein product of LVIS_2213 has 99% identity with the L. brevis IOEB 9809 tyrosine decarboxylase (AF446085) (Lucas & LonvaudFunel, 2002), suggesting that LVIS_2213 is a tyrosine decarboxylase gene. Therefore, it is now thought that L. brevis ATCC367 contains two GAD genes (LVIS_0079 and LVIS_1847) that are 1.7 Mb apart in the chromosome. Two corresponding GAD encoding genes have also been isolated from GABA-producers L. brevis TCCC13007 (Zhang et al., 2010) and L. brevis Lb85 (Shi & Li, 2011), respectively. In contrast, only one GAD gene was amplified from L. brevis IFO12005 (Hiraga et al., 2008), L. brevis BH2 (Kim et al., 2007) and L. brevis OPK-3 (Park & Oh, 2007), respectively. However, the researchers in those studies only attempted to amplify one GAD gene from these strains. Therefore, overall the data suggest that L. brevis strains normally contain two GAD genes. Escherichia coli also contains two GAD genes; gadA and gadB are 98% homologous at the nucleotide level, and are located in two distinct loci on the chromosome (Smith et al., 1992). In E. coli, gadB is linked to the glutamate:GABA antiporter encoding gene gadC (Hersh et al., 1996). Lactococcus lactis possesses only one GAD encoding gene (Nomura et al., 1999), designated gadB because it is adjacent to the lactococcal gadC (Sanders et al., 1998). Although LVIS_0079 of L. brevis ATCC367 flanks gadC, its deduced protein is only 49% homologous to the L. lactis GadB. However, the deduced protein of LVIS_1847 is 70% homologous to L. lactis GadB, suggesting that LVIS_1847 and its homologs contain the gadB gene; they have been designated as gadB. Accordingly, LVIS_0079 and its homologs have been designated as gadA. The arrangement of the lactobacilli gadCA is similar to the lactococcal operon gadCB. Lactobacillus brevis gadCA alone can encode the complete GAD system (GAD and glutamate:GABA antiporter) and this gene arrangement may be beneficial to the decarboxylation process. Although notable genetic sequence differences exist, the role of gadCA and gadCB are identical: gadC is responsible for glutamate:GABA antiport, and gadA or gadB are responsible for glutamate decarboxylation. Notably, gadB of L. brevis is located separately and apart from gadCA. It is not fully understood whether or how the expression of the L. brevis gadB gene is associated with gadCA.
111
expected length (Fig. 1). This cloned fragment is 1449 bp in length and its deduced amino acid sequence shares 91% identify with the GadA (ABJ63253) and 51% identity with the GadB (ABJ64910) protein of L. brevis ATCC367. The results indicate that the NLC912 gene belongs to the gadA family. NLC912 GadA has both a highly conserved motif [HVDAA(S/F)GG] that belongs to pyridoxal5′-phosphate (PLP)-dependent decarboxylases and a PLP-binding domain (Fig. 2) (Kawalleck et al., 1993; Kim et al., 2007; Park & Oh, 2007; Hiraga et al., 2008). We used single primer PCR walking to isolate regions flanking the gadA of strain NLC912. One walk into downstream regions and four walks into upstream regions of gadA were successful, but the locus was not entirely cloned and additional upstream walks by the single primer method failed (Fig. 3). Instead we used TAIL-PCR (Liu & Whittier, 1995) to walk further upstream of gadA to finally obtain a 4615-bp DNA fragment (JX074764) containing the whole locus. The fragment contained sequences including a predicted acetyltransferase gene (act), gadR, gadC, gadA genes and a glutamyl-tRNA synthetase gene (gts; Fig. 4). This gene organization is similar to that observed in L. brevis ATCC367, except that in ATCC367, the NADPH:quinone reductase-related, Zndependent oxidoreductase gene is also located upstream of gadR. The nucleotide homology of gadR, gadC and gadA between the NCL912 and ATCC367 strains was 66%, 79% and 79%, and the amino acid homology between the encoded proteins was 66%, 91% and 91%, respectively. The sizes of the intergenic regions between act and gadR, gadR and gadC, and gadC and gadA were
The gadA locus encodes an efficient GAD system in L. brevis NCL912
Eleven pairs of primers (Table S1) were used to amplify the gadA gene from L. brevis NCL912. Only the primer pair gadAU2 and gadAD2 could amplify a fragment with FEMS Microbiol Lett 349 (2013) 108–116
Fig. 1. PCR product amplified by primer pair gadAU2 and gadAD2. The arrow indicates the target fragment. Lane 1: PCR product. M: DNA Marker VII (from top to bottom 2.5, 2, 1.5, 1, 0.5 and 0.3 kb).
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
112
H. Li et al.
Fig. 2. Alignment of the amino acid sequence of NCL912 GadA with GadA proteins from other lactic acid bacteria. The amino acid residues [HVDAA(S/F)GG] in the green box are highly conserved in pyridoxal 5′-phosphatedependent decarboxylases; the amino acid residues in black box are the pyridoxal 5′-phosphate binding domain.
278, 210 and 59 bp in NCL912, and 270, 193, and 55 bp in ATCC367, respectively. The nucleotide homology between the two strains in the intergenic regions was 43%, 58% and 62%, respectively. Differences in the primary structure of GADs affect the ability of LABs to produce GABA (Komatsuzaki et al., 2008). The ability of L. brevis NCL912 to produce high levels of GABA may be associated with the particular gadA locus that it contains. In L. lactis, gadCB is an operon (Sanders et al., 1998) and the structure of the NCL912 gadCA is similar to the lactococcal gadCB operon. Furthermore, we were unable to detect transcription ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
initiation signals within or near the 59-bp intergenic region located between the NCL912 gadA and gadC genes. These and our transcription data below suggest gadCA of NCL912 may also be transcribed as an operon to ensure the expression of GAD and glutamate:GABA antiport is coordinated. gadB is absent in NCL912
Sixty-one primer pairs (including 23 degenerate primer pairs from conserved regions of gadB in other strains; Table S2) were used to isolate the gadB gene from FEMS Microbiol Lett 349 (2013) 108–116
113
gadA locus and expression in L. brevis NCL912
Fig. 3. Chromosome walking of regions flanking the gadA by single primer PCR. Lanes 1–7 successively present PCR products of primers gadA-ACPR1–gadA-ACPR7 in Table S4. Lane 8: PCR product of primer gadA-ACPF1. M: DL2000 DNA Marker (from top to bottom 2, 1, 0.75, 0.5, 0.3 and 0.1 kb). Arrows indicate main bands.
NCL912 but none of the pairs could amplify gadB sequences (data not shown). The results suggest that gadB was not present in strain NCL912. Its absence was further verified by genome walking through and around its genomic location in L. brevis. First, we amplified internal fragments of three genes that normally flank gadB but only one upstream gene, aldo-keto reductase gene (akr), could be cloned (Fig. 5). There is only one copy of akr in the L. brevis ATCC367 genome, located 1003 bp upstream of gadB. Consequently, TAIL-PCR was employed to walk 3027 bp downstream of the akr gene but sequence analysis revealed that gadB was not present in the fragment. The combined PCR and DNA walking results suggest that L. brevis NCL912 does not contain a gadB gene. During evolution, NCL912 may have lost gadB, and mutations that increased the activity of the gadA locus could have been selected for to meet the cellular demand for glutamate decarboxylation in the absence of gadB. Alternatively, gadA may have acquired mutations that allowed it to meet the demands of the cell for glutamate decarboxylation alone and, as a result, gadB may have disappeared from NCL912 chromosome. The L. lactis subsp. cremoris of L. lactis (Nomura et al., 2000) and
Fig. 5. Amplification of the genes flanking gadB. Lanes 1–7 successively present PCR products of primer pairs 1844U1-1844D1, 1844U1-1844D2, 1844U2-1844D1, 1844U2-1844D2, 1849U11849D2, 1849U2-1849D1 and 1847U1-1847D1. M: DL2000 DNA Marker (from top to bottom 2, 1, 0.75, 0.5, 0.3 and 0.1 kb). Arrows indicate expected length fragments. Sequencing results show that only the first four primer pairs could isolate the correct fragments (i.e. internal fragments of the akr).
some Streptococcus thermophilus strains (Somkuti et al., 2012) do not possess GAD activity as the result of a frameshift mutation in the GAD gene; furthermore, some other S. thermophilus strains are apparently devoid of the GAD locus (Somkuti et al., 2012). Loss of GAD genes may be a prevailing trend in the evolution of LAB. Expression of the gadRCA during fed-batch fermentation
During the course of fed-batch fermentation, the transcription of gadR, gadC and gadA was synchronous. Increased mRNA levels were observed from 0–12 h, followed by a sharp decline from 12–24 h, and then a continuous decrease, regardless of whether glutamate was added. A good correlation existed between expression of the gadA locus and the production of GABA by NCL912 (Li et al., 2010).
Fig. 4. Gene organization of gadA locus in Lactobacillus brevis NCL912 and a comparison with the gadA locus of L. brevis ATCC367: act, acetyltransferase gene; gadR, transcriptional regulator gene of gadCA; gadC, glutamate:gamma-aminobutyric acid antiporter gene; gadA, glutamate decarboxylase A gene; gts, glutamyl-tRNA synthetase gene; nor, NADPH:quinone reductase-related Zn-dependent oxidoreductase. Arrows indicate gene orientations.
FEMS Microbiol Lett 349 (2013) 108–116
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
114
During 0–12 h the mRNA levels of each gene were almost identical in NCL912 cells grown in glutamatesupplemented and non-supplemented media, most likely due to the presence of some glutamate in the inoculums (Li et al., 2010) and a nitrogen source in the fermentation medium; after 12 h, the mRNA levels were lower in the non-supplemented media, probably due to the depletion of the glutamate introduced with the inoculum. The results suggest that glutamate induces transcription of the three gad genes. The mRNA levels of gadA and gadC were very similar, further suggesting that gadCA forms an operon. Notably, the mRNA levels of gadR were much higher (13–155fold) than those of gadCA throughout the culture period
H. Li et al.
(Fig. 6), suggesting that GadR may positively regulate the expression of gadCA in NCL912, as it does in L. lactis (Sanders et al., 1998). Later in production, GABA may compete with the inducer glutamate for the binding site in the GadR protein to inhibit the expression of gadCA. To overcome this effect, NCL912 might keep increasing the expression of gadR. High expression of gadR may be important for the high GABA-producing capacity of NCL912.
Conclusions Lactobacillus brevis NCL912 has only one GAD-encoding gene (gadA). The absence of gadB was verified by both
Fig. 6. Transcription levels of the gadA, gadC and gadR in media supplemented with or without glutamate during the fed-batch fermentation process.
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
FEMS Microbiol Lett 349 (2013) 108–116
gadA locus and expression in L. brevis NCL912
PCR and genomic walking. The gadA locus of NCL912 has relatively low homology with gadA loci in other L. brevis strains. In culture, the expression of the NCL912 gad genes, gadR, gadC and gadA, was synchronous and correlated well with GABA production. Transcription levels of gadA and gadC were almost identical, suggesting gadCA forms an operon and is regulated by gadR, which had much higher expression levels. This particular gadA locus may be responsible for the high yields of GABA produced by L. brevis NCL912 under fed-batch fermentation conditions.
Acknowledgements This work was supported by funds from the National Natural Science Foundation of China (31200060) and the Science & Technology Department of Jiangxi province (2010GNQ0139), China.
References Al-Wadei HAN, Plummer HK, Ullah MF, Unger B, Brody JR & Schuller HM (2012) Social stress promotes and gamma-aminobutyric acid inhibits tumor growth in mouse models of non-small cell lung cancer. Cancer Prev Res (Phila) 5: 189–196. Barney M, Volgyi A, Navarro A & Ryder D (2001) Riboprinting and 16S rRNA gene sequencing for identification of brewery Pediococcus isolates. Appl Environ Microbiol 67: 553–560. Barrett E, Ross RP, O’Toole PW, Fitzgerald GF & Stanton C (2012) gamma-aminobutyric acid production by culturable bacteria from the human intestine. J Appl Microbiol 113: 411–417. Chuang CY, Shi YC, You HP, Lo YH & Pan TM (2011) Antidepressant effect of GABA-rich Monascus-fermented product on forced swimming rat model. J Agric Food Chem 59: 3027–3034. Hayakawa K, Kimura M, Kasaha K, Matsumoto K, Sansawa H & Yamori Y (2004) Effect of a gamma-aminobutyric acid-enriched dairy product on the blood pressure of spontaneously hypertensive and normotensive Wistar–Kyoto rats. Br J Nutr 92: 411–417. Hersh BM, Farooq FT, Barstad DN, Blankenhorn DL & Slonczewski JL (1996) A glutamate-dependent acid resistance gene in Escherichia coli. J Bacteriol 178: 3978–3981. Hiraga K, Ueno Y & Oda K (2008) Glutamate decarboxylase from Lactobacillus brevis: activation by ammonium sulfate. Biosci Biotechnol Biochem 72: 1299–1306. Hwang IT, Kim YJ, Kim SH, Kwak CI, Gu YY & Chun JY (2003) Annealing control primer system for improving specificity of PCR amplification. Biotechniques 35: 1180–1184. Jakobs C, Jaeken J & Gibson KM (1993) Inherited disorders of GABA metabolism. J Inherit Metab Dis 16: 704–715.
FEMS Microbiol Lett 349 (2013) 108–116
115
Kawalleck P, Keller H, Hahlbrock K, Scheel D & Somssich IE (1993) A pathogen-responsive gene of parsley encodes tyrosine decarboxylase. J Biol Chem 268: 2189–2194. Kim SH, Shin BH, Kim YH, Nam SW & Jeon SJ (2007) Cloning and expression of a full-length glutamate decarboxylase gene from Lactobacillus brevis BH2. Biotechnol Bioprocess Eng 12: 707–712. Komatsuzaki N, Shima J, Kawamoto S, Momose H & Kimura T (2005) Production of gamma-aminobutyric acid (GABA) by Lactobacillus paracasei isolated from traditional fermented foods. Food Microbiol 22: 497–504. Komatsuzaki N, Nakamura T, Kimura T & Shima J (2008) Characterization of glutamate decarboxylase from a high gamma-aminobutyric acid (GABA)-producer, Lactobacillus paracasei. Biosci Biotechnol Biochem 72: 278–285. Li H & Cao Y (2010) Lactic acid bacterial cell factories for gamma-aminobutyric acid. Amino Acids 39: 1107–1116. Li H, Cao Y, Gao D & Xu H (2008) A high c-aminobutyric acid-producing ability Lactobacillus brevis isolated from Chinese traditional paocai. Ann Microbiol 58: 649–653. Li H, Qiu T, Huang G & Cao Y (2010) Production of gamma-aminobutyric acid by Lactobacillus brevis NCL912 using fed-batch fermentation. Microb Cell Fact 9: 85. Li H, Qiu T, Chen Y & Cao Y (2011) Separation of gamma-aminobutyric acid from fermented broth. J Ind Microbiol Biotechnol 38: 1955–1959. Liu YG & Whittier RF (1995) Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 25: 674–681. Lucas P & Lonvaud-Funel A (2002) Purification and partial gene sequence of the tyrosine decarboxylase of Lactobacillus brevis IOEB 9809. FEMS Microbiol Lett 211: 85–89. Nomura M, Nakajima I, Fujita Y, Kobayashi M, Kimoto H, Suzuki I & Aso H (1999) Lactococcus lactis contains only one glutamate decarboxylase gene. Microbiology 145: 1375–1380. Nomura M, Kobayashi M, Ohmomo S & Okamoto T (2000) Inactivation of the glutamate decarboxylase gene in Lactococcus lactis subsp. cremoris. Appl Environ Microbiol 66: 2235–2237. Park KB & Oh SH (2007) Cloning, sequencing and expression of a novel glutamate decarboxylase gene from a newly isolated lactic acid bacterium, Lactobacillus brevis OPK-3. Bioresour Technol 98: 312–319. Pfaffl M (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45. Ratanaburee A, Kantachote D, Charernjiratrakul W & Sukhoom A (2013) Selection of c-aminobutyric acid-producing lactic acid bacteria and their potential as probiotics for use as starter cultures in Thai fermented sausages (Nham). Int J Food Sci Technol 48: 1371–1382. Sanders JW, Leenhouts K, Burghoorn J, Brands JR, Venema G & Kok J (1998) A chloride-inducible acid resistance mechanism in Lactococcus lactis and its regulation. Mol Microbiol 27: 299–310.
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
116
Shi F & Li Y (2011) Synthesis of c-aminobutyric acid by expressing Lactobacillus brevis-derived glutamate decarboxylase in the Corynebacterium glutamicum strain ATCC 13032. Biotechnol Lett 33: 2469–2474. Siragusa S, De Angelis M, Di Cagno R, Rizzello CG, Coda R & Gobbetti M (2007) Synthesis of c-aminobutyric acid by lactic acid bacteria isolated from a variety of Italian cheeses. Appl Environ Microbiol 73: 7283–7290. Small PL & Waterman SR (1998) Acid stress, anaerobiosis and gadCB: lessons from Lactococcus lactis and Escherichia coli. Trends Microbiol 6: 214–216. Smith DK, Kassam T, Singh B & Elliott JF (1992) Escherichia coli has two homologous glutamate decarboxylase genes that map to distinct loci. J Bacteriol 174: 5820–5826. Somkuti GA, Renye JA Jr & Steinberg DH (2012) Molecular analysis of the glutamate decarboxylase locus in Streptococcus thermophilus ST110. J Ind Microbiol Biotechnol 39: 957–963. Ueno H (2000) Enzymatic and structural aspects on glutamate decarboxylase. J Mol Catal B Enzym 10: 67–79. Wong CG, Bottiglieri T & Snead OC 3rd (2003) GABA, gamma-hydroxybutyric acid, and neurological disease. Ann Neurol 54: S3–S12.
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
H. Li et al.
Zhang Y, Gao N, Feng Y, Song L & Gao Q (2010) Biotransformation of sodium L-glutamate to c-aminobutyric acid by L. brevis TCCC13007 with two glutamate decarboxylase genes. 4th International Conference on Bioinformatics and Biomedical Engineering. DOI: 10. 1109/ICBBE.2010.5518023.
Supporting Information Additional Supporting Information may be found in the online version of this article: Table S1. Primers for the amplification of gadA gene. Table S2. Primers for the amplification of gadB gene. Table S3. Primers for the direct amplification of genes flanking gadB. Table S4. Primers used in SP-PCR to walk upstream and downstream of gadA. Table S5. Primers used in TAIL-PCR to walk through genomic regions that flanked gadA and akr. Table S6. Thermal cycling parameters used in TAIL-PCR. Table S7. Summary of Primers and probes for qPCR
FEMS Microbiol Lett 349 (2013) 108–116
gadA gene locus in Lactobacillus brevis NCL912 and its expression during fed-batch fermentation Haixing Li, Wenming Li, Xiaohua Liu & Yusheng Cao Sino-German Joint Research Institute, Nanchang University, Nanchang, China
Correspondence: Yusheng Cao, SinoGerman Joint Research Institute, Nanchang University, Nanchang 330047, China. Tel.: +86 13907093454; fax: +86 791 88333708; e-mail: [email protected] Received 23 September 2013; accepted 16 October 2013. Final version published online 6 November 2013. DOI: 10.1111/1574-6968.12301 Editor: Wolfgang Kneifel
MICROBIOLOGY LETTERS
Keywords cloning and expression; gadA locus genes; gamma-aminobutyric acid; Lactobacillus brevis NCL912.
Abstract Normally, Lactobacillus brevis has two glutamate decarboxylase (GAD) genes; gadA and gadB. Using PCR, we cloned the gadA gene from L. brevis strain NCL912, a high yield strain for the production of gamma-aminobutyric acid (GABA). However, despite using 61 different primer pairs, including degenerate primers from conserved regions, we were unable to use PCR to clone gadB from the NCL912 strain. Furthermore, we could not clone it by genomic walking over 3000 bp downstream of the aldo-keto reductase gene, a single-copy gene that is located 1003 bp upstream of gadB in L. brevis ATCC367. Altogether, the data suggest that L. brevis NCL912 does not contain a gadB gene. By genomic walking, we cloned regions upstream and downstream of the gadA gene to obtain a 4615 bp DNA fragment that included the complete gadA locus. The locus contained the GAD gene (gadA) and the glutamate:GABA antiporter gene (gadC), which appear to be transcribed in an operon (gadCA), and a transcriptional regulator (gadR) of gadCA. During whole fed-batch fermentation, the expression of gadR, gadC and gadA was synchronized and correlated well with GABA production. The gadA locus we cloned from NCL912 has reduced homology compared with gadA loci of other L. brevis strains, and these differences might explain the ability of NCL912 to produce higher levels of GABA in culture.
Introduction Gamma-aminobutyric acid (GABA) is a major inhibitory neurotransmitter in the mammalian central nervous system (Jakobs et al., 1993; Ueno, 2000) and has several well characterized physiological functions (Wong et al., 2003; Hayakawa et al., 2004; Chuang et al., 2011; Al-Wadei et al., 2012). GABA is also a functionally bioactive component in foods and pharmaceuticals. The production of lactic acid bacterial (LAB) GABA has been actively pursued due to its natural characteristics and safety profile (Komatsuzaki et al., 2005; Siragusa et al., 2007; Li & Cao, 2010; Barrett et al., 2012; Ratanaburee et al., 2013). An intracellular glutamate decarboxylase (GAD) system, which is composed of GAD and the glutamate: GABA antiporter, is responsible for the production of GABA. Glutamate is imported into cells by the antiporter, then decarboxylated by intracellular GAD to produce GABA. Subsequently, the GABA is exported from the cells via the antiporter (Sanders et al., 1998; Small & Waterman, ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
1998). In Lactococcus lactis, the GAD encoding gene (gadB) and the glutamate:GABA antiporter encoding gene (gadC) form an operon called gadCB. This operon is positively regulated by the GadR protein (encoded by gadR), which recognizes the presence of glutamate and induces the expression of the gadCB genes (Sanders et al., 1998). Two different GAD encoding genes have been characterized from several L. brevis stains. However, they have often been considered the same gene (mostly referred to as gadB) and therefore frequently have been aligned together and thought to be poorly conserved (Kim et al., 2007; Park & Oh, 2007; Li & Cao, 2010). In fact, each of the genes is highly conserved, but complete data have not been available for an entire L. brevis gad locus up to now. In the genome (CP000416) of L. brevis ATCC367, there are two GAD encoding genes, gadA and gadB, separated by c. 1.7 Mb. gadA is located adjacent to, and downstream of, the glutamate:GABA antiporter gene (gadC). They are collectively referred to as gadCA and, similar to L. lactis, may form an operon. gadR, which lies FEMS Microbiol Lett 349 (2013) 108–116
109
gadA locus and expression in L. brevis NCL912
immediately upstream of gadCA, encodes a transcriptional regulator of gadCA. The gadB gene is located separately from the other gad genes and it is not known whether it is transcriptionally regulated by GadR. Lactobacillus brevis NCL912 is a strain isolated from fermented food in our laboratory (Li et al., 2008) that can produce high levels of GABA (102 g L 1 after 48 h) in fed-batch fermentation (Li et al., 2010). Understanding the mechanism for the high GABA yield and the ability of NCL912 to synthesize elevated levels of GABA is very important because this may involve genetically manipulating the NCL912 strain to increase GABA production further. To facilitate our research, this study focused on cloning and analyzing the GAD gene loci from L. brevis NCL912, and the expression of GAD genes during the fed-batch fermentation.
Materials and methods Strains, plasmids, media and cultivation
NCL912, a high-level GABA-producing strain of L. brevis, was isolated from paocai, a Chinese traditional fermented vegetable (Li et al., 2008). The pMD18-T Vector or pMD19-T Simple Vector (TaKaRa, Dalian, China) and Escherichia coli DH5a were used for cloning DNA. The seed medium of strain NCL912 was composed of (g L 1): glucose, 50; soya peptone, 25; MnSO44H2O, 0.01; L-glutamate, 150 mM; and Tween 80, 2 mL L 1; pH 5.0. The GABA fermentation medium was composed of (g L 1): glucose, 35; soya peptone, 25; L-glutamate, 400 mM; MnSO44H2O, 0.01; and Tween 80, 2 mL L 1; pH 5.0. Seed culture preparation and fed-batch fermentation of L. brevis NCL912 were carried out as previously described (Li et al., 2010, 2011) and samples were withdrawn every 12 h for up to 48 h after beginning the fermentation experiment. Escherichia coli DH5a was routinely grown at 37 °C in Luria–Bertani (LB) medium; E. coli DH5a cells containing recombinant DNA plasmids were grown in LB medium supplemented with ampicillin (100 lg mL 1) at 37 °C. Genomic DNA isolation and purification
Genomic DNA was extracted from NCL912 cells and purified by a modification of the method described by Barney et al. (2001). Logarithmic phase cells were harvested from 8 mL of culture by centrifugation at 5000 g for 5 min, rinsed once with TE (Tris/EDTA) buffer, and then resuspended in 1.07 mL of TES buffer [10 mM TrisHCl, 1 mM EDTA, and 0.35 M sucrose (pH 8.0)]. After adding 0.2 mL 50 mg mL 1 of lysozyme, samples were incubated at 37 °C for 3 h, and then 2.6 mL of CTAB FEMS Microbiol Lett 349 (2013) 108–116
buffer [100 mM Tris-HCl, 1.5 M NaCl, 10 mM EDTA, 2% cetyltrimethyl ammonium bromide (CTAB), pH 8.0] and 30 lL 20 mg mL 1 of proteinase K were added. Samples were incubated a further 2 h at 50 °C and the mixture then extracted with 1.95 mL of Tris-saturated phenol (pH 7.8) by vortexing for 2 min. An equal volume of 1.95 mL of chloroform-isoamyl alcohol (24 : 1, v/v) was added, the sample vortexed a further 2 min, and then the phases separated by centrifuging at 5000 g for 5 min. The aqueous phase was removed and extracted one more time with chloroform-isoamyl alcohol (24 : 1, v/v) and then precipitated by adding two volumes of isopropanol and incubating at 4 °C for 10 min. The DNA was pelleted by centrifuging at 10 000 g for 10 min, and rinsed twice with 70% ethanol and once with anhydrous alcohol. After drying, the DNA pellet was dissolved in 200 lL of TE buffer containing 250 lg of RNase A per mL and incubated at 37 °C for 2 h. The DNA was then reprecipitated by adding 300 lL of TE buffer, 50 lL of 3 M sodium acetate (pH 5.2) and two volumes of ethanol and incubated at 20°C for 30 min. The DNA was collected by centrifuging at 15 000 g for 10 min at 4 °C. After rinsing twice with 70% ethanol and once with anhydrous alcohol, the pellet was dried and then resuspended in 600 lL of ddH2O. Total RNA extraction
Total RNA was extracted from NCL912 cells using an RNAprep pure Cell/Bacteria Kit (Tiangen Biotech Co., Ltd, Beijing, China) according to the manufacturer’s instructions. DNAse I was added during the extraction process to remove DNA contamination. Amplification of gadA, gadB and the genes flanking gadB
Eleven (3 9 3 + 2) (Supporting Information, Table S1), 61 (2 9 2 + 3 9 3 + 5 9 5 + 3 9 3 + 2 9 2 + 2 9 3 + 2 9 2) (Table S2), four (2 9 2), four (2 9 2) and six (3 9 2) (Table S3) pairs of primers derived from gadA, gadB, aldo/keto reductase of the diketogulonic reductase gene (akr), a hypothetical protein gene, and the NCAIR mutase (PurE)-related protein gene in L. brevis ATCC367, respectively, were used to amplify the corresponding genes from strain NCL912. The PCR reaction mixture for all primer pairs was 19 PCR buffer containing 1.5–5.0 mM MgCl2, 0.2 mM dNTP, 0.2 lM each primer (or 0.4 lM if the primers were degenerate), 20 ng genomic DNA, and 2.5 U Taq polymerase in a 50-lL reaction volume. The PCR program was 94 °C for 2 min; 30–40 cycles of 94 °C for 30 s, 40–60 °C for 30 s, 72 °C for 0.5–3 min. ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
110
Walking into regions that flanked gadA using single primer PCR
To isolate the full-length gadA and its flanking regions, single primer PCR (SP-PCR) was carried out using annealing control primers (ACP) (Hwang et al., 2003). Each ACP primer was designed as follows: a 36-bp conventional primer which exactly matched the known sequence of the region was first selected, then five continuous nucleotides (22nd to 26th nucleotides, from 5′ end to 3′ end) in the sequence was replaced by five continuous deoxyinosines (dI) to produce an ACP primer with a 21-bp 5′ end region and a 10-bp 3′ end region. For example, five dITPs were used to substitute the five underlined nucleotides in the conventional primer CGTGTTC GTTGGCAATGACTTCCGGCCTTCAACGCT to produce the ACP primer CGTGTTCGTTGGCAATGACTT(dI)5CT TCAACGCT (Table S4). The ACP primer system can improve the specificity of PCR amplification. Here we used each ACP primer simultaneously as a specific and an arbitrary primer (walking primer) for genomic DNA walking. The PCR reaction mixture used for all primers was 19 PCR buffer that contained 1.5–5.0 mM MgCl2, 0.2 mM dNTP, 0.4 lM of ACP primer, and 2.5 U Taq polymerase in a 50-lL reaction volume. The PCR program was three cycles of 94 °C for 30 s, 40–60 °C for 3 min, 72 °C for 2 min, and 40 cycles of 94 °C for 30 s, 68 °C for 3 min. The main DNA band was isolated, cloned and sequenced. Walking of regions upstream of gadA or downstream of akr by thermal asymmetric interlaced PCR (TAIL-PCR)
The regions upstream of gadA or downstream of akr in NCL912 were obtained by TAIL-PCR (Liu & Whittier, 1995). The primers used for this procedure are shown in Table S5. The PCR reaction mixtures and thermal cycling conditions were similar to those described by Liu & Whittier (1995) with some modifications. The PCR reaction mixture (50 lL) was: 1 lL plate DNA, 0.4 mM dNTP, 19 LA PCR buffer II (Mg2+ plus), 2.5 U TaKaRa LA Taq, 12.5 lL of an arbitrary primer, 0.2 lM of a specific primer. The thermal cycling conditions are summarized in Table S6. The main DNA band in each reaction was isolated, cloned and sequenced. DNA purification
PCR products were purified with the Agarose Gel DNA Purification Kit Ver.2.0 (TaKaRa). and ligated into pMDTM18-T Vector or pMDTM19-T Simple Vector. The
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
H. Li et al.
plasmids were transformed into E. coli DH5a cells according to the TaKaRa guidelines and sequenced by Sangon Biotech Co., Ltd (Shanghai, China). Sequence analysis
DNA or protein homology searches against the GenBank were carried out using the BLAST program. Sequence alignments were conducted using the MegAlign program in the LASERGENE software (DM version 3.3.8). qPCR
Real-time fluorescence quantitative PCR was used to analyze the transcription levels of gadA, gadC and gadR in NCL912 during the fed-batch fermentation process. The primers and probes used for qPCR are shown in Table S7. Fluorescent probes were 5′ labeled with 6-carboxyfluorescein (FAM; Generay Biotech Co., Ltd, Shanghai, China). Unless otherwise stated, all the primers and probes were made to a concentration of 10 lM in nuclease-free ddH2O before use. Single-strand cDNA was synthesized from total RNA using the reverse transcription kit (Bio-serve Co., Ltd, Shanghai, China) according to the manufacturer’s instructions and the 16S rRNA gene was used as the reference gene (Li et al., 2008). qPCR reactions were conducted in a SLAN-96P Real-Time PCR Detection System (Hongshi Medical Technology Co., Ltd, Shanghai, China). The cycling profile used for qPCR was as follows: a predenaturation step at 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s; and a final elongation at 72 °C for 15 min. The relative transcription level was calculated using the 2 DCt method (Pfaffl, 2001). Nucleotide sequence accession number
The sequence of the gadA locus was deposited in GenBank database under accession number JX074764.
Results and discussion Lactobacillus brevis may normally have two GAD genes
Three genes in the L. brevis ATCC367 genome have been reported to encode GADs: LVIS_0079, LVIS_1847 and LVIS_2213. The protein sequence (ABJ63253) deduced from LVIS_0079 shares 99% identity with the well-characterized GAD (AB258458) of L. brevis IFO12005 (Hiraga et al., 2008); and the protein sequence (ABJ64910) deduced from LVIS_1847 shares over 98% identity with
FEMS Microbiol Lett 349 (2013) 108–116
gadA locus and expression in L. brevis NCL912
the well-characterized GAD of L. brevis BH2 (EU084998) (Kim et al., 2007) and L. brevis OPK-3 GAD (DQ168031) (Park & Oh, 2007). However, the protein product of LVIS_2213 has 99% identity with the L. brevis IOEB 9809 tyrosine decarboxylase (AF446085) (Lucas & LonvaudFunel, 2002), suggesting that LVIS_2213 is a tyrosine decarboxylase gene. Therefore, it is now thought that L. brevis ATCC367 contains two GAD genes (LVIS_0079 and LVIS_1847) that are 1.7 Mb apart in the chromosome. Two corresponding GAD encoding genes have also been isolated from GABA-producers L. brevis TCCC13007 (Zhang et al., 2010) and L. brevis Lb85 (Shi & Li, 2011), respectively. In contrast, only one GAD gene was amplified from L. brevis IFO12005 (Hiraga et al., 2008), L. brevis BH2 (Kim et al., 2007) and L. brevis OPK-3 (Park & Oh, 2007), respectively. However, the researchers in those studies only attempted to amplify one GAD gene from these strains. Therefore, overall the data suggest that L. brevis strains normally contain two GAD genes. Escherichia coli also contains two GAD genes; gadA and gadB are 98% homologous at the nucleotide level, and are located in two distinct loci on the chromosome (Smith et al., 1992). In E. coli, gadB is linked to the glutamate:GABA antiporter encoding gene gadC (Hersh et al., 1996). Lactococcus lactis possesses only one GAD encoding gene (Nomura et al., 1999), designated gadB because it is adjacent to the lactococcal gadC (Sanders et al., 1998). Although LVIS_0079 of L. brevis ATCC367 flanks gadC, its deduced protein is only 49% homologous to the L. lactis GadB. However, the deduced protein of LVIS_1847 is 70% homologous to L. lactis GadB, suggesting that LVIS_1847 and its homologs contain the gadB gene; they have been designated as gadB. Accordingly, LVIS_0079 and its homologs have been designated as gadA. The arrangement of the lactobacilli gadCA is similar to the lactococcal operon gadCB. Lactobacillus brevis gadCA alone can encode the complete GAD system (GAD and glutamate:GABA antiporter) and this gene arrangement may be beneficial to the decarboxylation process. Although notable genetic sequence differences exist, the role of gadCA and gadCB are identical: gadC is responsible for glutamate:GABA antiport, and gadA or gadB are responsible for glutamate decarboxylation. Notably, gadB of L. brevis is located separately and apart from gadCA. It is not fully understood whether or how the expression of the L. brevis gadB gene is associated with gadCA.
111
expected length (Fig. 1). This cloned fragment is 1449 bp in length and its deduced amino acid sequence shares 91% identify with the GadA (ABJ63253) and 51% identity with the GadB (ABJ64910) protein of L. brevis ATCC367. The results indicate that the NLC912 gene belongs to the gadA family. NLC912 GadA has both a highly conserved motif [HVDAA(S/F)GG] that belongs to pyridoxal5′-phosphate (PLP)-dependent decarboxylases and a PLP-binding domain (Fig. 2) (Kawalleck et al., 1993; Kim et al., 2007; Park & Oh, 2007; Hiraga et al., 2008). We used single primer PCR walking to isolate regions flanking the gadA of strain NLC912. One walk into downstream regions and four walks into upstream regions of gadA were successful, but the locus was not entirely cloned and additional upstream walks by the single primer method failed (Fig. 3). Instead we used TAIL-PCR (Liu & Whittier, 1995) to walk further upstream of gadA to finally obtain a 4615-bp DNA fragment (JX074764) containing the whole locus. The fragment contained sequences including a predicted acetyltransferase gene (act), gadR, gadC, gadA genes and a glutamyl-tRNA synthetase gene (gts; Fig. 4). This gene organization is similar to that observed in L. brevis ATCC367, except that in ATCC367, the NADPH:quinone reductase-related, Zndependent oxidoreductase gene is also located upstream of gadR. The nucleotide homology of gadR, gadC and gadA between the NCL912 and ATCC367 strains was 66%, 79% and 79%, and the amino acid homology between the encoded proteins was 66%, 91% and 91%, respectively. The sizes of the intergenic regions between act and gadR, gadR and gadC, and gadC and gadA were
The gadA locus encodes an efficient GAD system in L. brevis NCL912
Eleven pairs of primers (Table S1) were used to amplify the gadA gene from L. brevis NCL912. Only the primer pair gadAU2 and gadAD2 could amplify a fragment with FEMS Microbiol Lett 349 (2013) 108–116
Fig. 1. PCR product amplified by primer pair gadAU2 and gadAD2. The arrow indicates the target fragment. Lane 1: PCR product. M: DNA Marker VII (from top to bottom 2.5, 2, 1.5, 1, 0.5 and 0.3 kb).
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
112
H. Li et al.
Fig. 2. Alignment of the amino acid sequence of NCL912 GadA with GadA proteins from other lactic acid bacteria. The amino acid residues [HVDAA(S/F)GG] in the green box are highly conserved in pyridoxal 5′-phosphatedependent decarboxylases; the amino acid residues in black box are the pyridoxal 5′-phosphate binding domain.
278, 210 and 59 bp in NCL912, and 270, 193, and 55 bp in ATCC367, respectively. The nucleotide homology between the two strains in the intergenic regions was 43%, 58% and 62%, respectively. Differences in the primary structure of GADs affect the ability of LABs to produce GABA (Komatsuzaki et al., 2008). The ability of L. brevis NCL912 to produce high levels of GABA may be associated with the particular gadA locus that it contains. In L. lactis, gadCB is an operon (Sanders et al., 1998) and the structure of the NCL912 gadCA is similar to the lactococcal gadCB operon. Furthermore, we were unable to detect transcription ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
initiation signals within or near the 59-bp intergenic region located between the NCL912 gadA and gadC genes. These and our transcription data below suggest gadCA of NCL912 may also be transcribed as an operon to ensure the expression of GAD and glutamate:GABA antiport is coordinated. gadB is absent in NCL912
Sixty-one primer pairs (including 23 degenerate primer pairs from conserved regions of gadB in other strains; Table S2) were used to isolate the gadB gene from FEMS Microbiol Lett 349 (2013) 108–116
113
gadA locus and expression in L. brevis NCL912
Fig. 3. Chromosome walking of regions flanking the gadA by single primer PCR. Lanes 1–7 successively present PCR products of primers gadA-ACPR1–gadA-ACPR7 in Table S4. Lane 8: PCR product of primer gadA-ACPF1. M: DL2000 DNA Marker (from top to bottom 2, 1, 0.75, 0.5, 0.3 and 0.1 kb). Arrows indicate main bands.
NCL912 but none of the pairs could amplify gadB sequences (data not shown). The results suggest that gadB was not present in strain NCL912. Its absence was further verified by genome walking through and around its genomic location in L. brevis. First, we amplified internal fragments of three genes that normally flank gadB but only one upstream gene, aldo-keto reductase gene (akr), could be cloned (Fig. 5). There is only one copy of akr in the L. brevis ATCC367 genome, located 1003 bp upstream of gadB. Consequently, TAIL-PCR was employed to walk 3027 bp downstream of the akr gene but sequence analysis revealed that gadB was not present in the fragment. The combined PCR and DNA walking results suggest that L. brevis NCL912 does not contain a gadB gene. During evolution, NCL912 may have lost gadB, and mutations that increased the activity of the gadA locus could have been selected for to meet the cellular demand for glutamate decarboxylation in the absence of gadB. Alternatively, gadA may have acquired mutations that allowed it to meet the demands of the cell for glutamate decarboxylation alone and, as a result, gadB may have disappeared from NCL912 chromosome. The L. lactis subsp. cremoris of L. lactis (Nomura et al., 2000) and
Fig. 5. Amplification of the genes flanking gadB. Lanes 1–7 successively present PCR products of primer pairs 1844U1-1844D1, 1844U1-1844D2, 1844U2-1844D1, 1844U2-1844D2, 1849U11849D2, 1849U2-1849D1 and 1847U1-1847D1. M: DL2000 DNA Marker (from top to bottom 2, 1, 0.75, 0.5, 0.3 and 0.1 kb). Arrows indicate expected length fragments. Sequencing results show that only the first four primer pairs could isolate the correct fragments (i.e. internal fragments of the akr).
some Streptococcus thermophilus strains (Somkuti et al., 2012) do not possess GAD activity as the result of a frameshift mutation in the GAD gene; furthermore, some other S. thermophilus strains are apparently devoid of the GAD locus (Somkuti et al., 2012). Loss of GAD genes may be a prevailing trend in the evolution of LAB. Expression of the gadRCA during fed-batch fermentation
During the course of fed-batch fermentation, the transcription of gadR, gadC and gadA was synchronous. Increased mRNA levels were observed from 0–12 h, followed by a sharp decline from 12–24 h, and then a continuous decrease, regardless of whether glutamate was added. A good correlation existed between expression of the gadA locus and the production of GABA by NCL912 (Li et al., 2010).
Fig. 4. Gene organization of gadA locus in Lactobacillus brevis NCL912 and a comparison with the gadA locus of L. brevis ATCC367: act, acetyltransferase gene; gadR, transcriptional regulator gene of gadCA; gadC, glutamate:gamma-aminobutyric acid antiporter gene; gadA, glutamate decarboxylase A gene; gts, glutamyl-tRNA synthetase gene; nor, NADPH:quinone reductase-related Zn-dependent oxidoreductase. Arrows indicate gene orientations.
FEMS Microbiol Lett 349 (2013) 108–116
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
114
During 0–12 h the mRNA levels of each gene were almost identical in NCL912 cells grown in glutamatesupplemented and non-supplemented media, most likely due to the presence of some glutamate in the inoculums (Li et al., 2010) and a nitrogen source in the fermentation medium; after 12 h, the mRNA levels were lower in the non-supplemented media, probably due to the depletion of the glutamate introduced with the inoculum. The results suggest that glutamate induces transcription of the three gad genes. The mRNA levels of gadA and gadC were very similar, further suggesting that gadCA forms an operon. Notably, the mRNA levels of gadR were much higher (13–155fold) than those of gadCA throughout the culture period
H. Li et al.
(Fig. 6), suggesting that GadR may positively regulate the expression of gadCA in NCL912, as it does in L. lactis (Sanders et al., 1998). Later in production, GABA may compete with the inducer glutamate for the binding site in the GadR protein to inhibit the expression of gadCA. To overcome this effect, NCL912 might keep increasing the expression of gadR. High expression of gadR may be important for the high GABA-producing capacity of NCL912.
Conclusions Lactobacillus brevis NCL912 has only one GAD-encoding gene (gadA). The absence of gadB was verified by both
Fig. 6. Transcription levels of the gadA, gadC and gadR in media supplemented with or without glutamate during the fed-batch fermentation process.
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
FEMS Microbiol Lett 349 (2013) 108–116
gadA locus and expression in L. brevis NCL912
PCR and genomic walking. The gadA locus of NCL912 has relatively low homology with gadA loci in other L. brevis strains. In culture, the expression of the NCL912 gad genes, gadR, gadC and gadA, was synchronous and correlated well with GABA production. Transcription levels of gadA and gadC were almost identical, suggesting gadCA forms an operon and is regulated by gadR, which had much higher expression levels. This particular gadA locus may be responsible for the high yields of GABA produced by L. brevis NCL912 under fed-batch fermentation conditions.
Acknowledgements This work was supported by funds from the National Natural Science Foundation of China (31200060) and the Science & Technology Department of Jiangxi province (2010GNQ0139), China.
References Al-Wadei HAN, Plummer HK, Ullah MF, Unger B, Brody JR & Schuller HM (2012) Social stress promotes and gamma-aminobutyric acid inhibits tumor growth in mouse models of non-small cell lung cancer. Cancer Prev Res (Phila) 5: 189–196. Barney M, Volgyi A, Navarro A & Ryder D (2001) Riboprinting and 16S rRNA gene sequencing for identification of brewery Pediococcus isolates. Appl Environ Microbiol 67: 553–560. Barrett E, Ross RP, O’Toole PW, Fitzgerald GF & Stanton C (2012) gamma-aminobutyric acid production by culturable bacteria from the human intestine. J Appl Microbiol 113: 411–417. Chuang CY, Shi YC, You HP, Lo YH & Pan TM (2011) Antidepressant effect of GABA-rich Monascus-fermented product on forced swimming rat model. J Agric Food Chem 59: 3027–3034. Hayakawa K, Kimura M, Kasaha K, Matsumoto K, Sansawa H & Yamori Y (2004) Effect of a gamma-aminobutyric acid-enriched dairy product on the blood pressure of spontaneously hypertensive and normotensive Wistar–Kyoto rats. Br J Nutr 92: 411–417. Hersh BM, Farooq FT, Barstad DN, Blankenhorn DL & Slonczewski JL (1996) A glutamate-dependent acid resistance gene in Escherichia coli. J Bacteriol 178: 3978–3981. Hiraga K, Ueno Y & Oda K (2008) Glutamate decarboxylase from Lactobacillus brevis: activation by ammonium sulfate. Biosci Biotechnol Biochem 72: 1299–1306. Hwang IT, Kim YJ, Kim SH, Kwak CI, Gu YY & Chun JY (2003) Annealing control primer system for improving specificity of PCR amplification. Biotechniques 35: 1180–1184. Jakobs C, Jaeken J & Gibson KM (1993) Inherited disorders of GABA metabolism. J Inherit Metab Dis 16: 704–715.
FEMS Microbiol Lett 349 (2013) 108–116
115
Kawalleck P, Keller H, Hahlbrock K, Scheel D & Somssich IE (1993) A pathogen-responsive gene of parsley encodes tyrosine decarboxylase. J Biol Chem 268: 2189–2194. Kim SH, Shin BH, Kim YH, Nam SW & Jeon SJ (2007) Cloning and expression of a full-length glutamate decarboxylase gene from Lactobacillus brevis BH2. Biotechnol Bioprocess Eng 12: 707–712. Komatsuzaki N, Shima J, Kawamoto S, Momose H & Kimura T (2005) Production of gamma-aminobutyric acid (GABA) by Lactobacillus paracasei isolated from traditional fermented foods. Food Microbiol 22: 497–504. Komatsuzaki N, Nakamura T, Kimura T & Shima J (2008) Characterization of glutamate decarboxylase from a high gamma-aminobutyric acid (GABA)-producer, Lactobacillus paracasei. Biosci Biotechnol Biochem 72: 278–285. Li H & Cao Y (2010) Lactic acid bacterial cell factories for gamma-aminobutyric acid. Amino Acids 39: 1107–1116. Li H, Cao Y, Gao D & Xu H (2008) A high c-aminobutyric acid-producing ability Lactobacillus brevis isolated from Chinese traditional paocai. Ann Microbiol 58: 649–653. Li H, Qiu T, Huang G & Cao Y (2010) Production of gamma-aminobutyric acid by Lactobacillus brevis NCL912 using fed-batch fermentation. Microb Cell Fact 9: 85. Li H, Qiu T, Chen Y & Cao Y (2011) Separation of gamma-aminobutyric acid from fermented broth. J Ind Microbiol Biotechnol 38: 1955–1959. Liu YG & Whittier RF (1995) Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 25: 674–681. Lucas P & Lonvaud-Funel A (2002) Purification and partial gene sequence of the tyrosine decarboxylase of Lactobacillus brevis IOEB 9809. FEMS Microbiol Lett 211: 85–89. Nomura M, Nakajima I, Fujita Y, Kobayashi M, Kimoto H, Suzuki I & Aso H (1999) Lactococcus lactis contains only one glutamate decarboxylase gene. Microbiology 145: 1375–1380. Nomura M, Kobayashi M, Ohmomo S & Okamoto T (2000) Inactivation of the glutamate decarboxylase gene in Lactococcus lactis subsp. cremoris. Appl Environ Microbiol 66: 2235–2237. Park KB & Oh SH (2007) Cloning, sequencing and expression of a novel glutamate decarboxylase gene from a newly isolated lactic acid bacterium, Lactobacillus brevis OPK-3. Bioresour Technol 98: 312–319. Pfaffl M (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45. Ratanaburee A, Kantachote D, Charernjiratrakul W & Sukhoom A (2013) Selection of c-aminobutyric acid-producing lactic acid bacteria and their potential as probiotics for use as starter cultures in Thai fermented sausages (Nham). Int J Food Sci Technol 48: 1371–1382. Sanders JW, Leenhouts K, Burghoorn J, Brands JR, Venema G & Kok J (1998) A chloride-inducible acid resistance mechanism in Lactococcus lactis and its regulation. Mol Microbiol 27: 299–310.
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
116
Shi F & Li Y (2011) Synthesis of c-aminobutyric acid by expressing Lactobacillus brevis-derived glutamate decarboxylase in the Corynebacterium glutamicum strain ATCC 13032. Biotechnol Lett 33: 2469–2474. Siragusa S, De Angelis M, Di Cagno R, Rizzello CG, Coda R & Gobbetti M (2007) Synthesis of c-aminobutyric acid by lactic acid bacteria isolated from a variety of Italian cheeses. Appl Environ Microbiol 73: 7283–7290. Small PL & Waterman SR (1998) Acid stress, anaerobiosis and gadCB: lessons from Lactococcus lactis and Escherichia coli. Trends Microbiol 6: 214–216. Smith DK, Kassam T, Singh B & Elliott JF (1992) Escherichia coli has two homologous glutamate decarboxylase genes that map to distinct loci. J Bacteriol 174: 5820–5826. Somkuti GA, Renye JA Jr & Steinberg DH (2012) Molecular analysis of the glutamate decarboxylase locus in Streptococcus thermophilus ST110. J Ind Microbiol Biotechnol 39: 957–963. Ueno H (2000) Enzymatic and structural aspects on glutamate decarboxylase. J Mol Catal B Enzym 10: 67–79. Wong CG, Bottiglieri T & Snead OC 3rd (2003) GABA, gamma-hydroxybutyric acid, and neurological disease. Ann Neurol 54: S3–S12.
ª 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
H. Li et al.
Zhang Y, Gao N, Feng Y, Song L & Gao Q (2010) Biotransformation of sodium L-glutamate to c-aminobutyric acid by L. brevis TCCC13007 with two glutamate decarboxylase genes. 4th International Conference on Bioinformatics and Biomedical Engineering. DOI: 10. 1109/ICBBE.2010.5518023.
Supporting Information Additional Supporting Information may be found in the online version of this article: Table S1. Primers for the amplification of gadA gene. Table S2. Primers for the amplification of gadB gene. Table S3. Primers for the direct amplification of genes flanking gadB. Table S4. Primers used in SP-PCR to walk upstream and downstream of gadA. Table S5. Primers used in TAIL-PCR to walk through genomic regions that flanked gadA and akr. Table S6. Thermal cycling parameters used in TAIL-PCR. Table S7. Summary of Primers and probes for qPCR
FEMS Microbiol Lett 349 (2013) 108–116
