Physiology & Behavior 138 (2015) 179–187

Contents lists available at ScienceDirect

Physiology & Behavior journal homepage: www.elsevier.com/locate/phb

Gastrointestinal microbiota in children with autism in Slovakia Aleksandra Tomova a,⁎, Veronika Husarova a, Silvia Lakatosova a, Jan Bakos a, Barbora Vlkova b, Katarina Babinska a, Daniela Ostatnikova a a b

Institute of Physiology, Comenius University, Bratislava, Slovakia Institute of Molecular Biomedicine, Comenius University, Bratislava, Slovakia

H I G H L I G H T S • • • • •

Fecal microbiota in autistic children in Slovakia differs from controls and siblings. There is a correlation of the autism severity with the severity of GI dysfunction. In our study Desulfovibrio spp. abundance is associated with the severity of autism. Probiotic supplementation normalizes bacterial balance in fecal microbiota. No joined influence of oxytocin, testosterone, DHEAS and fecal microbiota on autism.

a r t i c l e

i n f o

Article history: Received 2 June 2014 Received in revised form 28 October 2014 Accepted 30 October 2014 Available online 6 November 2014 Keywords: Autism Fecal microbiota Probiotic

a b s t r a c t Development of Autism Spectrum Disorders (ASD), including autism, is based on a combination of genetic predisposition and environmental factors. Recent data propose the etiopathogenetic role of intestinal microflora in autism. The aim of this study was to elucidate changes in fecal microbiota in children with autism and determine its role in the development of often present gastrointestinal (GI) disorders and possibly other manifestations of autism in Slovakia. The fecal microflora of 10 children with autism, 9 siblings and 10 healthy children was investigated by real-time PCR. The fecal microbiota of autistic children showed a significant decrease of the Bacteroidetes/Firmicutes ratio and elevation of the amount of Lactobacillus spp. Our results also showed a trend in the incidence of elevated Desulfovibrio spp. in children with autism reaffirmed by a very strong association of the amount of Desulfovibrio spp. with the severity of autism in the Autism Diagnostic Interview (ADI) restricted/repetitive behavior subscale score. The participants in our study demonstrated strong positive correlation of autism severity with the severity of GI dysfunction. Probiotic diet supplementation normalized the Bacteroidetes/Firmicutes ratio, Desulfovibrio spp. and the amount of Bifidobacterium spp. in feces of autistic children. We did not find any correlation between plasma levels of oxytocin, testosterone, DHEA-S and fecal microbiota, which would suggest their combined influence on autism development. This pilot study suggests the role of gut microbiota in autism as a part of the “gut-brain” axis and it is a basis for further investigation of the combined effect of microbial, genetic, and hormonal changes for development and clinical manifestation of autism. © 2014 Elsevier Inc. All rights reserved.

1. Introduction Autism spectrum disorders (ASD) are pervasive developmental disorders, characterized by social abnormalities, communication impairments, and stereotyped and repetitive behaviors. The incidence of ASD in 2010 was 1.47% in the USA [1] and it has been increasing worldwide for last decade. The interest in autism is based firstly, on

⁎ Corresponding author at: Institute of Physiology, Faculty of Medicine, Comenius University, Sasinkova 2, Bratislava 81372, Slovakia. Tel.: +421 2 59357363. E-mail address: [email protected] (A. Tomova).

http://dx.doi.org/10.1016/j.physbeh.2014.10.033 0031-9384/© 2014 Elsevier Inc. All rights reserved.

the escalating incidences of ASD and secondarily, on the common gastrointestinal (GI) manifestations in these people. Up to 90% of children with ASD suffer from GI disorders such as gastroesophageal reflux, constipation, diarrhea, abdominal pain, vomiting and nutrition issues [2–4]. A direct correlation between the severity of autism and gastrointestinal symptoms has been shown [4,5]. Understanding the pathophysiology of the GI morbidity in ASD might be important for the early identification of ASD-related pathology and for guiding the therapy of GI symptoms and perhaps ASD. There is considerable evidence that GI disorders are linked to intestinal dysbiosis. Gut microbiota plays a significant role in modulating human metabolism and in the development of the immune system.

180

A. Tomova et al. / Physiology & Behavior 138 (2015) 179–187

The cellular and biochemical pathways of gut-brain interaction provide a basis for the influences of normal gut microbiota on development, neurochemistry, gene expression, and functioning of the brain [6–10]. The variations in the composition of gut microbes are associated with changes in the normal functioning of the nervous system and behavior [11,12]. For the last several years an escalating number of studies show the changes of gut microbiota in patients with ASD. Possible involvement of a microbial element in pathogenesis of autism was shown for the first time in 1998, when the hypothesis was introduced that Clostridium tetani neurotoxin ascends along the vagus nerve route from the intestinal tract to the CNS causing the symptoms of autism [13]. Later the positive effect of the antibiotic vancomycin on the GI symptoms in autistic patients confirmed the involvement of gut bacteria [14]. Unfortunately, the effect was temporal and could be explained by bacteria spore formation [15]. Establishment of dysbiosis in autistic children [16], and health improvement after using probiotics [17] only rapidly increased the evidence, that the composition of gut microbiota is associated with changes in the normal functioning of the nervous system and behavioral changes in ASD. A recent pyrosequencing study serves as convincing evidence of dysbiosis in autistic subjects, including not only a change of ratio of normally present microorganisms, but a significant increase of bacterial diversity [18]. The investigation of the dominant intestinal bacterial phyla in metagenomic analyses disclosed a significant change in the Bacteroidetes/Firmicutes ratio in the feces of autistic children comparing to healthy or neurotypical children with GI symptoms [18,19]. Various bacterial species have been shown to be involved in dysbiosis in children with autism, particularly they had a higher bacterial incidence of Desulfovibrio spp. [20] and some Clostridium clusters [13,16,21] than the control children population. The diversity of bacterial species was also higher in autistic compared to neurotypical children. For example, they had more Clostridia species [18,22]. Conversely, other species were significantly reduced in gut microbiota of autistic children, like Akkermansia muciniphila and Bifidobacterium spp. [23]. And finally some bacterial species have been shown to be present almost exclusively in autistic gut microbiota, such as Alkaliflexus [18] and Sutterella [24] or some other bacteria were present but only in healthy subjects, as Weissella [18]. The hypothesis of the pathogenesis of ASD includes multiple mechanisms, a combination of genetic predisposition and environmental factors. Although there have been advances in identifying a genetic cause in ASD, recent studies of concordant twins suggest there is a stronger environmental component than previously believed [25,26]. Our study is aimed to make a step forward to elucidating the importance of environmental factors and possibly in combination with other factors leading to developing the disease. Recent data suggest the connection of intestinal microflora content on health status of autistic individuals, and its possible etiological role in people with autistic predisposition. One of the latest theories of autism pathogenesis includes the etiopathogenetic role of specific bacteria (Clostridia, Desulfovibrio and Bifidobacterium) [27]. This is the reason why in our pilot study we investigated the intestinal microflora in children with autism in Slovakia and the specificity of their dysbacteriosis, compared to their siblings and to control group of neurotypical children. Moreover, we have also investigated the changes of microflora in a group of autistic children after probiotic therapy. Although over 50 bacterial phyla have been described in the human gut microbiota, we focused our study on the two most dominant, the Bacteroidetes and the Firmicutes. Special attention was paid to the bacteria described as being involved in manifestations of ASD (Lactobacillus, Bifidobacterium, Clostridia, and Desulfovibrio). For more complex investigation in the development of autism, we also looked at these children's oxytocin plasma levels and at such neurosteroids as testosterone and DHEAS, that were implicated to play an important role in autism development [28–30] and their possible coaction with intestinal microflora.

2. Materials and methods 2.1. Subjects We enrolled in our study 10 autistic children, their 9 non-autistic siblings, and 10 non-autistic children as a control. 9 of 10 autistic children underwent probiotic intervention. The age of autistic children was from 2 to 9 years, siblings — from 5 to 17 years and control children from 2 to 11 years old. In the group of autistic subjects were included 9 boys and one girl, in the group of siblings — 7 boys and two girls, the control group consisted of 10 boys. Children with autism were recruited from the local Autism Centre for children in Bratislava, Slovakia. All autistic children were diagnosed as meeting criteria for ICD-10 childhood autism by a clinical child psychologist in cooperation with the child psychiatrist. Additional assessment was done in our study using the Childhood Autism Rating Scale (CARS) and the Autism Diagnostic Interview (ADI) (two of the children had no additional ADI assessment). Control subjects were recruited through local pediatricians. All control subjects had no psychiatric conditions confirmed by child psychiatrists according to their examinations and parent interview. All subjects were medication–free. Written informed consent was obtained from parents of participating children. The protocol was approved by the Ethics Committee of the Comenius University Faculty of Medicine. The study conformed to the code of ethics stated in the Declaration of Helsinki. 2.2. Clinical procedures Psychological evaluation of the children with autism was performed using CARS [31] designated for identification and differential diagnostics of children with autism [32,33], and ADI [34], a semistructured interview for parents, who respond to the questions about a patient's behavior. We used the adjusted ADI version for research with 35 items in 4 content areas: social/reciprocal interaction, communication, speech and language and restricted/repetitive behavior, rated on 3 or 4 (5)–point scale. Questions about GI symptoms were selected on the basis of claims made about potential links with ASD. The GI condition was evaluated based on the parental questionnaires, where the absence of a symptom was 0, its presence ranged from 1 to 4 depending on the severity of the symptom, thus the score includes the number of symptoms and their severity. 2.3. Probiotic supplementation Dietary supplementation of one capsule of “Children Dophilus” containing 3 strains of Lactobacillus (60%), 2 strains of Bifidumbacteria (25%) and one strain of Streptococcus (15%) was given orally three times a day for 4 months. 2.4. Fecal specimens Stool specimens were collected by parents, kept at + 4 °C and delivered to our laboratory within 4 hours, where aliquots of 200 mg of each specimen were frozen at − 80 °C until DNA extraction. The other aliquots were diluted 1:2 in phosphate-buffered saline (pH 7.2) containing 1% protease inhibitor cocktail (Sigma-Aldrich, Steinheim Germany) and centrifuged at 12,000 g at 4 °C for 10 min. Supernatants were collected and kept frozen at −80 °C until TNF-α detection. DNA extraction from the fecal samples was performed from 200 mg of stool by QIAamp DNA Stool Mini Kit, (Qiagen, Hilden, Germany), according to the manufacturer's instructions with the final elution volume 100 μl of distilled water. The DNA concentration was determined by NanoDrop 1000 Spectrophotometer, (Thermo scientific, MA, USA).

A. Tomova et al. / Physiology & Behavior 138 (2015) 179–187

2.5. Bacterial cultures

181

Systems Europe Ltd. Abington, UK) according to the manufacturer's protocol.

Genomic DNA from the reference bacterial strains (L. rhamnosis, B. longum, B. fragilis, C.perfringers, S. thermophilus and D. idahonensis spp.) was purified from cultures by a QIAamp DNA Mini Kit, (Qiagen, Hilden, Germany), according to the manufacturer's instructions. DNA from each reference bacterial strain was amplified with corresponding primers (Table 1). 2.6. Real-time PCR Specific PCR primers were selected to detect predominant genera of gut microflora or specific bacteria species previously hypothesized to participate in autismus pathogenesis. Primers used in this study (Table 1) were previously described [35–38], except primers specific for Desulfovibrio spp. which were designed using BLAST database (www. ncbi.nlm.nih.gov/BLAST). Primers were commercially obtained (Eurofins MWG Operon, Ebersberg, Germany) and their specificity was proved. The reactions were set up in a total volume of 25 μL, containing 2x QuantiTect SYBR Green PCR Master Mix (Qiagen, Hilden, Germany), recommended amount of primers, and 20 ng of the template. Each sample was analyzed in duplicates. Amplification was performed on Mastercycler realplex 4 (Eppendorf, Hamburg, Germany), using the following program: 1 cycle of 15 min at 95 °C followed by 40 cycles of 94 °C for 15 s for denaturation, annealing for 30 s at 60 °C for all bacteria except Bifidobacterium, which was 59 °C, and extension was performed at 72 °C for 40 s. The CT values (i.e., the threshold cycles in which exponential amplification of PCR products was first detected) were determined on the basis of the mean baseline signals during the early cycles of amplification. CT values were collected with the software at constant threshold. Melting curve analysis was performed to check the specificity of the amplified products. The standard curve for each PCR was constructed by using DNA from the control culture of reference strains in ten-fold dilutions, according to the CFU (colony forming unit) of bacteria in the initial culture with the efficiency more than 90%. To determine the number of genome equivalents of DNA in the experimental samples, the standard curve using the 10-fold diluted DNA purified from the control culture was used. Each concentration was analysed in duplicates and results were averaged. The concentration of bacteria was from 102 to 109 CFU/mL. Plotting the cycle number versus the log-concentration of bacteria yielded a straightline regression with correlation coefficients (R2) more than 0.996. 2.7. Cytokine TNFα measurement in the stool Cytokine levels were measured in the stool supernatants, using sensitive ELISA for TNF-α with the detection limit b 0.1 pg/ml (R&D

2.8. Plasma hormones measurement Three ml of venous blood were taken from autistic children in the local Neurological Centre for Children and Adults in Bratislava. Blood of control children was taken by their pediatricians. After 10 minutes centrifugation at 3000 rpm, plasma was taken with the addition of protease inhibitor aprotinin (Sigma Aldrich) for oxytocin detection. Plasma oxytocin, testosterone and DHEA-S (dehydroepiandrosteronesulfate) levels were measured using the ELISA method according to manufacturer's instructions (Enzo Life Sciences, DRG, DRG Instruments GmbH correspondingly). 2.9. Statistical analysis Data were analyzed using one-way ANOVA and Bonferroni t –test to evaluate the differences between groups. All calculations were performed with XLStatistics 5.0 (Addinsoft SARL, NY, USA) and Microsoft Excel 2007. Data are presented as means ± SEM. For data correlation was used Pearson correlation coefficients [39]. P values less than 0.05 were considered significant. 3. Results In our study 9 out of 10 children with autism, 7 out of 9 in the siblings group and 6 out of 10 in the control group, had some kind of GI symptoms. The scoring, including the number of GI symptoms and their severity showed a significantly higher level of GI dysfunction in autistic children, as well as in their siblings, compared to the controls (Fig. 1). The significance of GI disorders was shown by a strong positive correlation between the intensity of GI symptoms and the severity of autism, scored on ADI scale (R = 0.78, p = 0.01) (Fig. 2). We did not find any correlation between CARS evaluation and GI manifestations. 3.1. Microbiota The results of our investigation established the difference in the fecal microbiota of children with and without autism. The dysbacteriosis of children with autism was represented by a different bacterial abundance at the level of phylum, as well as at the level of species. The Bacteroidetes/Firmicutes ratio was significantly lower in autistic compared to control children (Fig. 3A). When we further investigated the dysbacteriosis in children with autism we found a significant increase in the absolute amount of such beneficial bacteria as Lactobacillus (Fig. 4A). However, the proportion of Lactobacillus as well as the

Table 1 Primers used in this study. Sequence (5′-3′)

Primer

Aplicon (bp)

Target

Positive control

Reference

TCCTACGGGAGGCAGCAGT GGACTACCAGGGTATCTATCCTGTT GGARCATGTGGTTTATTCGATGAT AGCTGACGACAACCATGCAG GGAGYATGTGGTTTAATTCGAAGCA AGCTGACGACAACCATGCAC CGCGTCYGGTGTGAAAG CCCCACATCCAGCATCCA AGCAGTAGGGAATCTTCCA CACCGCTACACATGGAG TACCHRAGGAGGAAGCCAC GTTCTTCCTAATCTCTACGCAT CGCTAATCGGTCAGGTTAAAGAG CCCTTTACGTTTCACTACCCAAA ATACCCTGGTAGTCCACGCT CCACATACTCCACCGCTTGT

UnivF UnivR Bact934F Bact1060R Firm934F Firm1060R F-bifido R-bifido Lacto-F Lacto-R CI-F1 CI-R2 341F 411R DSV_f DSV_r

~459

total

L. rhamnosus

Wang L, 2011

~126

Bacteroidetes

B. fragilis

Guo X, 2008

~126

Firmicutes

C. perfringens

Williams BL, 2011; Guo X, 2008

~244

Bifidobacterium spp.

B. longum

Delroisse JM, 2008

~341

Lactobacillus spp.

L. rhamnosus

Wang L, 2011 Rinttilä T, 2004

~232

Clostridium cluster I

C. perfringens

Song Y, 2004

70

S.thermophilus

S. thermophilus

Ongol MP, 2009

~160

Desulfovibrio spp.

D. idahonensis

This study

182

A. Tomova et al. / Physiology & Behavior 138 (2015) 179–187

Fig. 1. GI symptoms scoring in control children (C), children with autism (A), and siblings of children with autism (S).

proportion of Bifidobacterium from the total microflora did not differ in the groups of children with and without autism (Fig. 4C,D). Investigations of Clostridia cluster l and Desulfovibrio showed a higher abundance of these species in children with autism compared to controls, and compared to all other groups, but this difference was not significant (Fig. 4E,F). Streptococcus thermophillus and the total bacteria content had no significant difference between the groups (data not shown). Interestingly, children with more severe GI symptoms (score 5) had a lower Clostridia and Desulfovibrio amount and lower Bacteroidetes/ Firmicutes ratio compared to the children with mild GI symptoms (8.1E+ 07 vs 9.9E+ 08; 8.3E+ 07 vs 1.3E+ 08 and 0.33 vs 0.64 correspondingly, not statistically significant). Unlike this, the children with more severe autism (CARS ≥ 50) had a higher Clostridia and Desulfovibrio amount and lower Bacteroidetes/Firmicutes ratio compared to the children with mild autism (2.6E+ 08 vs 1.2E+ 08; 1.1E+ 08 vs 9.9E+07 and 0.42 vs 0.48 correspondingly, not statistically significant). We did not find any correlation of GI symptoms and Desulfovibrio abundance. 3.2. Correlation between the fecal microbiota and autism severity The severity of dysbacteriosis in the group of children with autism, represented by the change of Bacteroidetes/Firmicutes ratio had only a weak negative trend towards correlation with the severity of autism evaluated by the ADI score. However, the severity of autism manifestations (ADI) showed a trend towards a positive correlation with the relative amount of Desulfovibrio (R = 0.61, p = 0.1) and it was mainly based on the very strong correlation of Desulfovibrio with the ADI restricted/repetitive behavior subscale score (R = 0.83, p b 0.05)

Fig. 3. Abundance of dominant phyla in fecal microflora of control children (C), children with autism (A), children with autism after probiotic therapy (A_L), siblings of children with autism (S). A. Bacteroidetes/Firmicutes ratio; B. Bacteroidetes; C. Firmicutes; *** p b 0.05.

(Fig. 5). These data may suggest a pathogenetic role of Desulfovibrio spp. in the development of autism. We did not find any correlation of the severity of autism evaluated by CARS score with fecal microbiota. 3.3. Effect of probiotic

Fig. 2. Correlation between ADI and GI symptoms in children with autism, R = 0.78 p = 0.01.

After the probiotic implementation the amount of Firmicutes significantly decreased, which resulted in the increase of the Bacteroidetes/ Firmicutes ratio to the level of the healthy individuals (Fig. 3A). From beneficial bacteria which we investigated in the stool of autistic children the amount of Bifidobacterium decreased significantly after the probiotic intervention and reached the level of the gastrointestinal content of the healthy subjects (Fig. 4B). The absolute amount of Lactobacillus had a

A. Tomova et al. / Physiology & Behavior 138 (2015) 179–187

183

Fig. 4. Species abundance in fecal microflora of control children (C), children with autism (A), children with autism after probiotic therapy (A_L), siblings of children with autism (S). A. Lactobacillus spp.; B. Bifidobacterium spp.; C. Lactobacillus/total bacteria ratio; D. Bifidobacterium/total bacteria ratio; E. Clostridia cluster l; F. Desulfovibrio spp.; *** p b 0.05.

downward trend, and attained a level not significantly different from the healthy children. On the other hand, the relative amount of Lactobacillus increased twice after administration of probiotic containing 60% of Lactobacillus. Desulfovibrio — a suspected etiopathogenetic agent of autism, decreased significantly after the probiotic therapy (Fig. 4F). 3.4. Siblings The group of siblings of autistic children had shown significantly increased Firmicutes and a trend to a decreased amount of Bacteroidetes,

with a significantly decreased ratio of Bacteroidetes/Firmicutes compared to controls (Fig. 3A). Neither Bacteroidetes, nor Firmicutes phyla had significantly different representation in the children with autism and their siblings (Fig. 3B,C). The presence of the specific bacteria species we investigated, including beneficial bacteria and putative etiopathogenetic agents, did not show significant differences from the control group. At the same time, the samples showed trends of decreased abundance of Clostridia and Desulfovibrio and significantly lower abundance of Bifidobacterium in siblings than in children with an autistic disorder (Fig. 4B,E,F), which might point to the importance of these bacterial agents in the development of autism.

184

A. Tomova et al. / Physiology & Behavior 138 (2015) 179–187

p b 0.05) (already observed before in our laboratory, unpublished data). Plasma level of DHEA-S was significantly lower in children with autism, compared to healthy children and compared to autistic siblings (p b 0.05) (Fig. 7B). We observed only a trend towards a correlation between decreased DHEA-S level and lower Bacteroidetes/Firmicutes ratio in children with autism (R = 0.45, p = 0.1). Testosterone levels did not show significant differences between groups, but had a significant positive correlation with the severity of autism (ADI) (R = 0.74, p b 0.05) (data not shown). 4. Discussion

Fig. 5. Correlation between ADI RRB and Desulfovibrio spp. abundance in children with autism, R = 0.83, p b 0.05.

3.5. Cytokine TNFα levels in the stool Although not statistically significant, the levels of the mean concentration of fecal TNFα were increased in the groups of autistic children and their siblings (66 – 100 pg/g stool) compared to the control group and autistic children after probiotic implementation group (14–21 pg/g stool) (data not shown). We also found a strong correlation between TNFα levels and GI symptoms (R = 0.78, p b 0.05) (data not shown). Moreover, our data showed a trend toward correlation of fecal TNFα levels with the severity of autism (ADI) (R = 0.7, p = 0.06) (data not shown), which supports the theory of involvement of GI inflammation and permeability in the severity of autism. The probiotic supplementation significantly decreased the TNFα levels in the feces of children with autism (two-tailed p b 0.05) (Fig. 6). One patient was excluded because of its high basal TNFα level suggesting an acute inflammatory process.

3.6. Plasma hormones The level of oxytocin was significantly lower in the plasma of children with autism and in their siblings compared to healthy children (p b 0.05) (Fig. 7A). We found in our study a significant positive correlation of plasma oxytocin levels and autism severity (ADI) (R = 0.71,

Fig. 6. Dynamic of TNF alpha in stool samples of children with autism before (A) and after probiotic supplementation (A_L), dynamic of group average (arrow), pg/mL, p b 0.05.

Although the major deficits in ASD are social and cognitive, individuals with autism often suffer from GI disorders [2–4], and it remains to be determined whether they are directly related to ASD pathophysiology, or are strictly comorbid condition. GI complains are accompanied by intestinal microflora changes and, therefore, it is important to identify microbiome and specific microorganisms' changes that can be targeted for diagnosis as well as for treatment of autism-related GI problems and possibly of autistic symptoms of these children. In our study the frequency and severity of GI symptoms in children with autism and in their siblings were higher than in control group children (p b 0.05), which allows the comparison of these three groups to help shed light on the specificity of intestinal microbiota in children with autism and consequently to help detect the microbial participants in so called “gut-brain” axis. At first we found in our participants a strong positive correlation between the manifestations of GI symptoms and the severity of autism (ADI), as it has been shown in some previous studies [4,5]. There was also strong correlation between the severity of GI disorders and the levels of fecal TNFα showing the connection with intestinal inflammation and permeability [40–43]. Surveillance of pro- and anti-inflammatory cytokine levels in stool of patients opens the way of accessible control of their GI disorders [41,42,44,45]. The intestinal dysbiosis in children with autism was represented by the significantly lower Bacteroidetes/Firmicutes ratio compared to the control children. It resulted from the lower abundance of Bacteroidetes phylum, what might include a recently described drop in the incidence of its large fraction — Prevotella genera [46]. The reduction of the Bacteroidetes/Firmicutes ratio is supported by the recent study [19] in children with/without autism, while it appears to be incongruent with the other study 2010 [18], where the Bacteroidetes/Firmicutes ratio in children with autismus was increased. The possible reasons of opposing results in different studies can be the age of participants — fecal microflora of younger people contains proportionally less Bacteroidetes [47], geographical area – in fecal microflora of European population is described the dominance of Firmicutes [48], the level of GI tract where sample was taken, or the presence of GI disorders in the control group [19]. Therefore, for the correct interpretation of the role of gut microbiota in etiopathogenesis of autism is very important to compare matching homogeneous groups. The increased Lactobacillus genus and tendency to increased Clostridia class l abundance in children with autism in our study has been described before [4,13,16,21]. Although we observed only trends for increased Clostridia cluster l and Desulfovibrio in children with autism, we found a very strong correlation of Desulfovibrio with the severity of autism manifestations represented by the ADI restricted/ repetitive behavior subscale score. These data support the hypothesis of Desulfovibrio involvement in pathogenesis of autism and does not confront the hypothesis of Clostridia involvement [15,16,20–22]. However, the large distribution of these two bacterial populations and their incidences in our patients with autism suggests that they might play a pathophysiological role only in a specific group of patients with ASD, what remains to be established. It is well known and it was already shown not only in animal models, but also in human studies, that probiotics change intestinal microbiota,

A. Tomova et al. / Physiology & Behavior 138 (2015) 179–187

185

Fig. 7. Plasma levels of A. Oxytocin, pg/mL, and B. DHEA-S, μg/mL, in control children (C), children with autism (A) and siblings of children with autism (S). *** p b 0.05.

influence immunity, and stabilize the mucosal barrier [49,50]. In more recent studies it has been also shown that probiotics influence the ‘gut-brain’ axis modeling the behavior in the way that significantly reduces anxiety, depression, and stress [6,50,51]. These results suggest potential beneficial effect of probiotics use in children with autism [17]. Although, before making a definitive conclusion of the beneficial effect from using probiotics, we propose taking into consideration the well-established fact that the health effects of probiotics vary within the species and particular strains of bacteria, based on genetic differences and the nature of bacteria-host interactions and, therefore, the probiotic should be selected individually. The probiotic we used in our study includes L. casei and B. longum with described positive gut-brain effects [12,52]. After the probiotic supplementation we observed a significant decrease of Firmicutes, Bifidobacterium and Desulfovibrio in the stool of children with autism and a trend to a decrease in Clostridia. The probiotic therapy resulted in an increase of the Bacteroidetes/ Firmicutes ratio to values not significantly different from that in neurotypical children. The positive effect of probiotic supplementation was represented not only by the ability to normalize the ratio of individual bacteria in gut microbiota, but also by the tendency to reduce intestinal inflammation (decrease fecal TNFα levels) in children with autism. Interestingly, the intestinal microbiota of siblings in our study had a lower Bacteroidetes/Firmicutes ratio compared to controls. Although the dysbiosis on the phyla level was even more severe than in autistic children, the microbiota of siblings on the level of species (Desulfovibrio, Clostridia cluster l and Bifidobacterium) did not differ from the healthy children. The general dysbacteriosis in siblings as well as in autistic children could be due to their GI dysfunction, but the trends of increased Desulfovibrio and Clostridia specifically in the microbiota of children with autism supports our theory of involvement of these species in autism development. Several other investigators found the microbiota of siblings to be more similar to autistic children than to the true control subjects [18,23], and the explanation of this could be a similar diet or other family factors influencing the intestinal microbiota, or the possible transmission of bacteria from autistic children to siblings, leading even to the development of this disease if there was a predisposition [18]. To support our hypothesis that there is a specific predisposition for Desulfovibrio and Clostridia leading to autism, but not to GI symptoms, we focused on the following trends: within the children with autism those with more severe autism had a higher Desulfovibrio and Clostridia amount compared to children with milder autism, while within the same group those with more severe GI problems had lower Desulfovibrio and Clostridia in comparison to the children with mild GI symptoms. On the other hand, within the children with autistic disorders those with more severe autism, as well as with more severe GI

problems had lower Bacteroidetes/Firmicutes ratio compared to the children with mild severity similarly compared to the control group children. Because of the small group of participants in our study, these tendencies allow us only to speculate about the possible contribution of Desulfovibrio and Clostridia in autism pathogenesis. The presence of specific bacteria or significantly changed ratios of normally present bacteria could play a role in the pathophysiology of disease and indicate the severity of the health condition of the patient. Metabolic products, such as propionic acid produced by enteric bacteria, including Clostridia, Desulfovibrio and Bacteroidetes, were shown to bring ASD-relevant behavioral and brain events to adult rats [53,54]. Bacterial toxins influence intercellular tight-junction of intestinal epithelium affecting the intestinal permeability and causing the ″leaky gut″ [55–59]. Increased penetration of bacterial products into the blood leads to inflammation and oxidative stress, resulting in neurological and behavioral changes and progression of the disease [2]. The role of gut microbiota in human metabolism, in the development of immune system, and functioning of the brain has been shown before [6,7]. The intestinal microbiota has direct as well as indirect effects on the intestinal epithelium, on the local mucosal immune system, on the enteric nervous system, affecting the afferent neuronal pathways transmitting signals from the gut to the brain. Intestinal bacteria synthesize a vast array of bio- and neuro-active molecules including neurotransmitters such as GABA and short chain fatty acids which through complex interactions upon the HPA (hypothalamuspituitary-adrenal) axis are targeting CNS structures and, therefore, affecting cognition and mood [6,60]. The cellular and biochemical pathways of gut-brain interaction provides strong evidence of the influences of normal gut microbiota on each step from the gene expression, development, neurochemistry, to functioning of the brain [8–10]. Rapidly is increasing evidence pointing to variations in the composition of gut microbes which are associated with changes in the normal functioning of the nervous system and behavior [11,12,61]. Intestinal microbiota is clearly involved in autism manifestations, but how and in combination of which other factors remains unclear. For a more complex view on the investigated pathogenesis of autism we have also measured changes in the plasma level of selected hormones. We observed significantly lower plasma oxytocin and DHEA-S levels in children with autism compared to the control, the plasma level of testosterone had strong positive correlation with the autism severity as well as the oxytocin level had. Lower level of DHEA-S in autistic children, but not in siblings. This could decrease the neuroprotective effect of DHEA-S [62] or lead to an excessive GABAergic influence [28] what may be manifested by behavioral changes in autistic children. Nevertheless, we were not able to detect any significant correlation between hormone levels and intestinal microflora abundance, which does not allow us to make any conclusions of their joint impact.

186

A. Tomova et al. / Physiology & Behavior 138 (2015) 179–187

5. Conclusion This is the first investigation of gastrointestinal microbiota in children with autism in Slovakia. We found that the gut microflora assessed from stool samples in children with autism differs from the one in children without autism: the Bacteroidetes/Firmicutes ratio was decreased and the Lactobacillus abundance was elevated. We also observed trends for elevated Clostridia cluster l and Desulfovibrio incidences in children with autism. Interestingly, gut microbiota of siblings had significant deviations of Bacteroidetes/Firmicutes ratio from the control group children. There was a correlation of the amount of Desulfovibrio with the severity of autism, based on the very strong correlation of Desulfovibrio abundance with the ADI restricted/repetitive behavior subscale score. In our study autism severity (ADI) correlated with the severity of GI dysfunction, which correlated with the fecal levels of pro-inflammatory cytokine TNFa. After probiotic supplementation in children with autism the Bacteroidetes/Firmicutes ratio in their feces normalized, and the amount of Bifidobacterium and Desulfovibrio decreased significantly. With significantly decreased plasma oxytocin and DHEA-S in autism, and strong positive correlation between testosterone or oxytocin levels with autism, we did not find any strong correlation between their plasma levels and fecal microbiota, which would suggest their shared influence in disease development. The obvious limitation of our study was the small number of participants. Nevertheless, the results obtained in this pilot study give us good starting point for further investigation with larger groups to elucidate the role of specific bacteria in GI and possibly in other manifestations of autism, and to look for fecal microbiota correlation with selected genetic and hormonal changes in children with autism. Acknowledgements A particular thanks to Dr. Perďochová, HPL spol. s.r.o., Slovakia and Dr. Gordon Webster, Cardiff University, UK for providing the reference bacterial strains. We thank Dr. P. Celec, Institute of Molecular Biomedicine FM CU, Slovakia, for his suggestions in modeling the experiment, Dr. B. Mravec, Institute of Physiology, FM CU, Slovakia, and Dr. A. Tillinger, SAS, Slovakia, for their manuscript suggestions, and Dr L. Levy, College of Osteopathic Medicine of Nova Southeastern University, USA, for editing the article. We also thank cordially the individuals and families who so generously participated in our study. The authors have no conflict of interest to declare, the funders had no role in study design, data collection and analysis, or preparation of the manuscript. This work was supposted by Ministry of Education and Slovak Akademy of Sciences, VEGA 1/0086/14, and Slovak Research and Development Agency, APVV 0254–11. References [1] ADDMNS. Prevalence of autism spectrum disorder among children aged 8 years autism and developmental disabilities monitoring network, 11 sites, United States, 2010. MMWR Surveill Summ 2014;63(Suppl. 2):1–21. [2] Coury DL, Ashwood P, Fasano A, Fuchs G, Geraghty M, Kaul A, et al. Gastrointestinal conditions in children with autism spectrum disorder: developing a research agenda. Pediatrics 2012;130(Suppl. 2):S160–8. [3] Babinská K, Slobodníková L, Jánošíková D, Lakatošová S, Bakoš J, Ostatníková D. The effects of probiotic administration on gastrointestinal functions in children with autism. Act Nerv Super Rediviva 2012;54:82. [4] Adams JB, Johansen LJ, Powell LD, Quig D, Rubin RA. Gastrointestinal flora and gastrointestinal status in children with autism–comparisons to typical children and correlation with autism severity. BMC Gastroenterol 2011;11:22. [5] Buie T, Campbell DB, Fuchs III GJ, Furuta GT, Levy J, Vandewater J, et al. Evaluation, diagnosis, and treatment of gastrointestinal disorders in individuals with ASDs: a consensus report. Pediatrics 2010;125(Suppl. 1):S1–S18. [6] Forsythe P, Sudo N, Dinan T, Taylor VH, Bienenstock J. Mood and gut feelings. Brain Behav Immun 2010;24:9–16. [7] Mulle JG, Sharp WG, Cubells JF. The gut microbiome: a new frontier in autism research. Curr Psychiatry Rep 2013;15:337. [8] Cryan JF, O'Mahony SM. The microbiome-gut-brain axis: from bowel to behavior. Neurogastroenterol Motil 2011;23:187–92.

[9] Diaz Heijtz R, Wang S, Anuar F, Qian Y, Bjorkholm B, Samuelsson A, et al. Normal gut microbiota modulates brain development and behavior. Proc Natl Acad Sci U S A 2011;108:3047–52. [10] Rhee SH, Pothoulakis C, Mayer EA. Principles and clinical implications of the braingut-enteric microbiota axis. Nat Rev Gastroenterol Hepatol 2009;6:306–14. [11] Mayer EA. Gut feelings: the emerging biology of gut-brain communication. Nat Rev Neurosci 2011;12:453–66. [12] Rao AV, Bested AC, Beaulne TM, Katzman MA, Iorio C, Berardi JM, et al. A randomized, double-blind, placebo-controlled pilot study of a probiotic in emotional symptoms of chronic fatigue syndrome. Gut Pathog 2009;1:6. [13] Bolte ER. Autism and Clostridium tetani. Med Hypotheses 1998;51:133–44. [14] Sandler RH, Finegold SM, Bolte ER, Buchanan CP, Maxwell AP, Vaisanen ML, et al. Short-term benefit from oral vancomycin treatment of regressive-onset autism. J Child Neurol 2000;15:429–35. [15] Finegold SM. Therapy and epidemiology of autism–clostridial spores as key elements. Med Hypotheses 2008;70:508–11. [16] Parracho HM, Bingham MO, Gibson GR, McCartney AL. Differences between the gut microflora of children with autistic spectrum disorders and that of healthy children. J Med Microbiol 2005;54:987–91. [17] Critchfield JW, van Hemert S, Ash M, Mulder L, Ashwood P. The potential role of probiotics in the management of childhood autism spectrum disorders. Gastroenterol Res Pract 2011;2011:161358. [18] Finegold SM, Dowd SE, Gontcharova V, Liu C, Henley KE, Wolcott RD, et al. Pyrosequencing study of fecal microflora of autistic and control children. Anaerobe 2010; 16:444–53. [19] Williams BL, Hornig M, Buie T, Bauman ML, Cho Paik M, Wick I, et al. Impaired carbohydrate digestion and transport and mucosal dysbiosis in the intestines of children with autism and gastrointestinal disturbances. PLoS One 2011;6:e24585. [20] Finegold SM. Desulfovibrio species are potentially important in regressive autism. Med Hypotheses 2011;77:270–4. [21] Song Y, Liu C, Finegold SM. Real-time PCR quantitation of clostridia in feces of autistic children. Appl Environ Microbiol 2004;70:6459–65. [22] Finegold SM, Molitoris D, Song Y, Liu C, Vaisanen ML, Bolte E, et al. Gastrointestinal microflora studies in late-onset autism. Clin Infect Dis 2002;35:S6–S16. [23] Wang L, Christophersen CT, Sorich MJ, Gerber JP, Angley MT, Conlon MA. Low relative abundances of the mucolytic bacterium Akkermansia muciniphila and Bifidobacterium spp. in feces of children with autism. Appl Environ Microbiol 2011;77:6718–21. [24] Williams BL, Hornig M, Parekh T, Lipkin WI. Application of novel PCR-based methods for detection, quantitation, and phylogenetic characterization of Sutterella species in intestinal biopsy samples from children with autism and gastrointestinal disturbances. mBio 2012:3. [25] Anderson GM. Twin studies in autism: what might they say about genetic and environmental influences. J Autism Dev Disord 2012;42:1526–7. [26] Hallmayer J, Cleveland S, Torres A, Phillips J, Cohen B, Torigoe T, et al. Genetic heritability and shared environmental factors among twin pairs with autism. Arch Gen Psychiatry 2011;68:1095–102. [27] Heberling CA, Dhurjati PS, Sasser M. Hypothesis for a systems connectivity model of Autism Spectrum Disorder pathogenesis: links to gut bacteria, oxidative stress, and intestinal permeability. Med Hypotheses 2013;80:264–70. [28] Strous RD, Golubchik P, Maayan R, Mozes T, Tuati-Werner D, Weizman A, et al. Lowered DHEA-S plasma levels in adult individuals with autistic disorder. Eur Neuropsychopharmacol 2005;15:305–9. [29] Auyeung B, Lombardo MV, Baron-Cohen S. Prenatal and postnatal hormone effects on the human brain and cognition. Pflugers Arch 2013;465:557–71. [30] Geier DA, Kern JK, King PG, Sykes LK, Geier MR. An evaluation of the role and treatment of elevated male hormones in autism spectrum disorders. Acta Neurobiol Exp (Wars) 2012;72:1–17. [31] Schopler E, Reichler RJ, DeVellis RF, Daly K. Toward objective classification of childhood autism: Childhood Autism Rating Scale (CARS). J Autism Dev Disord 1980;10: 91–103. [32] Ozonoff S, Goodlin-Jones BL, Solomon M. Evidence-based assessment of autism spectrum disorders in children and adolescents. J Clin Child Adolesc Psychol 2005; 34:523–40. [33] Mayes SD, Calhoun SL, Murray MJ, Morrow JD, Yurich KK, Mahr F, et al. Comparison of scores on the Checklist for Autism Spectrum Disorder, Childhood Autism Rating Scale, and Gilliam Asperger's Disorder Scale for children with low functioning autism, high functioning autism, Asperger's disorder, ADHD, and typical development. J Autism Dev Disord 2009;39:1682–93. [34] Le Couteur A, Rutter M, Lord C, Rios P, Robertson S, Holdgrafer M, et al. Autism diagnostic interview: a standardized investigator-based instrument. J Autism Dev Disord 1989;19:363–87. [35] Guo X, Xia X, Tang R, Zhou J, Zhao H, Wang K. Development of a real-time PCR method for Firmicutes and Bacteroidetes in faeces and its application to quantify intestinal population of obese and lean pigs. Lett Appl Microbiol 2008;47:367–73. [36] Ongol MP, Asano K. Main microorganisms involved in the fermentation of Ugandan ghee. Int J Food Microbiol 2009;133:286–91. [37] Delroisse JM, Boulvin AL, Parmentier I, Dauphin RD, Vandenbol M, Portetelle D. Quantification of Bifidobacterium spp. and Lactobacillus spp. in rat fecal samples by real-time PCR. Microbiol Res 2008;163:663–70. [38] Rinttilä T, Kassinen A, Malinen E, Krogius L, Palva A. Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J Appl Microbiol 2004;97:1166–77. [39] Wessa, P. Pearson Correlation (v1.0.6) in Free Statistics Software (v1.1.23-r7), Office for Research Development and Education. http://www.wessa.net/rwasp_correlation.wasp2012. p. http://www.wessa.net/rwasp_correlation.wasp.

A. Tomova et al. / Physiology & Behavior 138 (2015) 179–187 [40] Heyman M, Darmon N, Dupont C, Dugas B, Hirribaren A, Blaton MA, et al. Mononuclear cells from infants allergic to cow's milk secrete tumor necrosis factor alpha, altering intestinal function. Gastroenterology 1994;106:1514–23. [41] Saiki T, Mitsuyama K, Toyonaga A, Ishida H, Tanikawa K. Detection of pro- and antiinflammatory cytokines in stools of patients with inflammatory bowel disease. Scand J Gastroenterol 1998;33:616–22. [42] Braegger CP, Nicholls S, Murch SH, Stephens S, MacDonald TT. Tumour necrosis factor alpha in stool as a marker of intestinal inflammation. Lancet 1992;339:89–91. [43] Alcantara CS, Yang CH, Steiner TS, Barrett LJ, Lima AA, Chappell CL, et al. Interleukin8, tumor necrosis factor-alpha, and lactoferrin in immunocompetent hosts with experimental and Brazilian children with acquired cryptosporidiosis. Am J Trop Med Hyg 2003;68:325–8. [44] Long KZ, Rosado JL, Santos JI, Haas M, Al Mamun A, DuPont HL, et al. Associations between mucosal innate and adaptive immune responses and resolution of diarrheal pathogen infections. Infect Immun 2010;78:1221–8. [45] Long KZ, Santos JI, Rosado JL, Estrada-Garcia T, Haas M, Al Mamun A, et al. Vitamin A supplementation modifies the association between mucosal innate and adaptive immune responses and resolution of enteric pathogen infections. Am J Clin Nutr 2011; 93:578–85. [46] Kang DW, Park JG, Ilhan ZE, Wallstrom G, Labaer J, Adams JB, et al. Reduced incidence of Prevotella and other fermenters in intestinal microflora of autistic children. PLoS One 2013;8:e68322. [47] Claesson MJ, Cusack S, O'Sullivan O, Greene-Diniz R, de Weerd H, Flannery E, et al. Composition, variability, and temporal stability of the intestinal microbiota of the elderly. Proc Natl Acad Sci U S A 2011;108(Suppl. 1):4586–91. [48] Qin J, Li R, Raes J, Arumugam M, Burgdorf KS, Manichanh C, et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature 2010;464: 59–65. [49] Bested AC, Logan AC, Selhub EM. Intestinal microbiota, probiotics and mental health: from Metchnikoff to modern advances: part III - convergence toward clinical trials. Gut Pathog 2013;5:4. [50] Hsiao EY, McBride SW, Hsien S, Sharon G, Hyde ER, McCue T, et al. Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell 2013;155:1451–63. [51] Messaoudi M, Lalonde R, Violle N, Javelot H, Desor D, Nejdi A, et al. Assessment of psychotropic-like properties of a probiotic formulation (Lactobacillus helveticus

[52]

[53]

[54]

[55]

[56] [57] [58] [59]

[60]

[61] [62]

187

R0052 and Bifidobacterium longum R0175) in rats and human subjects. Br J Nutr 2011;105:755–64. Bercik P, Park AJ, Sinclair D, Khoshdel A, Lu J, Huang X, et al. The anxiolytic effect of Bifidobacterium longum NCC3001 involves vagal pathways for gut-brain communication. Neurogastroenterol Motil 2011;23:1132–9. MacFabe DF, Cain NE, Boon F, Ossenkopp KP, Cain DP. Effects of the enteric bacterial metabolic product propionic acid on object-directed behavior, social behavior, cognition, and neuroinflammation in adolescent rats: Relevance to autism spectrum disorder. Behav Brain Res 2011;217:47–54. Thomas RH, Meeking MM, Mepham JR, Tichenoff L, Possmayer F, Liu S, et al. The enteric bacterial metabolite propionic acid alters brain and plasma phospholipid molecular species: further development of a rodent model of autism spectrum disorders. J Neuroinflammation 2012;9:153. de Magistris L, Familiari V, Pascotto A, Sapone A, Frolli A, Iardino P, et al. Alterations of the intestinal barrier in patients with autism spectrum disorders and in their firstdegree relatives. J Pediatr Gastroenterol Nutr 2010;51:418–24. D'Eufemia P, Celli M, Finocchiaro R, Pacifico L, Viozzi L, Zaccagnini M, et al. Abnormal intestinal permeability in children with autism. Acta Paediatr 1996;85:1076–9. Liu Z, Li N, Neu J. Tight junctions, leaky intestines, and pediatric diseases. Acta Paediatr 2005;94:386–93. Nusrat A, Sitaraman SV, Neish A. Interaction of bacteria and bacterial toxins with intestinal epithelial cells. Curr Gastroenterol Rep 2001;3:392–8. Altieri L, Neri C, Sacco R, Curatolo P, Benvenuto A, Muratori F, et al. Urinary p-cresol is elevated in small children with severe autism spectrum disorder. Biomarkers 2011;16:252–60. Sudo N, Chida Y, Aiba Y, Sonoda J, Oyama N, Yu XN, et al. Postnatal microbial colonization programs the hypothalamic-pituitary-adrenal system for stress response in mice. J Physiol 2004;558:263–75. Stilling RM, Dinan TG, Cryan JF. Microbial genes, brain & behaviour - epigenetic regulation of the gut-brain axis. Genes Brain Behav 2014;13:69–86. Duszczyk-Budhathoki M, Olczak M, Lehner M, Majewska MD. Administration of thimerosal to infant rats increases overflow of glutamate and aspartate in the prefrontal cortex: protective role of dehydroepiandrosterone sulfate. Neurochem Res 2012; 37:436–47.