BIOLOGY OF REPRODUCTION (2014) 91(1):2, 1–10 Published online before print 22 May 2014. DOI 10.1095/biolreprod.114.119057
Galectin-3 Contributes to Luteolysis by Binding to Beta 1 Integrin in the Bovine Corpus Luteum1 Kazuhisa Hashiba,3 Masahiro Sano,3 Junko Nio-Kobayashi,4 Takuo Hojo,5 Dariusz J. Skarzynski,5 and Kiyoshi Okuda2,3 3
Laboratory of Reproductive Physiology, Graduate School of Environmental and Life Science, Okayama University, Okayama, Japan 4 Laboratory of Histology and Cytology, Hokkaido University Graduate School of Medicine, Sapporo, Japan 5 Department of Reproductive Immunology and Pathology, Institute of Animal Reproduction and Food Research, Polish Academy of Sciences, Olsztyn, Poland
Luteolysis is characterized by a reduction in progesterone (P4) production and tissue degeneration in the corpus luteum (CL). One of major events during luteolysis is luteal cell death. Galectin-3, a ubiquitously expressed protein involved in many cellular processes, serves as an antiapoptotic and/or proapoptotic factor in various cell types. Although galectin-3 is detected in the bovine CL, its role remains unclear. The expression of galectin-3 in the bovine CL was higher at the regressed stage than at the other luteal stages. Galectin-3 was localized on luteal steroidogenic cells (LSCs). When cultured LSCs were exposed to prostaglandin F2alpha (PGF) for 48 h, the expression and secretion of galectin-3 increased. When the cultured LSCs were treated with galectin-3 for 24 h, cleaved caspase-3 expression was increased, and the cell viability was decreased, whereas P4 production did not change. Beta 1 integrin, a target protein of galectin-3, was expressed in bovine CL and possessed glycans, which galectin-3 binds. Furthermore, galectin-3 bound to glycans of luteal beta 1 integrin. The decreased cell viability of cultured LSCs by galectin-3 was suppressed by beta 1 integrin antibody. The overall findings suggest that the secreted galectin3 stimulated by PGF plays a role in structural luteolysis by binding to beta 1 integrin. apoptosis, corpus luteum, galectin, glycan, luteolysis
INTRODUCTION The corpus luteum (CL) is a transient endocrine gland that is essential for the regulation of ovarian cycles as well as for the establishment of pregnancy. If pregnancy does not occur, regression of the CL (luteolysis) is initiated by the uterine prostaglandin F2a (PGF) in ruminants [1]. Luteolysis is characterized by a reduction in progesterone (P4) production (functional luteolysis) followed by luteal cell death (structural luteolysis) [2]. The major event that causes structural luteolysis is luteal cell death (apoptosis) [3–5]. Apoptosis is a highly 1 Supported by a Grant-in-Aid for Scientific Research (No. 24380155) of the Japan Society for the Promotion of Science (JSPS). 2 Correspondence: Kiyoshi Okuda, Laboratory of Reproductive Physiology, Graduate School of Environment and Life Science, Okayama University, Tsushima Naka Kita-ku, 1-1-1, Okayama 700-8530, Japan. E-mail: [email protected]
Received: 4 March 2014. First decision: 25 March 2014. Accepted: 9 May 2014. Ó 2014 by the Society for the Study of Reproduction, Inc. eISSN: 1529-7268 http://www.biolreprod.org ISSN: 0006-3363
1
Article 2
Downloaded from www.biolreprod.org.
conserved mechanism that allows an organism to tightly control cell numbers and tissue size [6]. Luteal regression is triggered by complex factors. Since progesterone is one of the survival factors in the bovine corpus luteum [7], functional luteolysis could be a cause of structural luteolysis. Many cytokines, including tumor necrosis factor a (TNF) and interferon c (IFNG), secreted by immune cells, and nitric oxide, produced by luteal endothelial cells, directly induce CL cells to undergo apoptosis [8–10]. Nitric oxide is also known to play a crucial role in functional luteolysis [11]. These reports indicate that many molecules are involved in structural luteolysis. However, the indirect effects of the above luteolytic factors on luteolysis are not well understood. Galectin-3 is one of the b-galactoside-binding proteins that bind to target molecules through conserved carbohydrate recognition domains [12]. In various cell types, galectin-3 is expressed in the nucleus or cytoplasm, on the cell membrane, and in the extracellular matrix [13]. Galectin-3 is involved in many cellular processes, such as apoptosis and proliferation [14–16]. Intracellular galectin-3 generally mediates antiapoptotic effects through carbohydrate-independent processes [17– 20], whereas extracellular galectin-3 binds to cell surface oligosaccharides and thereby induces apoptosis [14, 21, 22]. Integrins are cell surface glycoproteins that mediate adhesion to the extracellular matrix, and integrin signaling regulates cell proliferation, differentiation, and apoptosis [23]. In mammals, they are composed of 18 a-subunits and 8 bsubunits [24]. Among these integrins, 12 members containing the b1 subunit are involved in various biological functions [25]. b1 integrin is a glycan to which galectin-3 binds [26], and extracellular galectin-3 induces apoptosis by binding to b1 integrin in T cells and tumor cells [14, 22]. Therefore, interaction between galectin-3 and b1 integrin might also play a role in inducing apoptosis of luteal cells. In cow, galectin-3 has been identified in the uterus, cervix, oviduct, atretic follicles, and CL [27]. Galectin-3 protein localization has been immunohistochemically detected in the regressing CL [27], but its physiological role is still unclear. Based on these reports, we hypothesized that galectin-3 is involved in the apoptosis of luteal cells during luteolysis. In the present study, to test this hypothesis, we examined 1) cyclic changes in the galectin-3 mRNA and protein expressions, 2) the effect of luteolytic factors on expression of galectin-3 mRNA and protein in cultured midluteal steroidogenic cells (LSCs), 3) subcellular localization of galectin-3 in the regressed CL and the effect of PGF on the secretion of galectin-3 in LSCs, 4) the effect of galectin-3 on P4 production and cell viability in LSCs, 5) the expression and glycan structure of b1 integrin in bovine CL throughout the estrous
ABSTRACT
HASHIBA ET AL. TABLE 1. Primers for real-time PCR. Primer (5 0 -3 0 )a
Gene LGALS-3 ITGB1 MRPL4 COX4 GAPDH TUBB a
F: R: F: R: F: R: F: R: F: R: F: R:
TCGCATGCTGATAACAATCC GAAGCGTGGGTTAAAGTGGA GCAGTTTGTGGATCCCTGAT AAACGATGCCACCAAGTTTC GGCTCAAGACCTTCAACCTG GCGTGTAACGTGAGTCATGC AAGGAGAAGGCTTCCTGGAG CCACCGTCTTCCACTCATTT CACCCTCAAGATTGTCAGCA GGTCATAAGTCCCTCCACGA GAGGCCACCGGTAACAAGTA ACTCTGGCCAAACACGAAGT
Accession no.
Product (base pairs)
BC148136
106
BC114107
109
BC108102
138
BC102733
118
BC102589
103
BC105401
129
F, forward; R, reverse.
cycle, and 6) the interaction between b1 integrin and galectin-3 in LSCs.
these stages, CL tissues were immediately separated from the ovaries, frozen rapidly in liquid nitrogen, and then stored at 808C until processed for mRNA and protein analysis. For immunohistochemistry, pieces of CL tissue were fixed in 10% (vol/vol) neutral formalin (pH 7.4) for 20–24 h and then embedded in paraffin. For cell culture, ovaries with CLs were submerged in ice-cold physiological saline and transported to the laboratory.
MATERIALS AND METHODS
Luteal Cell Isolation
Ovaries were collected from Holstein cows at a local slaughterhouse within 10–20 min after exsanguinations. The stage of the estrous cycle was defined as described previously [28]. Ovaries with CLs were classified into the early (Days 2–3 after ovulation), developing (Days 5–6), mid (Days 8–12), late (Days 15–17), and regressed (Days 19–21) luteal stages. After determination of
The CLs classified in the midluteal stage were used for cell culture. Luteal tissue was enzymatically dissociated, and luteal cells were cultured as described previously [29]. Dissociated luteal cells from CLs were pooled. The luteal cells were suspended in a culture medium, Dulbecco modified Eagle medium, and
FIG. 1. Changes in the relative amounts of galectin-3 expressions. A) Comparison of relative amounts of galectin-3 mRNA determined by quantitative RTPCR in bovine CL tissue throughout the estrous cycle (early, Days 2–3; developing, Days 5–6; mid, Days 8–12; late, Days 15–17; regressed luteal stages [Regress], Days 19–21). Data are the mean 6 SEM for four samples/stage and are expressed as the relative ratio of galectin-3 mRNA to MRPL4 mRNA. B) Representative Western blot bands for galectin-3 and ACTB. Densitometrically analyzed Western blot results in the bovine CL tissue during different luteal phases. Data are the mean 6 SEM for four samples/stage and are expressed as the relative ratio of galectin-3 protein to ACTB protein. Different superscript letters indicate significant difference (P , 0.05), as determined by ANOVA followed by Bonferroni multiple comparison test.
2
Article 2
Downloaded from www.biolreprod.org.
Collection of Bovine CL
GALECTIN-3 IN CL DURING LUTEOLYSIS
Ham F-12 medium (D/F; 1:1 [vol/vol]; D8900; Sigma-Aldrich Corp., St. Louis, MO), containing 5% calf serum (16170-078; Life Technologies, Grand Island, NY) and 20 lg/ml gentamicin (15750-060; Life Technologies) under 5% CO2 in air. Cell viability was greater than 85% as assessed by trypan blue exclusion. The cells in the cell suspension consisted of about 70% small LSCs, 20% large LSCs, 10% endothelial cells or fibrocytes, and no erythrocytes. In this study, these cells were defined as LSCs.
(Dainippon Pharmaceutical, Osaka, Japan) and/or 2.5 nM recombinant bovine IFNG (Kindly donated by Dr. S. Inumaru, NIAH, Ibaraki, Japan) or 1.0 lM PGF (P7652; Sigma-Aldrich) for 12, 24, 48, and 72 h. The doses for treatments were selected based on previous reports [30, 31]. After the culture, the expression of galectin-3 mRNA was determined by quantitative RT-PCR. The galectin-3 protein expression was assessed by Western blotting in cells treated with PGF for 48 h.
Cell Culture
Experiment 3: Subcellular Localization of Galectin-3 in the Regressed CL and Effect of PGF on the Secretion of Galectin-3 in Cultured Mid-LSCs
Dispersed luteal cells (2.0 3 105 /ml) were cultured in D/F medium containing 5% calf serum in 24-well plates (662160; Greiner Bio-One, Frickenhausen, Germany) for quantitative RT-PCR, 75-cm2 culture flasks (658175; Greiner Bio-One) for Western blotting, or 96-well culture dishes (3860-096; Iwaki, Chiba, Japan) for cell viability test. After 24 h of culture, the medium was replaced with D/F medium without phenol red (D2906; SigmaAldrich) containing 0.1% BSA, 5 ng/ml sodium selenite (S5261; SigmaAldrich), and 5 lg/ml holo-transferrin (T3400; Sigma-Aldrich), and the following experiments were carried out.
To elucidate the subcellular localization of galectin-3 in the regressed CL, the regressed CL tissue was fractionated into membrane and cytoplasm fractions. The CL tissues were homogenized on ice in the homogenization buffer by a tissue homogenizer (Physcotron [NS-50; NITI-ON Inc., Chiba, Japan]), followed by a filtration with a metal wire mesh (150 lm). For protein analysis, nuclei were removed from the tissue homogenates by centrifugation at 700 3 g for 5 min. The resultant supernatant was fractionated into membrane and cytoplasmic cell fractions by centrifugation at 100 000 3 g for 1 h. The membrane and cytoplasm fractions were detected expression of galectin-3 protein by Western blotting. Validation of the cell fractionation was performed by reprobing with tumor necrosis factor receptor 1 (TNFR1) antibody (ab19139; Abcam, Cambridge, UK) as a plasma membrane marker and ACTB antibody (A2228; Sigma-Aldrich) as a cytoplasm marker. Since TNFR1 is expressed in the bovine CL [32] and generally known as a membrane receptor, TNFR1 antibody was used for plasma membrane marker. To examine whether PGF induces secretion of the galectin-3 in LSCs, after 48 h of treatment with PGF (1.0 lM), cultured LSCs were treated with a noncompeting saccharide, 0.1 M sucrose, and a competing saccharide, 0.1 M blactose, for 4 h. LSCs were collected and subsequently analyzed galectin-3 protein by Western blotting.
Experiment 1: Cyclic Changes in the Galectin-3 mRNA and Protein Expressions Galectin-3 mRNA and protein expressions of in each CL tissues (early, n ¼ 4; developing, n ¼ 4; mid, n ¼ 4; late, n ¼ 4; regressed, n ¼ 4) were examined by quantitative RT-PCR and Western blotting. Galectin-3 protein localization of in each CL tissues (early, n ¼ 3; mid, n ¼ 3; regressed, n ¼ 3) was analyzed by immunohistochemistry.
Experiment 2: Effect of Luteolytic Factors on Expression of Galectin-3 mRNA and Protein in Cultured Mid-LSCs To clarify regulatory factors of galectin-3 mRNA and protein in cultured mid-LSCs, the cells were exposed to 2.3 nM recombinant human TNF
3
Article 2
Downloaded from www.biolreprod.org.
FIG. 2. Representative images of the localization of galectin-3 protein in bovine CL throughout the estrous cycle. Black arrows indicate macrophages. Bars ¼ 50 lm.
HASHIBA ET AL.
Experiment 4: Effect of Galectin-3 on P4 Production and Cell Viability in Cultured Mid-LSCs
Quantitative RT-PCR Total RNA was extracted from CL tissues and cells using TRIsure (BIO38032; BI-OLINE) according to the manufacturer’s directions. One microgram of each total RNA was reverse transcribed using a ThermoScript RT-PCR System (no. 11146-016; Invitrogen, Carlsbad, CA), and 10% of the reaction mixture was used in each PCR using specific primers for galectin-3 from the bovine sequence (Table 1). Quantification of mRNA expression was determined by iQ SYBR Green Supermix (no. 170-8880; Bio-Rad Laboratories, Inc., Berkeley, CA) starting with 2 ng of reverse-transcribed total RNA. For quantification of the mRNA expression levels, PCR was performed under the following conditions: 958C for 15 min, followed by 45 cycles of 948C for 15 sec, 608C for 20 sec, and 728C for 15 sec. Use of the QuantiTect SYBR Green PCR system at elevated temperatures resulted in reliable and sensitive quantification of the RT-PCR products with high linearity (Pearson correlation coefficient: r . 0.99). MRPL4 mRNA expression was used as an internal control. To analyze the relative level of expression of each mRNA, the 2-DDCT method was used [34]. In the present study, we compared four housekeeping genes in the CL by quantitative PCR. The four genes evaluated were mitochondrial ribosomal protein L4 (MRPL4), cytochrome c oxidase subunit IV (COX4), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and tubulin beta 2 (TUBB) (Table 1). To determine the most stable transcribed housekeeping gene, Normfinder software (downloaded at http://moma.dk/ normfinder-software) was used. This software calculates the gene expression stability measure (M) and determines the most stable housekeeping gene via a stepwise exclusion or ranking process resulting in the selection of the most stable housekeeping genes for the specific tissue. Since MRPL4 was the most suitable, with an average expression stability of M ¼ 0.171, followed by COX4 (M ¼ 0.261) . TUBB (M ¼ 0.280) . GAPDH (M ¼ 0.762), MRPL4 was used as a housekeeping gene for further experiments.
To reveal the effect of galectin-3 on P4 production and cell viability in LSCs, the cells were exposed to recombinant galectin-3 (0.01, 0.1, 1.0, and 5.0 lg/ml; R&D Systems, Inc., Minneapolis, MN) for 24 h. The cell viability was determined by Dojindo Cell Counting Kit including WST-1 (no. 345–06463; Dojindo, Kumamoto, Japan) as described previously [33]. Progesterone concentrations in the media of LSCs were measured by enzyme immunoassay. Expression of cleaved caspase-3 was analyzed by Western blotting in cells treated with recombinant galectin-3 (1.0 lg/ml) for 24 h.
Experiment 5: Expression and Glycan Structure of b1 Integrin in Bovine CL Throughout the Estrous Cycle The membrane fractions of the CLs and the LSCs were lysed in a lysis buffer consisting of 20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1.0% Triton X 100, 10% glycerol, and protease inhibitor cocktail (11 697 498 001; Roche; Basel, Switzerland). The lysates (2.0 mg of protein) were incubated with b1 integrin antibody (MAB2000; Millipore, Billerica, MA) and protein-G-beads (MAB2000; Millipore) at 48C for 24 h. The beads were washed with lysis buffer three times, and immunoprecipitated proteins were analyzed by lectin blotting.
Experiment 6: Interaction Between b1 Integrin and Galectin-3 in Cultured Mid-LSCs To investigate whether galectin-3 decreases cell viability via b1 integrin in LSCs, after 1 h of treatment with b1 integrin neutralizing antibody (MAB1965; Millipore) or anti-mouse IgG diluted at 1:1000, cultured LSCs were treated with recombinant galectin-3 (1.0 lg/ml) for 24 h, and the cell viability was determined by WST-1.
Western Blotting Protein concentrations in the lysates were determined by using BSA as a standard. The proteins were then solubilized in SDS gel-loading buffer (50 mM Tris-HCl, 2% SDS [31607-94, Nacalai Tesque, Tokyo, Japan], 10% glycerol,
4
Article 2
Downloaded from www.biolreprod.org.
FIG. 3. Effects of luteolytic factors on the expression of galectin-3 mRNA and protein in LSCs. A) LSCs were treated with PGF (1.0 lM) or TNF (2.3 nM) and/or IFNG (2.5 nM) for 12, 24, 48, and 72 h. Data are expressed as the relative ratio of galectin-3 mRNA to MRPL4 mRNA levels. B) Representative Western blot bands for galectin-3 and ACTB in the cells treated with PGF (1.0 lM) for 48 h. The resultant signal was detected by chemiluminescence and quantitated by computer-assisted densitometry. Data are expressed as the relative ratio of galectin-3 protein to ACTB protein. All values are the means 6 SEM. All of the experiments were repeated more than three times. The data were statistically analyzed using ANOVA followed by Bonferroni multiple comparison test. Asterisks indicate significant differences compared with control for 48 h (P , 0.05).
GALECTIN-3 IN CL DURING LUTEOLYSIS NA931; Amersham Biosciences; 1:10 000 for b1 integrin or 1:40 000 for ACTB]) for 1 h at room temperature. After washing again with TBS-T, the signal was detected by chemiluminescence using Immobilon Western Chemiluminescent HRP Substrate (P36599; Millipore). ACTB protein expression was used as an internal control. The intensity of the immunological reaction in the tissues was estimated by measuring the optical density in the defined area by computerized densitometry using Image Lab Software version 4.0 (Bio-Rad Laboratories).
Immunohistochemistry The sections, at 5-lm thickness, were dewaxed and washed in phosphatebuffered saline. Subsequently, the sections were incubated at room temperature with 3% hydrogen peroxide in distilled water for 20 min and Avidin/Biotin blocking solution (Vector Laboratories Inc., Burlingame, CA) for 15 min for each reagent. Then the sections were incubated with normal goat serum for 60 min at room temperature followed by galectin-3 antibody (1:200) at 48C overnight. After washing twice in PBS, the sections were incubated with biotinylated anti-rabbit IgG (1:500; Vector Laboratories) for 60 min at room temperature. The reaction sites were visualized using Vectastain ABC Elite kit (Vector Laboratories) for 60 min at room temperature and ImmPACT 3, 3 0 Diaminobenzidine (DAB) Peroxidase Substrate Kit (Vector Laboratories) for 5 min. The sections were counterstained for 2 min with hematoxylin and observed under a light microscope (BX51; Olympus Corporation, Tokyo, Japan).
WST-1, a kind of MTT (3-[4,5-dimethyl-2 thiazolyl]-2,5-diphenyl-2 Htetrazolium bromide), is a yellow tetrazolium salt that is reduced to formazan by live cells containing active mitochondria. The culture medium was replaced with 100 ll D/F without phenol red medium-BSA, and a 10-ll aliquot (0.3% WST-1, 0.2 mM 1-methoxy PMS in PBS, pH 7.4) was added to each well. The cells were then incubated for 4 h at 388C. The absorbance was read at 450 nm using a microplate reader (Model 450; Bio-Rad Laboratories). In this assay, data were expressed as percentages of the appropriate control values.
P4 Determination Concentrations of P4 were determined directly from the cell culture media with an enzyme immunoassay, as described previously [30]. The standard curve ranged from 0.391 to 100 ng/ml, and the median effective dose (ED50) of the assay was 4.5 ng/ml. The intra- and interassay coefficients of variation were 5.8% and 9.3%, respectively.
Lectin Blotting
FIG. 4. A) Subcellular localization of galectin-3 in the regressed CL. Regressed CL was fractionated into the membrane and cytoplasm fractions. Galectin-3 is shown in the upper lane. Staining for ACTB and TNFR1 was used to assess the purity of the cytoplasm and membrane fractions, respectively. B) Effect of PGF on the secretion of galectin-3 in cultured mid-LSCs. Cultured mid-LSCs were treated with 0.1 M sucrose and 0.1 M b-lactose (lactose) for 4 h after treatment with PGF (1.0 lM) for 48 h. The galectin-3 protein expression was assessed by Western blotting analysis. Representative Western blot bands for galectin-3 and ACTB are shown. All values are the means 6 SEM. All of the experiments were repeated more than three times, and different superscript letters indicate significant difference (P , 0.05), as determined by ANOVA followed by Bonferroni multiple comparison test.
Protein samples were subsequently separated by SDS-PAGE. Separated proteins were transferred onto PVDF membrane. The membrane was blocked with 5% BSA in TBS-T and then reacted with 1.0 lg/ml of HRP-conjugated L4-PHA lectin (J212; J-OIL MILLS, Tokyo, Japan) in TBS-T for 1 h. After washing again with TBS-T, the reactive protein bands were detected by chemiluminescence using Immobilon Western Chemiluminescent HRP Substrate.
Galectin-3 Overlay Assay Cell lysates (2.0 mg of protein) were immunoprecipitated with b1 integrin antibody and protein-G-beads, as described above. Precipitated proteins were separated by SDS-PAGE and subsequently transferred to a PVDF membrane. The membrane was blocked with 5% BSA in TBS-T and then exposed to biotin-conjugated galectin-3. Biotinylated label of glectin-3 was performed using the EasyLink Biotin Conjugation Kit (ab102865; Abcam), according to the manufacturer’s instruction. After washing with TBS-T, the membrane was incubated with streptavidin conjugated to HRP. After washing again with TBST, the reactive protein bands were detected by chemiluminescence using Immobilon Western Chemiluminescent HRP Substrate.
and 1% b-mercaptoethanol [137–06862; Wako Pure Chemical Industries, Ltd], pH 6.8) and heated at 958C for 10 min. Samples (30 lg protein) were separated on SDS-PAGE and then transferred to a PVDF membrane (RPN303F; GE Healthcare, Little Chalfont, Buckinghamshire, UK). The membrane was washed in TBS-T (0.1% Tween 20 in TBS [25 mM Tris-HCl, 137 mM NaCl, pH 7.5]) and incubated in blocking buffer (5% nonfat dry milk in TBS-T) for 1 h at room temperature. After washing, the membranes were incubated with galectin-3 antibody diluted at 1:1000 (sc-20157; Santa Cruz Biotechnology Inc., Santa Cruz, CA), cleaved caspase-3 antibody diluted at 1:1000 (no. 9661; Cell Signaling Technology Inc., Beverly, MA), TNFR1 antibody diluted at 1:1000, b1 integrin antibody diluted at 1:1000, or ACTB antibody diluted at 1:10 000 overnight at 48C. After washing with TBS-T, the membrane was incubated with the appropriate secondary antibodies (anti-rabbit Ig, HRP-linked whole antibody produced by donkey [NA934; Amersham Biosciences Corp., San Francisco, CA; 1:10 000] for galectin-3, cleaved caspase-3, and TNFR1 protein; anti-mouse Ig, HRP-linked whole antibody produced by sheep [no.
Statistical Analysis All experimental data are shown as the mean 6 SEM. The statistical significance of differences in the expression of galectin-3 mRNA and protein, cleaved caspase-3 protein, P4 production, and the viability of LSCs were assessed by analysis of a one-way ANOVA followed by Bonferroni multiple comparison test. Probabilities less than 5% (P , 0.05) were considered significant.
5
Article 2
Downloaded from www.biolreprod.org.
WST-1 Assay
HASHIBA ET AL.
Downloaded from www.biolreprod.org. FIG. 5. Effects of galectin-3 on P4 production (A) and cell viability (B) in LSCs. The cells were treated with recombinant galectin-3 (0, 0.01, 0.1, 1.0, 5.0, lg/ml) for 24 h. C) Representative Western blot bands for cleaved caspase-3 and ACTB in the cells treated with recombinant galectin-3 (1.0 lg/ml) for 24 h. The resultant signal was detected by chemiluminescence and quantitated by computer-assisted densitometry. Protein data are expressed as the relative ratio of cleaved caspase-3 protein to ACTB protein. All values are the means 6 SEM. All of the experiments were repeated more than three times. The data were statistically analyzed using ANOVA followed by Bonferroni multiple comparison test (P , 0.05).
RESULTS
other luteal stages (Fig. 1, A and B; P , 0.05). Galectin-3 was localized mainly in LSCs and macrophage (Fig. 2).
Experiment 1: Cyclic Changes in the Galectin-3 mRNA and Protein Expressions
Experiment 2: Effect of Luteolytic Factors on Expression of Galectin-3 mRNA and Protein in Cultured Mid-LSCs
The expressions of galectin-3 mRNA and protein in the bovine CL were higher at the regressed luteal stage than at the
The expression of galectin-3 mRNA was significantly increased by a treatment with PGF for 48 h (Fig. 3A; P , 0.05) 6
Article 2
GALECTIN-3 IN CL DURING LUTEOLYSIS
viability (Fig. 5B; P , 0.05). Furthermore, the protein expression of cleaved caspase-3 was significantly increased by galectin-3 (1.0 lg/ml; Fig. 5C; P , 0.05).
but not by TNF and/or IFNG, compared with control for 12, 24, 48, and 72 h. The expression of galectin-3 protein was also significantly increased by a treatment with PGF for 48 h (Fig. 3B; P , 0.05).
Experiment 5: Expression and Glycan Structure of b1 Integrin in Bovine CL Throughout the Estrous Cycle
Experiment 3: Subcellular Localization of Galectin-3 in the Regressed CL and Effect of PGF on the Secretion of Galectin-3 in Cultured Mid-LSCs
b1 integrin mRNA and protein in bovine CL were expressed throughout the estrous cycle (Fig. 6, A and B). b1 integrin in both bovine CL and cultured mid-LSCs possessed glycans, which galectin-3 binds, as revealed by lectin blotting using L4PHA (Fig. 6C).
The expression of galectin-3 protein was detected mainly in the membrane fraction. ACTB was detected mostly in the cytoplasmic fraction, and TNFR1 was detected in the membrane fraction (Fig. 4A). The expression of galectin-3 protein was significantly increased by PGF. PGF-induced galectin-3 expression was significantly decreased by b-lactose (Fig. 4B; P , 0.05).
Experiment 6: Interaction Between b1 Integrin and Galectin-3 in Cultured Mid-LSCs Galectin-3 bound directly to b1 integrin in the isolated midluteal cells (Fig.7 A). Although cultured LSC viability was decreased by galectin-3, the viability of the LSC treated with b1 neutralizing integrin antibody was not changed by galectin3 compared with control (Fig. 7B; P , 0.05).
Experiment 4: Effect of Galectin-3 on P4 Production and Cell Viability in Cultured Mid-LSCs Galectin-3 did not affect P4 production (Fig. 5A), whereas galectin-3 (1.0 and 5.0 lg/ml) significantly decreased the cell 7
Article 2
Downloaded from www.biolreprod.org.
FIG. 6. Changes in the relative amounts and glycan structure of b1 integrin. A) Comparison of relative amounts of b1 integrin mRNA determined by quantitative RT-PCR in bovine CL tissue throughout the estrous cycle. Data are the mean 6 SEM for four samples/stage and are expressed as the relative ratio of b1 integrin mRNA to MRPL4 mRNA. B) Representative Western blot bands for b1 integrin and ACTB. Densitometrically analyzed Western blot results in the bovine CL tissue during different luteal phases. C) L4-PHA lectin blot analysis of glycans attached to b1 integrin. Purified b1 integrin proteins were subjected to blotting analysis probed either b1 integrin antibody or plant lectin (L4-PHA for detecting oligomers of D-GalNac). Data are the mean 6 SEM for four samples/stage and are expressed as the relative ratio of galectin-3 protein to ACTB protein.
HASHIBA ET AL.
DISCUSSION
stage than at the other luteal stages, and its protein was localized in LSCs and macrophages (Figs. 1, 2). Since galectin3 is commonly used as a macrophage maker [38], galectin-3positive cells besides LSCs were judged as macrophages. Since the bone marrow-derived macrophages of galectin-3-deficient mouse exhibited defective phagocytosis of apoptotic cells, galectin-3 in macrophages is thought to play important roles of phagocytosis [39]. Moreover, luteolysis involves phagocytic elimination of apoptotic luteal cells by luteal macrophages in rat [40]. Based on the above findings, galectin-3 may also be required for phagocytosis by macrophages in the regressing CL in cattle. The localization of galectin-3 on the membrane might not completely be supported because a faint band of b-actin was detected in plasma membrane fraction (Fig. 4A). Therefore, we further investigated whether galectin-3 was localized on LSCs stimulated by PGF (a mimic luteal regression; Fig 4B). Galectin-3 binds to N-acetyllactosamine (LacNAc) structure in glycans, and lactose is a saccharide that has structure similar to LacNAc and inhibits the binding to galectin-3 [13]. On the other hand, since sucrose is a saccharide that does not bind to galectin-3, sucrose is commonly used as a negative control of
Galectin-3 is a ubiquitously expressed protein that is involved in cell survival and death in many cell types [35]. In the mice, since regressing CL consisted of galectin-3positive luteal cells, galectin-3 is suggested to be involved in luteal regression [36]. Although galectin-3 has been detected immunohistochemically in the bovine CL throughout the estrous cycle [27], its regulatory factor, target protein, and roles in LSCs are unclear. Galectin-3 is present in the cell nucleus or cytoplasm, on the cell surface, and also in the extracellular environment [15]. Galectin-3 has been demonstrated to play conflicting roles in cell viability, that is, cell survival and apoptosis [15]. The two different actions of galectin-3 on cell viability depend on its subcellular localization [13]. Intracellular galectin-3 generally protects cells against apoptosis through carbohydrate-independent mechanisms, whereas extracellular galectin-3 binds to cell surface oligosaccharides and induces apoptosis [14, 21, 22, 37]. The major event that causes the structural luteolysis is death of LSCs by apoptosis [5]. In the present study, the expression of galectin-3 in the bovine CL was higher at the regressed luteal 8
Article 2
Downloaded from www.biolreprod.org.
FIG. 7. Interaction between b1 integrin and galectin-3 in cultured mid-LSCs. A) Galectin-3 overlay assay of glycans attached to b1 integrin. Immunoprecipitated b1 integrin proteins were subjected to blotting analysis probed either b1 integrin antibody or biotinylated galectin-3. As shown, biotin-conjugated galection-3 bound to b1 integrin from the mid-LSCs. B) Cultured mid-LSCs were treated with recombinant galectin-3 (1.0 lg/ml) for 24 h after treatment with b1 integrin function blocking antibody or mouse IgG (diluted at 1:1000) for 1 h. All values are the means 6 SEM. All of the experiments were repeated more than three times, and different superscript letters indicate significant difference (P , 0.05), as determined by ANOVA followed by Bonferroni multiple comparison test.
GALECTIN-3 IN CL DURING LUTEOLYSIS
lactose [22]. In the present study, the expression of galectin-3 protein stimulated by PGF was decreased by lactose but not sucrose (Fig 4B), and the Western blot band of membrane fraction was obviously stronger than that of cytosol fraction (Fig. 4A). The above findings strongly suggest that galectin-3 is localized mainly on the plasma membrane in the regressed CL. In various cells types, galectin expression is induced by cytokines as TNF, IFNG, and interleukin 1 b [41–44]. In luteolysis, TNF and IFNG produced by immune cells play an important role [5]. Not only cytokines (TNF and IFNG) but also PGF are known as important luteolytic factors [5, 33]. Since galectin-3 expression was higher at the regressed luteal stage (Figs. 1, 2), we hypothesized that TNF, IFNG, or PGF affect the expression and secretion of galectin-3 in LSCs. In the present study, the expression and secretion of galectin-3 in LSCs was stimulated by PGF at 48 h. PGF is elevated as a series of pulses in uterine venous blood at Days 18–19 after ovulation [1]. In addition, galectin-3 expression in bovine CL was increased at the regressed stage (Fig. 1). Based on the above findings, PGF, which triggers the induction of luteolysis during Days 18–19 [1], may stimulate the expression and secretion of galectin-3 by LSCs during Days 19–21. Furthermore, galectin-3 localized on plasma membrane in the regressed CL may be the result of secretion of galectin-3 from LSCs in response to PGF. Luteolysis is characterized by a phase of inhibited P4 production (functional luteolysis), followed by a phase of decreasing in luteal size (structural luteolysis), when cells of the CL undergo apoptosis [1]. P4 production by LSCs treated with galectin-3 did not change in spite of decreasing LSC viability. There are no reports that galectin-3 affects a hormone production by any types of cells. One might only suppose that the cell death of LSCs started occurring at around 24 h after galectin-3 treatment. Galectin-3 may contribute to only structural luteolysis, not to functional luteolysis. Galectin-3 binds to glycoproteins, such as integrins, neural cell adhesion molecule, and CD98 [35]. In addition, integrins are expressed in luteal cells of rodents and granulosa and theca cells of ruminants [23]. b1 integrin is reported to be involved in apoptosis induced by galectin-3 in colonic epithelial cells [22]. Based on the above findings, we hypothesized that the apoptosis in LSCs induced by galectin-3 requires b1 integrin. As expected, b1 integrin was expressed and possesses glycans, which galectin-3 binds in bovine CL throughout the estrous cycle. However, b1 integrin expression and glycan structure did not change throughout the estrous cycle (Fig. 6). This may be the reason why luteolysis is controlled by the change of galectin-3 expression during the estrous cycle but not by changes in the expression or glycan structure of b1 integrin. We confirmed that galectin-3 induces LSC death by binding to b1 integrin (Fig. 7), as shown in colon epithelial cells and T cells [14, 22]. Integrins, including b1 integrin, bind to extracellular matrix (fibronectin and collagen), and galectin-3 inhibits the binding of the integrins to the extracellular matrix [45]. A variety of cell types undergo apoptosis by lack of extracellular matrix attachment, which is termed anoikis [24]. These findings suggest that galectin-3 produced by LSCs inhibits binding of integrins to extracellular matrix and induces anoikis in LSCs. The overall findings suggest that galectin-3 increased by PGF induces apoptosis in bovine LSCs via b1 integrin, contributing to structural luteolysis.
ACKNOWLEDGMENT We are grateful to Dainippon Pharmaceutical, Osaka, Japan, for recombinant human TNF (HF-13) and Dr. S. Inumaru of the NIAH, Ibaraki, Japan, for recombinant bovine IFNG.
REFERENCES
9
Article 2
Downloaded from www.biolreprod.org.
1. McCracken JA, Custer EE, Lamsa JC. Luteolysis: a neuroendocrinemediated event. Physiol Rev 1999; 79:263–323. 2. Juengel JL, Garverick HA, Johnson AL, Youngquist RS, Smith MF. Apoptosis during luteal regression in cattle. Endocrinology 1993; 132: 249–254. 3. Knickerbocker JJ, Wiltbank MC, Niswender GD. Mechanisms of luteolysis in domestic livestock. Domest Anim Endocrinol 1988; 5: 91–107. 4. Bacci ML, Barazzoni AM, Forni M, Costerbosa GL. In situ detection of apoptosis in regressing corpus luteum of pregnant sow: evidence of an early presence of DNA fragmentation. Domest Anim Endocrinol 1996; 13: 361–372. 5. Pate JL, Johnson-Larson CJ, Ottobre JS. Life or death decisions in the corpus luteum. Reprod Domest Anim 2012; 47(suppl 4):297–303. 6. Hengartner MO. The biochemistry of apoptosis. Nature 2000; 407: 770–776. 7. Okuda K, Korzekwa A, Shibaya M, Murakami S, Nishimura R, Tsubouchi M, Woclawek-Potocka I, Skarzynski DJ. Progesterone is a suppressor of apoptosis in bovine luteal cells. Biol Reprod 2004; 71:2065–2071. 8. Rueda BR, Tilly KI, Botros IW, Jolly PD, Hansen TR, Hoyer PB, Tilly JL. Increased bax and interleukin-1b-converting enzyme messenger ribonucleic acid levels coincide with apoptosis in the bovine corpus luteum during structural regression. Biol Reprod 1997; 97:186–193. 9. Penny LA, Armstrong D, Bramley TA, Webb R, Collins RA, Watson ED. Immune cells and cytokine production in the bovine corpus luteum throughout the oestrous cycle and after induced luteolysis. J Reprod Fertil 1999; 115:87–96. 10. Vega M, Urrutia L, In˜iguez G, Gabler F, Devoto L, Johnson MC. Nitric oxide induces apoptosis in the human corpus luteum in vitro. Mol Hum Reprod 2000; 6:681–687. 11. Skarzynski DJ, Piotrowska-Tomala KK, Lukasik K, Galvao A, Farberov S, Zalman Y, Meidan R. Growth and regression in bovine corpora lutea: regulation by local survival and death pathways. Reprod Domest Anim 2013; 48(suppl 1):25–37. 12. Yang RY, Rabinovich GA, Liu FT. Galectins: structure, function, and therapeutic potential. Expert Rev Mol Med 2008; 10:e17. 13. Dumic J, Dabelic S, Flo¨gel M. Galectin-3: an open-ended story. Biochim Biophys Acta 2006; 1760:616–635. 14. Fukumori T, Takenaka Y, Hogan V, Inohara H, Kagawa S, Raz A. CD29 and CD7 mediate galectin-3-induced type II T-cell apoptosis. Cancer Res 2003; 63:8302–8311. 15. Nakahara S, Oka N, Raz A. On the role of galectin-3 in cancer apoptosis. Apoptosis 2005; 10:267–275. 16. Yang H, Lei C, Cheng C, Feng Y, Zhang W, Petracco RG, Sak S. The antiapoptotic effect of galectin-3 in human endometrial cells under the regulation of estrogen and progesterone. Biol Reprod 2012; 87:1–7. 17. Matarrese P, Tinari N, Semeraro ML, Natoli C, Iacobelli S, Malorni W. Galectin-3 overexpression protects from cell damage and death by influencing mitochondrial homeostasis. FEBS Lett 2000; 473:311–315. 18. Moon BK, Lee YJ, Battle P, Jessup JM, Raz A, Kim HR. Galectin-3 protects human breast carcinoma cells against nitric oxide-induced apoptosis. Am J Pathol 2001; 159:1055–1060. 19. Mazurek N, Sun YJ, Liu KF, Gilcrease MZ, Schober W, Nangia-Makker P, Raz A, Bresalier RS. Phosphorylated galectin-3 mediates tumor necrosis factor-related apoptosis-inducing ligand signaling by regulating phosphatase and tensin homologue deleted on chromosome 10 in human breast carcinoma cells. J Biol Chem 2007; 282:21337–21348. 20. Nangia-Makker P, Raz T, Tait L, Hogan V, Fridman R, Raz A. Galectin-3 cleavage: a novel surrogate marker for matrix metalloproteinase activity in growing breast cancers. Cancer Res 2007; 67:11760–11768. 21. Suzuki Y, Inoue T, Yoshimaru T, Ra C. Galectin-3 but not galectin-1 induces mast cell death by oxidative stress and mitochondrial permeability transition. Biochim Biophys Acta 2008; 1783:924–934. 22. Zhuo Y, Chammas R, Bellis SL. Sialylation of b1 integrins blocks cell adhesion to galectin-3 and protects cells against galectin-3-induced apoptosis. J Biol Chem 2008; 283:22177–22185. 23. Monniaux D, Huet-Calderwood C, Le Bellego F, Fabre S, Monget P, Calderwood DA. Integrins in the ovary. Semin Reprod Med 2006; 24: 251–261.
HASHIBA ET AL.
35. 36.
37. 38.
39.
40.
41. 42. 43.
44.
45.
10
real-time quantitative PCR and the 2DDCT method. Methods 2001; 25: 402–408. Krzeslak A, Lipinska A. Galectin-3 as a multifunctional protein. Cell Mol Biol Lett 2004; 9:305–328. Nio J, Iwanaga T. Differential cellular localization of galectin-1 and galectin-3 in the regressing corpus luteum of mice and their possible contribution to luteal cell elimination. J Histochem Cytochem 2010; 58: 741–749. Liu FT, Rabinovich GA. Galectins as modulators of tumour progression. Nat Rev Cancer 2005; 5:29–41. De Boer RA, Voors AA, Muntendam P, van Gilst WH, van Veldhuisen DJ. Galectin-3: a novel mediator of heart failure development and progression. Eur J Heart Fail 2009; 11(9):811–817. Sano H, Hsu DK, Apgar JR, Yu L, Sharma BB, Kuwabara I, Izui S, Liu FT. Critical role of galectin-3 in phagocytosis by macrophages. J Clin Invest 2003; 112:389–397. Kato S, Shiratsuchi A, Nagaosa K, Nakanishi Y. Phosphatidylserine- and integrin-mediated phagocytosis of apoptotic luteal cells by macrophages of the rat. Dev Growth Differ 2005; 47:153–161. Cherayil BJ, Weiner SJ, Pillai S. The Mac-2 antigen is a galactose-specific lectin that binds IgE. J Exp Med 1989; 170:1959–1972. Hughes RC. Secretion of the galectin family of mammalian carbohydratebinding proteins. Biochim Biophys Acta 1999; 1473:172–185. Deschildre C, Ji JW, Chater S, Dacheux F, Selva J, Albert M, Bailly M, Hatey F, Benahmed M. Expression of galectin-3 and its regulation in the testes. Int J Androl 2007; 30:28–40. Steelman AJ, Smith R, Welsh CJ, Li J. Galectin-9 is up-regulated in astrocytes by TNF and promotes encephalitogenic T-cell apoptosis. J Biol Chem 2013; 288:23776–23787. Friedrichs J, Manninen A, Muller DJ, Helenius J. Galectin-3 regulates integrin a2b1-mediated adhesion to collagen-I and -IV. J Biol Chem 2008; 283:32264–32272.
Article 2
Downloaded from www.biolreprod.org.
24. Zhong X, Rescorla FJ. Cell surface adhesion molecules and adhesioninitiated signaling: understanding of anoikis resistance mechanisms and therapeutic opportunities. Cell Signal 2012; 24:393–401. 25. Zheng M, Fang H, Hakomori S. Functional role of N-glycosylation in a5b1 integrin receptor. De-N-glycosylation induces dissociation or altered association of a5 and b1 subunits and concomitant loss of fibronectin binding activity. J Biol Chem 1994; 269:12325–12331. 26. Kremser ME, Przybylo M, Amoresano A, Carpentieri A, Bubka M, Litynska A. Characterisation of a3b1 and avb3 integrin N-oligosaccharides in metastatic melanoma WM9 and WM239 cell lines. Biochim Biophys Acta 2008; 1780:1421–1431. 27. Kim M, Kim S, Kim H, Kim H, Joo HG, Shin T. Immunohistochemical localization of galectin-3 in the reproductive organs of the cow. Acta Histochem 2008; 110:473–480. 28. Miyamoto Y, Skarzynski DJ, Okuda K. Is tumor necrosis factor a trigger for the initiation of endometrial prostaglandin F2a release at luteolysis in cattle? Biol Reprod 2000; 62:1109–1115. 29. Okuda K, Miyamoto A, Sauerwein H, Schweigert FJ, Schams D. Evidence for oxytocin receptors in cultured bovine luteal cells. Biol Reprod 1992; 46:1001–1006. 30. Okuda K, Uenoyama Y, Lee KW, Sakumoto R, Skarzynski DJ. Progesterone stimulation by prostaglandin F2a involves the protein kinase C pathway in cultured bovine luteal cells. J Reprod Dev 1998; 44:79–84. 31. Komiyama J, Nishimura R, Lee HY, Sakumoto R, Tetsuka M, Acosta TJ, Skarzynski DJ, Okuda K. Cortisol is a suppressor of apoptosis in bovine corpus luteum. Biol Reprod 2008; 78:888–895. 32. Sakumoto R, Vermehren M, Kenngott RA, Okuda K, Sinowatz F. Localization of gene and protein expressions of tumor necrosis factor-a and tumor necrosis factor receptor types I and II in the bovine corpus luteum during the estrous cycle. J Anim Sci 2011; 89:3040–3047. 33. Taniguchi H, Yokomizo Y, Okuda K. Fas-Fas ligand system mediates luteal cell death in bovine corpus luteum. Biol Reprod 2002; 66:754–763. 34. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using
Galectin-3 Contributes to Luteolysis by Binding to Beta 1 Integrin in the Bovine Corpus Luteum1 Kazuhisa Hashiba,3 Masahiro Sano,3 Junko Nio-Kobayashi,4 Takuo Hojo,5 Dariusz J. Skarzynski,5 and Kiyoshi Okuda2,3 3
Laboratory of Reproductive Physiology, Graduate School of Environmental and Life Science, Okayama University, Okayama, Japan 4 Laboratory of Histology and Cytology, Hokkaido University Graduate School of Medicine, Sapporo, Japan 5 Department of Reproductive Immunology and Pathology, Institute of Animal Reproduction and Food Research, Polish Academy of Sciences, Olsztyn, Poland
Luteolysis is characterized by a reduction in progesterone (P4) production and tissue degeneration in the corpus luteum (CL). One of major events during luteolysis is luteal cell death. Galectin-3, a ubiquitously expressed protein involved in many cellular processes, serves as an antiapoptotic and/or proapoptotic factor in various cell types. Although galectin-3 is detected in the bovine CL, its role remains unclear. The expression of galectin-3 in the bovine CL was higher at the regressed stage than at the other luteal stages. Galectin-3 was localized on luteal steroidogenic cells (LSCs). When cultured LSCs were exposed to prostaglandin F2alpha (PGF) for 48 h, the expression and secretion of galectin-3 increased. When the cultured LSCs were treated with galectin-3 for 24 h, cleaved caspase-3 expression was increased, and the cell viability was decreased, whereas P4 production did not change. Beta 1 integrin, a target protein of galectin-3, was expressed in bovine CL and possessed glycans, which galectin-3 binds. Furthermore, galectin-3 bound to glycans of luteal beta 1 integrin. The decreased cell viability of cultured LSCs by galectin-3 was suppressed by beta 1 integrin antibody. The overall findings suggest that the secreted galectin3 stimulated by PGF plays a role in structural luteolysis by binding to beta 1 integrin. apoptosis, corpus luteum, galectin, glycan, luteolysis
INTRODUCTION The corpus luteum (CL) is a transient endocrine gland that is essential for the regulation of ovarian cycles as well as for the establishment of pregnancy. If pregnancy does not occur, regression of the CL (luteolysis) is initiated by the uterine prostaglandin F2a (PGF) in ruminants [1]. Luteolysis is characterized by a reduction in progesterone (P4) production (functional luteolysis) followed by luteal cell death (structural luteolysis) [2]. The major event that causes structural luteolysis is luteal cell death (apoptosis) [3–5]. Apoptosis is a highly 1 Supported by a Grant-in-Aid for Scientific Research (No. 24380155) of the Japan Society for the Promotion of Science (JSPS). 2 Correspondence: Kiyoshi Okuda, Laboratory of Reproductive Physiology, Graduate School of Environment and Life Science, Okayama University, Tsushima Naka Kita-ku, 1-1-1, Okayama 700-8530, Japan. E-mail: [email protected]
Received: 4 March 2014. First decision: 25 March 2014. Accepted: 9 May 2014. Ó 2014 by the Society for the Study of Reproduction, Inc. eISSN: 1529-7268 http://www.biolreprod.org ISSN: 0006-3363
1
Article 2
Downloaded from www.biolreprod.org.
conserved mechanism that allows an organism to tightly control cell numbers and tissue size [6]. Luteal regression is triggered by complex factors. Since progesterone is one of the survival factors in the bovine corpus luteum [7], functional luteolysis could be a cause of structural luteolysis. Many cytokines, including tumor necrosis factor a (TNF) and interferon c (IFNG), secreted by immune cells, and nitric oxide, produced by luteal endothelial cells, directly induce CL cells to undergo apoptosis [8–10]. Nitric oxide is also known to play a crucial role in functional luteolysis [11]. These reports indicate that many molecules are involved in structural luteolysis. However, the indirect effects of the above luteolytic factors on luteolysis are not well understood. Galectin-3 is one of the b-galactoside-binding proteins that bind to target molecules through conserved carbohydrate recognition domains [12]. In various cell types, galectin-3 is expressed in the nucleus or cytoplasm, on the cell membrane, and in the extracellular matrix [13]. Galectin-3 is involved in many cellular processes, such as apoptosis and proliferation [14–16]. Intracellular galectin-3 generally mediates antiapoptotic effects through carbohydrate-independent processes [17– 20], whereas extracellular galectin-3 binds to cell surface oligosaccharides and thereby induces apoptosis [14, 21, 22]. Integrins are cell surface glycoproteins that mediate adhesion to the extracellular matrix, and integrin signaling regulates cell proliferation, differentiation, and apoptosis [23]. In mammals, they are composed of 18 a-subunits and 8 bsubunits [24]. Among these integrins, 12 members containing the b1 subunit are involved in various biological functions [25]. b1 integrin is a glycan to which galectin-3 binds [26], and extracellular galectin-3 induces apoptosis by binding to b1 integrin in T cells and tumor cells [14, 22]. Therefore, interaction between galectin-3 and b1 integrin might also play a role in inducing apoptosis of luteal cells. In cow, galectin-3 has been identified in the uterus, cervix, oviduct, atretic follicles, and CL [27]. Galectin-3 protein localization has been immunohistochemically detected in the regressing CL [27], but its physiological role is still unclear. Based on these reports, we hypothesized that galectin-3 is involved in the apoptosis of luteal cells during luteolysis. In the present study, to test this hypothesis, we examined 1) cyclic changes in the galectin-3 mRNA and protein expressions, 2) the effect of luteolytic factors on expression of galectin-3 mRNA and protein in cultured midluteal steroidogenic cells (LSCs), 3) subcellular localization of galectin-3 in the regressed CL and the effect of PGF on the secretion of galectin-3 in LSCs, 4) the effect of galectin-3 on P4 production and cell viability in LSCs, 5) the expression and glycan structure of b1 integrin in bovine CL throughout the estrous
ABSTRACT
HASHIBA ET AL. TABLE 1. Primers for real-time PCR. Primer (5 0 -3 0 )a
Gene LGALS-3 ITGB1 MRPL4 COX4 GAPDH TUBB a
F: R: F: R: F: R: F: R: F: R: F: R:
TCGCATGCTGATAACAATCC GAAGCGTGGGTTAAAGTGGA GCAGTTTGTGGATCCCTGAT AAACGATGCCACCAAGTTTC GGCTCAAGACCTTCAACCTG GCGTGTAACGTGAGTCATGC AAGGAGAAGGCTTCCTGGAG CCACCGTCTTCCACTCATTT CACCCTCAAGATTGTCAGCA GGTCATAAGTCCCTCCACGA GAGGCCACCGGTAACAAGTA ACTCTGGCCAAACACGAAGT
Accession no.
Product (base pairs)
BC148136
106
BC114107
109
BC108102
138
BC102733
118
BC102589
103
BC105401
129
F, forward; R, reverse.
cycle, and 6) the interaction between b1 integrin and galectin-3 in LSCs.
these stages, CL tissues were immediately separated from the ovaries, frozen rapidly in liquid nitrogen, and then stored at 808C until processed for mRNA and protein analysis. For immunohistochemistry, pieces of CL tissue were fixed in 10% (vol/vol) neutral formalin (pH 7.4) for 20–24 h and then embedded in paraffin. For cell culture, ovaries with CLs were submerged in ice-cold physiological saline and transported to the laboratory.
MATERIALS AND METHODS
Luteal Cell Isolation
Ovaries were collected from Holstein cows at a local slaughterhouse within 10–20 min after exsanguinations. The stage of the estrous cycle was defined as described previously [28]. Ovaries with CLs were classified into the early (Days 2–3 after ovulation), developing (Days 5–6), mid (Days 8–12), late (Days 15–17), and regressed (Days 19–21) luteal stages. After determination of
The CLs classified in the midluteal stage were used for cell culture. Luteal tissue was enzymatically dissociated, and luteal cells were cultured as described previously [29]. Dissociated luteal cells from CLs were pooled. The luteal cells were suspended in a culture medium, Dulbecco modified Eagle medium, and
FIG. 1. Changes in the relative amounts of galectin-3 expressions. A) Comparison of relative amounts of galectin-3 mRNA determined by quantitative RTPCR in bovine CL tissue throughout the estrous cycle (early, Days 2–3; developing, Days 5–6; mid, Days 8–12; late, Days 15–17; regressed luteal stages [Regress], Days 19–21). Data are the mean 6 SEM for four samples/stage and are expressed as the relative ratio of galectin-3 mRNA to MRPL4 mRNA. B) Representative Western blot bands for galectin-3 and ACTB. Densitometrically analyzed Western blot results in the bovine CL tissue during different luteal phases. Data are the mean 6 SEM for four samples/stage and are expressed as the relative ratio of galectin-3 protein to ACTB protein. Different superscript letters indicate significant difference (P , 0.05), as determined by ANOVA followed by Bonferroni multiple comparison test.
2
Article 2
Downloaded from www.biolreprod.org.
Collection of Bovine CL
GALECTIN-3 IN CL DURING LUTEOLYSIS
Ham F-12 medium (D/F; 1:1 [vol/vol]; D8900; Sigma-Aldrich Corp., St. Louis, MO), containing 5% calf serum (16170-078; Life Technologies, Grand Island, NY) and 20 lg/ml gentamicin (15750-060; Life Technologies) under 5% CO2 in air. Cell viability was greater than 85% as assessed by trypan blue exclusion. The cells in the cell suspension consisted of about 70% small LSCs, 20% large LSCs, 10% endothelial cells or fibrocytes, and no erythrocytes. In this study, these cells were defined as LSCs.
(Dainippon Pharmaceutical, Osaka, Japan) and/or 2.5 nM recombinant bovine IFNG (Kindly donated by Dr. S. Inumaru, NIAH, Ibaraki, Japan) or 1.0 lM PGF (P7652; Sigma-Aldrich) for 12, 24, 48, and 72 h. The doses for treatments were selected based on previous reports [30, 31]. After the culture, the expression of galectin-3 mRNA was determined by quantitative RT-PCR. The galectin-3 protein expression was assessed by Western blotting in cells treated with PGF for 48 h.
Cell Culture
Experiment 3: Subcellular Localization of Galectin-3 in the Regressed CL and Effect of PGF on the Secretion of Galectin-3 in Cultured Mid-LSCs
Dispersed luteal cells (2.0 3 105 /ml) were cultured in D/F medium containing 5% calf serum in 24-well plates (662160; Greiner Bio-One, Frickenhausen, Germany) for quantitative RT-PCR, 75-cm2 culture flasks (658175; Greiner Bio-One) for Western blotting, or 96-well culture dishes (3860-096; Iwaki, Chiba, Japan) for cell viability test. After 24 h of culture, the medium was replaced with D/F medium without phenol red (D2906; SigmaAldrich) containing 0.1% BSA, 5 ng/ml sodium selenite (S5261; SigmaAldrich), and 5 lg/ml holo-transferrin (T3400; Sigma-Aldrich), and the following experiments were carried out.
To elucidate the subcellular localization of galectin-3 in the regressed CL, the regressed CL tissue was fractionated into membrane and cytoplasm fractions. The CL tissues were homogenized on ice in the homogenization buffer by a tissue homogenizer (Physcotron [NS-50; NITI-ON Inc., Chiba, Japan]), followed by a filtration with a metal wire mesh (150 lm). For protein analysis, nuclei were removed from the tissue homogenates by centrifugation at 700 3 g for 5 min. The resultant supernatant was fractionated into membrane and cytoplasmic cell fractions by centrifugation at 100 000 3 g for 1 h. The membrane and cytoplasm fractions were detected expression of galectin-3 protein by Western blotting. Validation of the cell fractionation was performed by reprobing with tumor necrosis factor receptor 1 (TNFR1) antibody (ab19139; Abcam, Cambridge, UK) as a plasma membrane marker and ACTB antibody (A2228; Sigma-Aldrich) as a cytoplasm marker. Since TNFR1 is expressed in the bovine CL [32] and generally known as a membrane receptor, TNFR1 antibody was used for plasma membrane marker. To examine whether PGF induces secretion of the galectin-3 in LSCs, after 48 h of treatment with PGF (1.0 lM), cultured LSCs were treated with a noncompeting saccharide, 0.1 M sucrose, and a competing saccharide, 0.1 M blactose, for 4 h. LSCs were collected and subsequently analyzed galectin-3 protein by Western blotting.
Experiment 1: Cyclic Changes in the Galectin-3 mRNA and Protein Expressions Galectin-3 mRNA and protein expressions of in each CL tissues (early, n ¼ 4; developing, n ¼ 4; mid, n ¼ 4; late, n ¼ 4; regressed, n ¼ 4) were examined by quantitative RT-PCR and Western blotting. Galectin-3 protein localization of in each CL tissues (early, n ¼ 3; mid, n ¼ 3; regressed, n ¼ 3) was analyzed by immunohistochemistry.
Experiment 2: Effect of Luteolytic Factors on Expression of Galectin-3 mRNA and Protein in Cultured Mid-LSCs To clarify regulatory factors of galectin-3 mRNA and protein in cultured mid-LSCs, the cells were exposed to 2.3 nM recombinant human TNF
3
Article 2
Downloaded from www.biolreprod.org.
FIG. 2. Representative images of the localization of galectin-3 protein in bovine CL throughout the estrous cycle. Black arrows indicate macrophages. Bars ¼ 50 lm.
HASHIBA ET AL.
Experiment 4: Effect of Galectin-3 on P4 Production and Cell Viability in Cultured Mid-LSCs
Quantitative RT-PCR Total RNA was extracted from CL tissues and cells using TRIsure (BIO38032; BI-OLINE) according to the manufacturer’s directions. One microgram of each total RNA was reverse transcribed using a ThermoScript RT-PCR System (no. 11146-016; Invitrogen, Carlsbad, CA), and 10% of the reaction mixture was used in each PCR using specific primers for galectin-3 from the bovine sequence (Table 1). Quantification of mRNA expression was determined by iQ SYBR Green Supermix (no. 170-8880; Bio-Rad Laboratories, Inc., Berkeley, CA) starting with 2 ng of reverse-transcribed total RNA. For quantification of the mRNA expression levels, PCR was performed under the following conditions: 958C for 15 min, followed by 45 cycles of 948C for 15 sec, 608C for 20 sec, and 728C for 15 sec. Use of the QuantiTect SYBR Green PCR system at elevated temperatures resulted in reliable and sensitive quantification of the RT-PCR products with high linearity (Pearson correlation coefficient: r . 0.99). MRPL4 mRNA expression was used as an internal control. To analyze the relative level of expression of each mRNA, the 2-DDCT method was used [34]. In the present study, we compared four housekeeping genes in the CL by quantitative PCR. The four genes evaluated were mitochondrial ribosomal protein L4 (MRPL4), cytochrome c oxidase subunit IV (COX4), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and tubulin beta 2 (TUBB) (Table 1). To determine the most stable transcribed housekeeping gene, Normfinder software (downloaded at http://moma.dk/ normfinder-software) was used. This software calculates the gene expression stability measure (M) and determines the most stable housekeeping gene via a stepwise exclusion or ranking process resulting in the selection of the most stable housekeeping genes for the specific tissue. Since MRPL4 was the most suitable, with an average expression stability of M ¼ 0.171, followed by COX4 (M ¼ 0.261) . TUBB (M ¼ 0.280) . GAPDH (M ¼ 0.762), MRPL4 was used as a housekeeping gene for further experiments.
To reveal the effect of galectin-3 on P4 production and cell viability in LSCs, the cells were exposed to recombinant galectin-3 (0.01, 0.1, 1.0, and 5.0 lg/ml; R&D Systems, Inc., Minneapolis, MN) for 24 h. The cell viability was determined by Dojindo Cell Counting Kit including WST-1 (no. 345–06463; Dojindo, Kumamoto, Japan) as described previously [33]. Progesterone concentrations in the media of LSCs were measured by enzyme immunoassay. Expression of cleaved caspase-3 was analyzed by Western blotting in cells treated with recombinant galectin-3 (1.0 lg/ml) for 24 h.
Experiment 5: Expression and Glycan Structure of b1 Integrin in Bovine CL Throughout the Estrous Cycle The membrane fractions of the CLs and the LSCs were lysed in a lysis buffer consisting of 20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1.0% Triton X 100, 10% glycerol, and protease inhibitor cocktail (11 697 498 001; Roche; Basel, Switzerland). The lysates (2.0 mg of protein) were incubated with b1 integrin antibody (MAB2000; Millipore, Billerica, MA) and protein-G-beads (MAB2000; Millipore) at 48C for 24 h. The beads were washed with lysis buffer three times, and immunoprecipitated proteins were analyzed by lectin blotting.
Experiment 6: Interaction Between b1 Integrin and Galectin-3 in Cultured Mid-LSCs To investigate whether galectin-3 decreases cell viability via b1 integrin in LSCs, after 1 h of treatment with b1 integrin neutralizing antibody (MAB1965; Millipore) or anti-mouse IgG diluted at 1:1000, cultured LSCs were treated with recombinant galectin-3 (1.0 lg/ml) for 24 h, and the cell viability was determined by WST-1.
Western Blotting Protein concentrations in the lysates were determined by using BSA as a standard. The proteins were then solubilized in SDS gel-loading buffer (50 mM Tris-HCl, 2% SDS [31607-94, Nacalai Tesque, Tokyo, Japan], 10% glycerol,
4
Article 2
Downloaded from www.biolreprod.org.
FIG. 3. Effects of luteolytic factors on the expression of galectin-3 mRNA and protein in LSCs. A) LSCs were treated with PGF (1.0 lM) or TNF (2.3 nM) and/or IFNG (2.5 nM) for 12, 24, 48, and 72 h. Data are expressed as the relative ratio of galectin-3 mRNA to MRPL4 mRNA levels. B) Representative Western blot bands for galectin-3 and ACTB in the cells treated with PGF (1.0 lM) for 48 h. The resultant signal was detected by chemiluminescence and quantitated by computer-assisted densitometry. Data are expressed as the relative ratio of galectin-3 protein to ACTB protein. All values are the means 6 SEM. All of the experiments were repeated more than three times. The data were statistically analyzed using ANOVA followed by Bonferroni multiple comparison test. Asterisks indicate significant differences compared with control for 48 h (P , 0.05).
GALECTIN-3 IN CL DURING LUTEOLYSIS NA931; Amersham Biosciences; 1:10 000 for b1 integrin or 1:40 000 for ACTB]) for 1 h at room temperature. After washing again with TBS-T, the signal was detected by chemiluminescence using Immobilon Western Chemiluminescent HRP Substrate (P36599; Millipore). ACTB protein expression was used as an internal control. The intensity of the immunological reaction in the tissues was estimated by measuring the optical density in the defined area by computerized densitometry using Image Lab Software version 4.0 (Bio-Rad Laboratories).
Immunohistochemistry The sections, at 5-lm thickness, were dewaxed and washed in phosphatebuffered saline. Subsequently, the sections were incubated at room temperature with 3% hydrogen peroxide in distilled water for 20 min and Avidin/Biotin blocking solution (Vector Laboratories Inc., Burlingame, CA) for 15 min for each reagent. Then the sections were incubated with normal goat serum for 60 min at room temperature followed by galectin-3 antibody (1:200) at 48C overnight. After washing twice in PBS, the sections were incubated with biotinylated anti-rabbit IgG (1:500; Vector Laboratories) for 60 min at room temperature. The reaction sites were visualized using Vectastain ABC Elite kit (Vector Laboratories) for 60 min at room temperature and ImmPACT 3, 3 0 Diaminobenzidine (DAB) Peroxidase Substrate Kit (Vector Laboratories) for 5 min. The sections were counterstained for 2 min with hematoxylin and observed under a light microscope (BX51; Olympus Corporation, Tokyo, Japan).
WST-1, a kind of MTT (3-[4,5-dimethyl-2 thiazolyl]-2,5-diphenyl-2 Htetrazolium bromide), is a yellow tetrazolium salt that is reduced to formazan by live cells containing active mitochondria. The culture medium was replaced with 100 ll D/F without phenol red medium-BSA, and a 10-ll aliquot (0.3% WST-1, 0.2 mM 1-methoxy PMS in PBS, pH 7.4) was added to each well. The cells were then incubated for 4 h at 388C. The absorbance was read at 450 nm using a microplate reader (Model 450; Bio-Rad Laboratories). In this assay, data were expressed as percentages of the appropriate control values.
P4 Determination Concentrations of P4 were determined directly from the cell culture media with an enzyme immunoassay, as described previously [30]. The standard curve ranged from 0.391 to 100 ng/ml, and the median effective dose (ED50) of the assay was 4.5 ng/ml. The intra- and interassay coefficients of variation were 5.8% and 9.3%, respectively.
Lectin Blotting
FIG. 4. A) Subcellular localization of galectin-3 in the regressed CL. Regressed CL was fractionated into the membrane and cytoplasm fractions. Galectin-3 is shown in the upper lane. Staining for ACTB and TNFR1 was used to assess the purity of the cytoplasm and membrane fractions, respectively. B) Effect of PGF on the secretion of galectin-3 in cultured mid-LSCs. Cultured mid-LSCs were treated with 0.1 M sucrose and 0.1 M b-lactose (lactose) for 4 h after treatment with PGF (1.0 lM) for 48 h. The galectin-3 protein expression was assessed by Western blotting analysis. Representative Western blot bands for galectin-3 and ACTB are shown. All values are the means 6 SEM. All of the experiments were repeated more than three times, and different superscript letters indicate significant difference (P , 0.05), as determined by ANOVA followed by Bonferroni multiple comparison test.
Protein samples were subsequently separated by SDS-PAGE. Separated proteins were transferred onto PVDF membrane. The membrane was blocked with 5% BSA in TBS-T and then reacted with 1.0 lg/ml of HRP-conjugated L4-PHA lectin (J212; J-OIL MILLS, Tokyo, Japan) in TBS-T for 1 h. After washing again with TBS-T, the reactive protein bands were detected by chemiluminescence using Immobilon Western Chemiluminescent HRP Substrate.
Galectin-3 Overlay Assay Cell lysates (2.0 mg of protein) were immunoprecipitated with b1 integrin antibody and protein-G-beads, as described above. Precipitated proteins were separated by SDS-PAGE and subsequently transferred to a PVDF membrane. The membrane was blocked with 5% BSA in TBS-T and then exposed to biotin-conjugated galectin-3. Biotinylated label of glectin-3 was performed using the EasyLink Biotin Conjugation Kit (ab102865; Abcam), according to the manufacturer’s instruction. After washing with TBS-T, the membrane was incubated with streptavidin conjugated to HRP. After washing again with TBST, the reactive protein bands were detected by chemiluminescence using Immobilon Western Chemiluminescent HRP Substrate.
and 1% b-mercaptoethanol [137–06862; Wako Pure Chemical Industries, Ltd], pH 6.8) and heated at 958C for 10 min. Samples (30 lg protein) were separated on SDS-PAGE and then transferred to a PVDF membrane (RPN303F; GE Healthcare, Little Chalfont, Buckinghamshire, UK). The membrane was washed in TBS-T (0.1% Tween 20 in TBS [25 mM Tris-HCl, 137 mM NaCl, pH 7.5]) and incubated in blocking buffer (5% nonfat dry milk in TBS-T) for 1 h at room temperature. After washing, the membranes were incubated with galectin-3 antibody diluted at 1:1000 (sc-20157; Santa Cruz Biotechnology Inc., Santa Cruz, CA), cleaved caspase-3 antibody diluted at 1:1000 (no. 9661; Cell Signaling Technology Inc., Beverly, MA), TNFR1 antibody diluted at 1:1000, b1 integrin antibody diluted at 1:1000, or ACTB antibody diluted at 1:10 000 overnight at 48C. After washing with TBS-T, the membrane was incubated with the appropriate secondary antibodies (anti-rabbit Ig, HRP-linked whole antibody produced by donkey [NA934; Amersham Biosciences Corp., San Francisco, CA; 1:10 000] for galectin-3, cleaved caspase-3, and TNFR1 protein; anti-mouse Ig, HRP-linked whole antibody produced by sheep [no.
Statistical Analysis All experimental data are shown as the mean 6 SEM. The statistical significance of differences in the expression of galectin-3 mRNA and protein, cleaved caspase-3 protein, P4 production, and the viability of LSCs were assessed by analysis of a one-way ANOVA followed by Bonferroni multiple comparison test. Probabilities less than 5% (P , 0.05) were considered significant.
5
Article 2
Downloaded from www.biolreprod.org.
WST-1 Assay
HASHIBA ET AL.
Downloaded from www.biolreprod.org. FIG. 5. Effects of galectin-3 on P4 production (A) and cell viability (B) in LSCs. The cells were treated with recombinant galectin-3 (0, 0.01, 0.1, 1.0, 5.0, lg/ml) for 24 h. C) Representative Western blot bands for cleaved caspase-3 and ACTB in the cells treated with recombinant galectin-3 (1.0 lg/ml) for 24 h. The resultant signal was detected by chemiluminescence and quantitated by computer-assisted densitometry. Protein data are expressed as the relative ratio of cleaved caspase-3 protein to ACTB protein. All values are the means 6 SEM. All of the experiments were repeated more than three times. The data were statistically analyzed using ANOVA followed by Bonferroni multiple comparison test (P , 0.05).
RESULTS
other luteal stages (Fig. 1, A and B; P , 0.05). Galectin-3 was localized mainly in LSCs and macrophage (Fig. 2).
Experiment 1: Cyclic Changes in the Galectin-3 mRNA and Protein Expressions
Experiment 2: Effect of Luteolytic Factors on Expression of Galectin-3 mRNA and Protein in Cultured Mid-LSCs
The expressions of galectin-3 mRNA and protein in the bovine CL were higher at the regressed luteal stage than at the
The expression of galectin-3 mRNA was significantly increased by a treatment with PGF for 48 h (Fig. 3A; P , 0.05) 6
Article 2
GALECTIN-3 IN CL DURING LUTEOLYSIS
viability (Fig. 5B; P , 0.05). Furthermore, the protein expression of cleaved caspase-3 was significantly increased by galectin-3 (1.0 lg/ml; Fig. 5C; P , 0.05).
but not by TNF and/or IFNG, compared with control for 12, 24, 48, and 72 h. The expression of galectin-3 protein was also significantly increased by a treatment with PGF for 48 h (Fig. 3B; P , 0.05).
Experiment 5: Expression and Glycan Structure of b1 Integrin in Bovine CL Throughout the Estrous Cycle
Experiment 3: Subcellular Localization of Galectin-3 in the Regressed CL and Effect of PGF on the Secretion of Galectin-3 in Cultured Mid-LSCs
b1 integrin mRNA and protein in bovine CL were expressed throughout the estrous cycle (Fig. 6, A and B). b1 integrin in both bovine CL and cultured mid-LSCs possessed glycans, which galectin-3 binds, as revealed by lectin blotting using L4PHA (Fig. 6C).
The expression of galectin-3 protein was detected mainly in the membrane fraction. ACTB was detected mostly in the cytoplasmic fraction, and TNFR1 was detected in the membrane fraction (Fig. 4A). The expression of galectin-3 protein was significantly increased by PGF. PGF-induced galectin-3 expression was significantly decreased by b-lactose (Fig. 4B; P , 0.05).
Experiment 6: Interaction Between b1 Integrin and Galectin-3 in Cultured Mid-LSCs Galectin-3 bound directly to b1 integrin in the isolated midluteal cells (Fig.7 A). Although cultured LSC viability was decreased by galectin-3, the viability of the LSC treated with b1 neutralizing integrin antibody was not changed by galectin3 compared with control (Fig. 7B; P , 0.05).
Experiment 4: Effect of Galectin-3 on P4 Production and Cell Viability in Cultured Mid-LSCs Galectin-3 did not affect P4 production (Fig. 5A), whereas galectin-3 (1.0 and 5.0 lg/ml) significantly decreased the cell 7
Article 2
Downloaded from www.biolreprod.org.
FIG. 6. Changes in the relative amounts and glycan structure of b1 integrin. A) Comparison of relative amounts of b1 integrin mRNA determined by quantitative RT-PCR in bovine CL tissue throughout the estrous cycle. Data are the mean 6 SEM for four samples/stage and are expressed as the relative ratio of b1 integrin mRNA to MRPL4 mRNA. B) Representative Western blot bands for b1 integrin and ACTB. Densitometrically analyzed Western blot results in the bovine CL tissue during different luteal phases. C) L4-PHA lectin blot analysis of glycans attached to b1 integrin. Purified b1 integrin proteins were subjected to blotting analysis probed either b1 integrin antibody or plant lectin (L4-PHA for detecting oligomers of D-GalNac). Data are the mean 6 SEM for four samples/stage and are expressed as the relative ratio of galectin-3 protein to ACTB protein.
HASHIBA ET AL.
DISCUSSION
stage than at the other luteal stages, and its protein was localized in LSCs and macrophages (Figs. 1, 2). Since galectin3 is commonly used as a macrophage maker [38], galectin-3positive cells besides LSCs were judged as macrophages. Since the bone marrow-derived macrophages of galectin-3-deficient mouse exhibited defective phagocytosis of apoptotic cells, galectin-3 in macrophages is thought to play important roles of phagocytosis [39]. Moreover, luteolysis involves phagocytic elimination of apoptotic luteal cells by luteal macrophages in rat [40]. Based on the above findings, galectin-3 may also be required for phagocytosis by macrophages in the regressing CL in cattle. The localization of galectin-3 on the membrane might not completely be supported because a faint band of b-actin was detected in plasma membrane fraction (Fig. 4A). Therefore, we further investigated whether galectin-3 was localized on LSCs stimulated by PGF (a mimic luteal regression; Fig 4B). Galectin-3 binds to N-acetyllactosamine (LacNAc) structure in glycans, and lactose is a saccharide that has structure similar to LacNAc and inhibits the binding to galectin-3 [13]. On the other hand, since sucrose is a saccharide that does not bind to galectin-3, sucrose is commonly used as a negative control of
Galectin-3 is a ubiquitously expressed protein that is involved in cell survival and death in many cell types [35]. In the mice, since regressing CL consisted of galectin-3positive luteal cells, galectin-3 is suggested to be involved in luteal regression [36]. Although galectin-3 has been detected immunohistochemically in the bovine CL throughout the estrous cycle [27], its regulatory factor, target protein, and roles in LSCs are unclear. Galectin-3 is present in the cell nucleus or cytoplasm, on the cell surface, and also in the extracellular environment [15]. Galectin-3 has been demonstrated to play conflicting roles in cell viability, that is, cell survival and apoptosis [15]. The two different actions of galectin-3 on cell viability depend on its subcellular localization [13]. Intracellular galectin-3 generally protects cells against apoptosis through carbohydrate-independent mechanisms, whereas extracellular galectin-3 binds to cell surface oligosaccharides and induces apoptosis [14, 21, 22, 37]. The major event that causes the structural luteolysis is death of LSCs by apoptosis [5]. In the present study, the expression of galectin-3 in the bovine CL was higher at the regressed luteal 8
Article 2
Downloaded from www.biolreprod.org.
FIG. 7. Interaction between b1 integrin and galectin-3 in cultured mid-LSCs. A) Galectin-3 overlay assay of glycans attached to b1 integrin. Immunoprecipitated b1 integrin proteins were subjected to blotting analysis probed either b1 integrin antibody or biotinylated galectin-3. As shown, biotin-conjugated galection-3 bound to b1 integrin from the mid-LSCs. B) Cultured mid-LSCs were treated with recombinant galectin-3 (1.0 lg/ml) for 24 h after treatment with b1 integrin function blocking antibody or mouse IgG (diluted at 1:1000) for 1 h. All values are the means 6 SEM. All of the experiments were repeated more than three times, and different superscript letters indicate significant difference (P , 0.05), as determined by ANOVA followed by Bonferroni multiple comparison test.
GALECTIN-3 IN CL DURING LUTEOLYSIS
lactose [22]. In the present study, the expression of galectin-3 protein stimulated by PGF was decreased by lactose but not sucrose (Fig 4B), and the Western blot band of membrane fraction was obviously stronger than that of cytosol fraction (Fig. 4A). The above findings strongly suggest that galectin-3 is localized mainly on the plasma membrane in the regressed CL. In various cells types, galectin expression is induced by cytokines as TNF, IFNG, and interleukin 1 b [41–44]. In luteolysis, TNF and IFNG produced by immune cells play an important role [5]. Not only cytokines (TNF and IFNG) but also PGF are known as important luteolytic factors [5, 33]. Since galectin-3 expression was higher at the regressed luteal stage (Figs. 1, 2), we hypothesized that TNF, IFNG, or PGF affect the expression and secretion of galectin-3 in LSCs. In the present study, the expression and secretion of galectin-3 in LSCs was stimulated by PGF at 48 h. PGF is elevated as a series of pulses in uterine venous blood at Days 18–19 after ovulation [1]. In addition, galectin-3 expression in bovine CL was increased at the regressed stage (Fig. 1). Based on the above findings, PGF, which triggers the induction of luteolysis during Days 18–19 [1], may stimulate the expression and secretion of galectin-3 by LSCs during Days 19–21. Furthermore, galectin-3 localized on plasma membrane in the regressed CL may be the result of secretion of galectin-3 from LSCs in response to PGF. Luteolysis is characterized by a phase of inhibited P4 production (functional luteolysis), followed by a phase of decreasing in luteal size (structural luteolysis), when cells of the CL undergo apoptosis [1]. P4 production by LSCs treated with galectin-3 did not change in spite of decreasing LSC viability. There are no reports that galectin-3 affects a hormone production by any types of cells. One might only suppose that the cell death of LSCs started occurring at around 24 h after galectin-3 treatment. Galectin-3 may contribute to only structural luteolysis, not to functional luteolysis. Galectin-3 binds to glycoproteins, such as integrins, neural cell adhesion molecule, and CD98 [35]. In addition, integrins are expressed in luteal cells of rodents and granulosa and theca cells of ruminants [23]. b1 integrin is reported to be involved in apoptosis induced by galectin-3 in colonic epithelial cells [22]. Based on the above findings, we hypothesized that the apoptosis in LSCs induced by galectin-3 requires b1 integrin. As expected, b1 integrin was expressed and possesses glycans, which galectin-3 binds in bovine CL throughout the estrous cycle. However, b1 integrin expression and glycan structure did not change throughout the estrous cycle (Fig. 6). This may be the reason why luteolysis is controlled by the change of galectin-3 expression during the estrous cycle but not by changes in the expression or glycan structure of b1 integrin. We confirmed that galectin-3 induces LSC death by binding to b1 integrin (Fig. 7), as shown in colon epithelial cells and T cells [14, 22]. Integrins, including b1 integrin, bind to extracellular matrix (fibronectin and collagen), and galectin-3 inhibits the binding of the integrins to the extracellular matrix [45]. A variety of cell types undergo apoptosis by lack of extracellular matrix attachment, which is termed anoikis [24]. These findings suggest that galectin-3 produced by LSCs inhibits binding of integrins to extracellular matrix and induces anoikis in LSCs. The overall findings suggest that galectin-3 increased by PGF induces apoptosis in bovine LSCs via b1 integrin, contributing to structural luteolysis.
ACKNOWLEDGMENT We are grateful to Dainippon Pharmaceutical, Osaka, Japan, for recombinant human TNF (HF-13) and Dr. S. Inumaru of the NIAH, Ibaraki, Japan, for recombinant bovine IFNG.
REFERENCES
9
Article 2
Downloaded from www.biolreprod.org.
1. McCracken JA, Custer EE, Lamsa JC. Luteolysis: a neuroendocrinemediated event. Physiol Rev 1999; 79:263–323. 2. Juengel JL, Garverick HA, Johnson AL, Youngquist RS, Smith MF. Apoptosis during luteal regression in cattle. Endocrinology 1993; 132: 249–254. 3. Knickerbocker JJ, Wiltbank MC, Niswender GD. Mechanisms of luteolysis in domestic livestock. Domest Anim Endocrinol 1988; 5: 91–107. 4. Bacci ML, Barazzoni AM, Forni M, Costerbosa GL. In situ detection of apoptosis in regressing corpus luteum of pregnant sow: evidence of an early presence of DNA fragmentation. Domest Anim Endocrinol 1996; 13: 361–372. 5. Pate JL, Johnson-Larson CJ, Ottobre JS. Life or death decisions in the corpus luteum. Reprod Domest Anim 2012; 47(suppl 4):297–303. 6. Hengartner MO. The biochemistry of apoptosis. Nature 2000; 407: 770–776. 7. Okuda K, Korzekwa A, Shibaya M, Murakami S, Nishimura R, Tsubouchi M, Woclawek-Potocka I, Skarzynski DJ. Progesterone is a suppressor of apoptosis in bovine luteal cells. Biol Reprod 2004; 71:2065–2071. 8. Rueda BR, Tilly KI, Botros IW, Jolly PD, Hansen TR, Hoyer PB, Tilly JL. Increased bax and interleukin-1b-converting enzyme messenger ribonucleic acid levels coincide with apoptosis in the bovine corpus luteum during structural regression. Biol Reprod 1997; 97:186–193. 9. Penny LA, Armstrong D, Bramley TA, Webb R, Collins RA, Watson ED. Immune cells and cytokine production in the bovine corpus luteum throughout the oestrous cycle and after induced luteolysis. J Reprod Fertil 1999; 115:87–96. 10. Vega M, Urrutia L, In˜iguez G, Gabler F, Devoto L, Johnson MC. Nitric oxide induces apoptosis in the human corpus luteum in vitro. Mol Hum Reprod 2000; 6:681–687. 11. Skarzynski DJ, Piotrowska-Tomala KK, Lukasik K, Galvao A, Farberov S, Zalman Y, Meidan R. Growth and regression in bovine corpora lutea: regulation by local survival and death pathways. Reprod Domest Anim 2013; 48(suppl 1):25–37. 12. Yang RY, Rabinovich GA, Liu FT. Galectins: structure, function, and therapeutic potential. Expert Rev Mol Med 2008; 10:e17. 13. Dumic J, Dabelic S, Flo¨gel M. Galectin-3: an open-ended story. Biochim Biophys Acta 2006; 1760:616–635. 14. Fukumori T, Takenaka Y, Hogan V, Inohara H, Kagawa S, Raz A. CD29 and CD7 mediate galectin-3-induced type II T-cell apoptosis. Cancer Res 2003; 63:8302–8311. 15. Nakahara S, Oka N, Raz A. On the role of galectin-3 in cancer apoptosis. Apoptosis 2005; 10:267–275. 16. Yang H, Lei C, Cheng C, Feng Y, Zhang W, Petracco RG, Sak S. The antiapoptotic effect of galectin-3 in human endometrial cells under the regulation of estrogen and progesterone. Biol Reprod 2012; 87:1–7. 17. Matarrese P, Tinari N, Semeraro ML, Natoli C, Iacobelli S, Malorni W. Galectin-3 overexpression protects from cell damage and death by influencing mitochondrial homeostasis. FEBS Lett 2000; 473:311–315. 18. Moon BK, Lee YJ, Battle P, Jessup JM, Raz A, Kim HR. Galectin-3 protects human breast carcinoma cells against nitric oxide-induced apoptosis. Am J Pathol 2001; 159:1055–1060. 19. Mazurek N, Sun YJ, Liu KF, Gilcrease MZ, Schober W, Nangia-Makker P, Raz A, Bresalier RS. Phosphorylated galectin-3 mediates tumor necrosis factor-related apoptosis-inducing ligand signaling by regulating phosphatase and tensin homologue deleted on chromosome 10 in human breast carcinoma cells. J Biol Chem 2007; 282:21337–21348. 20. Nangia-Makker P, Raz T, Tait L, Hogan V, Fridman R, Raz A. Galectin-3 cleavage: a novel surrogate marker for matrix metalloproteinase activity in growing breast cancers. Cancer Res 2007; 67:11760–11768. 21. Suzuki Y, Inoue T, Yoshimaru T, Ra C. Galectin-3 but not galectin-1 induces mast cell death by oxidative stress and mitochondrial permeability transition. Biochim Biophys Acta 2008; 1783:924–934. 22. Zhuo Y, Chammas R, Bellis SL. Sialylation of b1 integrins blocks cell adhesion to galectin-3 and protects cells against galectin-3-induced apoptosis. J Biol Chem 2008; 283:22177–22185. 23. Monniaux D, Huet-Calderwood C, Le Bellego F, Fabre S, Monget P, Calderwood DA. Integrins in the ovary. Semin Reprod Med 2006; 24: 251–261.
HASHIBA ET AL.
35. 36.
37. 38.
39.
40.
41. 42. 43.
44.
45.
10
real-time quantitative PCR and the 2DDCT method. Methods 2001; 25: 402–408. Krzeslak A, Lipinska A. Galectin-3 as a multifunctional protein. Cell Mol Biol Lett 2004; 9:305–328. Nio J, Iwanaga T. Differential cellular localization of galectin-1 and galectin-3 in the regressing corpus luteum of mice and their possible contribution to luteal cell elimination. J Histochem Cytochem 2010; 58: 741–749. Liu FT, Rabinovich GA. Galectins as modulators of tumour progression. Nat Rev Cancer 2005; 5:29–41. De Boer RA, Voors AA, Muntendam P, van Gilst WH, van Veldhuisen DJ. Galectin-3: a novel mediator of heart failure development and progression. Eur J Heart Fail 2009; 11(9):811–817. Sano H, Hsu DK, Apgar JR, Yu L, Sharma BB, Kuwabara I, Izui S, Liu FT. Critical role of galectin-3 in phagocytosis by macrophages. J Clin Invest 2003; 112:389–397. Kato S, Shiratsuchi A, Nagaosa K, Nakanishi Y. Phosphatidylserine- and integrin-mediated phagocytosis of apoptotic luteal cells by macrophages of the rat. Dev Growth Differ 2005; 47:153–161. Cherayil BJ, Weiner SJ, Pillai S. The Mac-2 antigen is a galactose-specific lectin that binds IgE. J Exp Med 1989; 170:1959–1972. Hughes RC. Secretion of the galectin family of mammalian carbohydratebinding proteins. Biochim Biophys Acta 1999; 1473:172–185. Deschildre C, Ji JW, Chater S, Dacheux F, Selva J, Albert M, Bailly M, Hatey F, Benahmed M. Expression of galectin-3 and its regulation in the testes. Int J Androl 2007; 30:28–40. Steelman AJ, Smith R, Welsh CJ, Li J. Galectin-9 is up-regulated in astrocytes by TNF and promotes encephalitogenic T-cell apoptosis. J Biol Chem 2013; 288:23776–23787. Friedrichs J, Manninen A, Muller DJ, Helenius J. Galectin-3 regulates integrin a2b1-mediated adhesion to collagen-I and -IV. J Biol Chem 2008; 283:32264–32272.
Article 2
Downloaded from www.biolreprod.org.
24. Zhong X, Rescorla FJ. Cell surface adhesion molecules and adhesioninitiated signaling: understanding of anoikis resistance mechanisms and therapeutic opportunities. Cell Signal 2012; 24:393–401. 25. Zheng M, Fang H, Hakomori S. Functional role of N-glycosylation in a5b1 integrin receptor. De-N-glycosylation induces dissociation or altered association of a5 and b1 subunits and concomitant loss of fibronectin binding activity. J Biol Chem 1994; 269:12325–12331. 26. Kremser ME, Przybylo M, Amoresano A, Carpentieri A, Bubka M, Litynska A. Characterisation of a3b1 and avb3 integrin N-oligosaccharides in metastatic melanoma WM9 and WM239 cell lines. Biochim Biophys Acta 2008; 1780:1421–1431. 27. Kim M, Kim S, Kim H, Kim H, Joo HG, Shin T. Immunohistochemical localization of galectin-3 in the reproductive organs of the cow. Acta Histochem 2008; 110:473–480. 28. Miyamoto Y, Skarzynski DJ, Okuda K. Is tumor necrosis factor a trigger for the initiation of endometrial prostaglandin F2a release at luteolysis in cattle? Biol Reprod 2000; 62:1109–1115. 29. Okuda K, Miyamoto A, Sauerwein H, Schweigert FJ, Schams D. Evidence for oxytocin receptors in cultured bovine luteal cells. Biol Reprod 1992; 46:1001–1006. 30. Okuda K, Uenoyama Y, Lee KW, Sakumoto R, Skarzynski DJ. Progesterone stimulation by prostaglandin F2a involves the protein kinase C pathway in cultured bovine luteal cells. J Reprod Dev 1998; 44:79–84. 31. Komiyama J, Nishimura R, Lee HY, Sakumoto R, Tetsuka M, Acosta TJ, Skarzynski DJ, Okuda K. Cortisol is a suppressor of apoptosis in bovine corpus luteum. Biol Reprod 2008; 78:888–895. 32. Sakumoto R, Vermehren M, Kenngott RA, Okuda K, Sinowatz F. Localization of gene and protein expressions of tumor necrosis factor-a and tumor necrosis factor receptor types I and II in the bovine corpus luteum during the estrous cycle. J Anim Sci 2011; 89:3040–3047. 33. Taniguchi H, Yokomizo Y, Okuda K. Fas-Fas ligand system mediates luteal cell death in bovine corpus luteum. Biol Reprod 2002; 66:754–763. 34. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using
