GdpS contributes to Staphylococcus aureus biofilm formation by regulation of eDNA release.

ARTICLE IN PRESS

G Model IJMM-50763; No. of Pages 16

International Journal of Medical Microbiology xxx (2013) xxx–xxx

Contents lists available at ScienceDirect

International Journal of Medical Microbiology journal homepage: www.elsevier.com/locate/ijmm

GdpS contributes to Staphylococcus aureus biofilm formation by regulation of eDNA release A. Fischer a,∗ , K. Kambara a , H. Meyer b , L. Stenz a , E.-J. Bonetti a , M. Girard a , M. Lalk b , P. Francois a , J. Schrenzel a a b

Genomic Research Laboratory, Department of Medical Specialties, Geneva University Hospitals, 1211 Geneva 14, Switzerland Institute of Biochemistry, University of Greifswald, Felix-Hausdorff-Strasse 4, 17487 Greifswald, Germany

a r t i c l e

i n f o

Article history: Received 4 July 2013 Received in revised form 25 October 2013 Accepted 27 October 2013 Available online xxx Keywords: Staphylococcus aureus Biofilm eDNA lrgAB cidABC Cyclic-di-GMP GGDEF domain Transcriptomic

a b s t r a c t In Staphylococcus aureus, the role of the GGDEF domain-containing protein GdpS remains poorly understood. Previous studies reported that gdpS mutant strains had decreased biofilm formation due to changes in icaADBC expression that were independent of cyclic-di-GMP levels. We deleted gdpS in three unrelated S. aureus isolates, and analyzed the resultant mutants for alterations in biofilm formation, metabolism and transcription. Dynamic imaging during biofilm development showed that GdpS inhibited early biofilm formation in only two out of the three strains examined, without affecting bacterial survival. However, quantification of biofilm formation using crystal violet staining revealed that inactivation of gdpS affected biofilm formation in all three studied strains. Extraction of metabolites from S. aureus cells confirmed the absence of cyclic-di-GMP, suggesting that biofilm formation in this species differs from that in other Gram-positive organisms. In addition, targeted mutagenesis demonstrated that the GGDEF domain was not required for GdpS activity. Transcriptomic analysis revealed that the vast majority of GGDEF-regulated genes were involved in virulence, metabolism, cell wall biogenesis and eDNA release. Finally, expression of lrgAB or deletion of cidABC in a strain lacking gdpS confirmed the role of GdpS on regulation of eDNA production that occurred without an increase in cell autolysis, but with a late increase in holin-mediated autolysis, in the presence of high oxacillin concentrations. In summary, S. aureus GdpS contributes to cell-to-cell interactions during early biofilm formation by influencing expression of lrgAB and cidABC mediated eDNA release. We conclude that GdpS acts as a negative regulator of eDNA release. © 2013 Elsevier GmbH. All rights reserved.

Introduction Staphylococcus aureus is a prevalent human pathogen causing high morbidity; however, the molecular mechanisms of its pathogenesis remain largely unknown (Al-Talib et al., 2010; Lazarevic et al., 2011; Niven et al., 2010; Peters and Pulverer, 1984; Zafar et al., 2011). Under defined conditions, biofilm formation increases the severity of S. aureus related infections (cystic fibrosis, endocarditis, infectious arthritis, catheter-related bacteremia) (Raad, 1998), and leads to an increased phenotypic tolerance to antimicrobial agents. Biofilms form when bacterial cells adhere to a surface and then begin producing polysaccharides (O’Toole and Kolter, 1998). In S. aureus, interactions with abiotic hydrophilic surfaces are mediated by PIA (polysaccharide intracellular adhesin) (Gotz, 2002). PIA is encoded by the ica operon (icaABCD) (Cramton et al., 1999),

∗ Corresponding author at: Genomic Research Laboratory, Department of Medical Specialties, Geneva University Hospitals, 4 rue Gabrielle-Perret-Gentil, 1211 Geneva 14, Switzerland. Tel.: +41 022 372 9818; fax: +41 022 372 9830. E-mail address: adrien.fi[email protected] (A. Fischer).

whose products are also involved in the synthesis of an extracellular polysaccharidic glucidic matrix that can be destroyed by metaperiodate or DispersinB® , a commercially available antibiofilm enzyme (Kaplan et al., 2004; Kogan et al., 2006). ica-independent biofilms (absence of PIA) can be easily dissolved by proteinase K (Chaignon et al., 2007; Kogan et al., 2006; Toledo-Arana et al., 2005). Formation of both types of biofilms is currently actively studied as neither their regulation nor their respective roles during infection are fully understood. A recent study demonstrated the important role of two cysteine proteases SspB and ScpA in S. aureus biofilms (Mootz et al., 2013). Surface proteins Bap (biofilm-associated protein), Eap (extracellular adherence protein) or PSM (phenol soluble modulin) promote S. aureus adherence to host cells and surfaces as well as cell aggregation (Cucarella et al., 2001; Hussain et al., 2002, 2008; Thompson et al., 2010). Intercellular auto-aggregation is also favored by SasG (S. aureus surface protein G) (Corrigan et al., 2007) but inhibited by the delta hemolysin (Hld or PSM␥) (Vuong et al., 2003). Hld is encoded by RNAIII, the effector of the agr quorum sensing system (Janzon et al., 1989). During the maturation step, SigB inhibits RNAIII expression, decreasing secretion of the extracellular

1438-4221/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.ijmm.2013.10.010

Please cite this article in press as: Fischer, A., et al., GdpS contributes to Staphylococcus aureus biofilm formation by regulation of eDNA release. Int. J. Med. Microbiol. (2013), http://dx.doi.org/10.1016/j.ijmm.2013.10.010

G Model IJMM-50763; No. of Pages 16 2

ARTICLE IN PRESS A. Fischer et al. / International Journal of Medical Microbiology xxx (2013) xxx–xxx

proteases and thus favoring biofilm maturation (Lauderdale et al., 2009). SarA regulates extracellular protease production and is involved in the production of surface-binding proteins like spa or hla (Zielinska et al., 2012). SaeRS is a two-component system that controls the expression of the S. aureus nuclease nuc (Olson et al., 2013). SaeRS and SarA were recently shown to synergistically decrease the production of proteases in S. aureus, thus favoring the formation of protein-dependent biofilms (Mrak et al., 2012). In various microorganisms, the structure and stability of biofilms is dependent on the release or the intracellular accumulation of small molecules, and on the presence of extracellular DNA (eDNA) (Kirkpatrick and Viollier, 2010; Rice et al., 2007; Spoering and Gilmore, 2006; Thomas et al., 2008, 2009). eDNA provides structure and stability in mature biofilms of S. aureus (Bayles, 2007; Izano et al., 2008; Rice et al., 2007), and many other species (Allesen-Holm et al., 2006; Whitchurch et al., 2002). eDNA facilitates cell attachment to surfaces (Heijstra et al., 2009; Rice et al., 2007), and cell-to-cell interactions during early biofilm formation in Enterococcus faecalis (Barnes et al., 2012). In many bacteria, eDNA in the biofilm matrix originates by cell lysis, which is tightly regulated by autolysins. In S. aureus, an increase in eDNA concentration is caused by the major autolysin Atl (Houston et al., 2011), and the bacteriophage holin-antiholin like system cid-lrg (Rice and Bayles, 2008). cid and lrg are regulated by CidR (Yang et al., 2005) and LytSR (Brunskill and Bayles, 1996). While murein hydrolysis (and thus eDNA release) is favored by cid (Rice et al., 2003) (Rice et al., 2007), lrg inhibits these processes (Groicher et al., 2000; Mann et al., 2009; Sharma-Kuinkel et al., 2009). Although autolysisindependent eDNA secretion has been described in many bacteria, including E. faecalis (Barnes et al., 2012), Pseudomonas aeruginosa (Whitchurch et al., 2002), Bacillus cereus (Vilain et al., 2009), Streptococcus sanguinis and S. gordonii (Kreth et al., 2009), the existence of such secretion has not yet been identified in S. aureus. Following biofilm maturation, staphylococcal bacteria may disperse using a thermonuclease (nuc) that degrades eDNA (Mann et al., 2009). Biofilm formation and stability can also depend on the second messenger cyclic-di-GMP (c-di-GMP), first described in Gluconacetobacter xylinum as a regulator of cellulose production (Ross et al., 1990). c-di-GMP is produced by the opposite and coordinated actions of two proteins: the diguanylate cyclase (that contains a GGDEF domain) and the c-di-GMP phosphodiesterase (Ross et al., 1987; Tal et al., 1998). Tu Quoc et al. identified genes important for early steps in biofilm formation by screening >10,000 transposon insertion mutants in S30, a clinical strain originally isolated from a catheter-related pediatric infection (Tu Quoc et al., 2007). This study suggested that gdpS (GGDEF Domain Protein from Staphylococcus – SA0701), a 1071 nucleotide long gene encoding for a 40 kDa protein, was involved in biofilm formation. The GdpS protein sequence contains a GGDEF domain (Ryan et al., 2006) (with the actual sequence being GGEEF) that is associated with motility and biofilm formation in other bacterial species (Gjermansen et al., 2006; Lim et al., 2006; Ryjenkov et al., 2005). The molecular mechanism underlying S. aureus biofilm formation is only partly described, and the specific roles of the GGDEF-containing protein are unclear. S. aureus GdpS is a ‘class I molecule’ (Lasa, 2006), characterized by the lack of an EAL domain known to be involved in hydrolysis of c-di-GMP. Moreover, a recent study in S. epidermidis showed that c-di-GMP may not regulate biofilm formation that involves the GGDEF domain protein (Holland et al., 2008). In addition, Corrigan and colleagues showed that c-di-GMP was not produced in S. aureus strain RN4220 (Corrigan et al., 2011). In contrast, the addition of extracellular c-di-GMP to the S. aureus gdpS mutant strain in culture enhanced biofilm formation, suggesting that GdpS could regulate biofilm formation (Ishihara et al., 2009). Whereas Tu Quoc et al. (2007), Holland et al. (2008) and Ishihara et al. (2009) showed

that gdpS deletion led to decreased biofilm formation, Shang and colleagues concluded that GdpS did not impact biofilm formation in S. aureus (Shang et al., 2009), but rather influenced the expression of virulence factors. Bioinformatic predictions suggest that GdpS contains a two-component sensor activity (InterPro: http://www.ebi.ac.uk/interpro/ISearch?query=Y701 STAAN). We have therefore attempted to clarify the role of GdpS and its partner(s) in S. aureus biofilm formation by using a variety of complementary experimental approaches. Our results indicate that GdpS can negatively regulate biofilm formation and the release of eDNA.

Materials and methods Bacterial strains and culture conditions All wild type strains were grown on Mueller-Hinton (MH) agar plates at 37 ◦ C. S. aureus liquid cultures were in MHB at 37 ◦ C with shaking, except for biofilm experiments. Bacterial strains used for transformation (Table 1) were E. coli DH5␣ for heat shock, S. aureus RN4220, SA113 and SA564 for electroporation and transduction, and S. aureus UAMS-1 for transductional genomic integration. E. coli DH5␣, MG1655 and AB1077 were grown on Luria-Bertani (LB) agar. Plasmids were selected in DH5␣ using 100 ␮g/mL ampicillin at 37 ◦ C; E. coli AB1077 is resistant to low levels of ampicillin (30 ␮g/mL). S. aureus deletion strains, and those containing plasmids, were plated on MH agar with 10 ␮g/mL chloramphenicol or 10 ␮g/mL erythromycin (Table 1). Incubation at 32 ◦ C was performed for pCN38ts plasmid selection and on MH agar containing the appropriate antibiotics (Table 1). Phi11 was induced for transduction experiments by growing bacteria containing phi11 on MH agar or broth without antibiotics (Dyer et al., 1985; Novick, 1991).

Mutants and complementation constructions To delete gdpS and cidABC, we performed allelic replacement using double crossover recombination as previously described (Mangold et al., 2004; Pohl et al., 2009; Shang et al., 2009). Using primers and restriction enzymes listed in Table 2, we generated two fragments of 964 bp 5 and 995 bp 3 of gdpS and 1 050 bp 5 and 1 053 bp 3 of cidABC. These fragments were ligated in 5 and 3 of the ermC (Charpentier et al., 2004) (erythromycin, gdpS) and aphA-3 (Charpentier et al., 2004) (kanamycin, cidABC) resistance cassettes in a high copy number plasmid pCN38ts (pCN38 containing pCN39 thermosensitive S. aureus replication (Charpentier et al., 2004)). Once plasmids were introduced in RN4220, we used phi11 transduction to transduce our plasmids in other S. aureus strains (Dyer et al., 1985; Novick, 1991; Pohl et al., 2009). We performed double crossover recombination in UAMS-1 only. Then, gdpS mutation was directly transduced in the other S. aureus strains using phi11 (Dyer et al., 1985; Novick, 1991; Pohl et al., 2009). Gene deletion was verified by PCR and sequencing. The GGGGF mutation was obtained using directed mutagenesis, using overlapping primers with modified nucleotide sequences (Table 2). Two PCR fragments were generated and used as template to obtain a single amplicon that was ligated in pCN38 and introduced in UAMS-1 gdpS strain using similar experimental procedure as described above. Complementation plasmid construction was performed as previously described (Pohl et al., 2009) using primers and restriction enzymes listed in Table 2 with a low copy number plasmid pCN38 (Charpentier et al., 2004). The presence of each insert was verified after each transformation by PCR and sequencing. Detailed information regarding restriction sites/enzymes, primers used and fragment size are presented in Table 2.




3

Table 1 Bacterial strains and plasmids used in this study. Strain/plasmid E. coli MG1655 AB1077

S. aureus UAMS-1 wt UAMS-1 gdpS UAMS-1 gdpS-pC UAMS-1 gdpS-GGGGF UAMS-1 wt-lrgAB+ UAMS-1 gdpS-lrgAB+ UAMS-1 cidABC-gdpS UAMS-1 cidABC-gdpS-pCC UAMS-1 wt-pCC SA113 wt SA113 gdpS SA113 gdpS-pC SA564 wt SA564 gdpS SA564 gdpS-pC Plasmids pCN38

pCN39 pCN38ts pL4

pC pL7

pL8 pL9

pCC

Relevant characteristics

Antibiotic resistance

Sources or reference

E. coli K-12 wt MG1655 Lambda att site:: (bla araC PBAD::dgcA). A diguanylate cyclase gene dgcA (cc3285) is inserted at the lambda attachment site under the control of the arabinose inducible promoter to produce high amount of c-di-GMP

– amp

Blattner et al. (1997) Christen et al. (2006)

Host for DNA cloning gdpS complete deletion (gdpS::ermC) gdpS deletion complementation with the plasmid pC gdpS mutant strain containing pL4 wt strain containing pL8 gdpS mutant strain containing pL8 gdpS and cidABC complete deletion (gdpS::ermC and cidABC::kan) Complementation of cidABC-gdpS double deletion with the plasmid pCC wt strain containing pCC Host for DNA cloning gdpS complete deletion (gdpS::ermC) gdpS deletion complemented with pC Host for DNA cloning gdpS complete deletion (gdpS::ermC) gdpS deletion complemented with pC

– ery chl, ery chl, ery chl, ery chl, ery ery, kan

Clinical strain (Gillaspy et al., 1995) This study This study This study This study This study This study

chl, ery, kan

This study

– ery chl, ery – ery chl, ery

This study Laboratory strain (Iordanescu and Surdeanu, 1976) This study This study Clinical strain (Somerville et al., 2002) This study This study

Low copy plasmid; E. coli replication origin; ampicillin resistance in E. coli; chloramphenicol resistance in S. aureus; S. aureus replication origin pT181repC; pUC19 MCS High copy plasmid; thermosensitive replication origin in S. aureus High copy plasmid; pCN38 with S. aureus thermosensitive replication origin from pCN39. pCN38 containing complete gdpS gene with point mutations in the GGEEF domain coding sequence, resulting in an altered GGEEF domain (GGGGF) pCN38 containing complete gdpS gene for complementation assay pCN38ts containing erythromycin resistance cassette (ermC) surrounded by gdpS flanking regions for gdpS deletion pCN38 containing the genes lrgAB for expression assay in gdpS mutant strains pCN38ts containing kanamycin resistance cassette surrounded by 1 kb flanking regions for cidABC deletion in gdpS strains pCN38 containing complete cidABC and gdpS genes under the control of their native promoter for double complementation assay

amp, chl

Gift of E. Charpentier (Charpentier et al., 2004)

amp, ery

Gift of E. Charpentier (Charpentier et al., 2004)

amp, chl

This study

chl

This study

amp, chl

This study

amp, chl, ery

This study

amp, chl

This study and ref (Mann et al., 2009)

amp, chl, kan (Charpentier et al., 2004) amp, chl

This study

This study

amp: ampicillin; ery: erythromycin; chl: chloramphenicol and kan: kanamycin.

Biofilm production assay

RNA extraction from 5-h-old biofilms

Biofilm formation was assayed dynamically using the Biofluxion (Fluxion Biosciences, San Francisco, CA) as recommended by the manufacturer. Biofilms were allowed to grow for 8 h with a shear rate of 0.65 dyn/cm2 . Pictures of cellular development on the surface were taken every 10 min with a CCD camera coupled to a research-grade inverted microscope (Supplementary data 1). Biofilm formation of SA113 was particularly efficient and therefore required a slightly modified protocol. The inlet reservoir was filled with TSB-glucose and 10 ␮L of bacterial culture (109 cells/mL) was added to the outlet reservoir. Bacteria were pulsed into the channels for 4 s at 5 dyn/cm2 and then followed by a slow flow (0.65 dyn/cm2 ) from the inlet reservoir (without bacteria). Biofilm formation was further assessed by crystal violet (CV) staining in 96 well plates, as previously described (O’Toole and Kolter, 1998; Tu Quoc et al., 2007).

To quantify gene expression in biofilms using microarrays and qRT-PCR, we extracted bacterial RNA using the RNeasy Micro Kit (Qiagen Inc., Valencia, CA) as previously described (Garzoni et al., 2007; Renzoni et al., 2004). RNA purity and yield were evaluated with the Bioanalyzer (Agilent) and Nanodrop. The absence of DNA was verified by performing qPCR without RT.

Transcriptional analyses Microarray design and manufacturing The microarray was manufactured by in situ synthesis of 10,807, 60-mer oligonucleotide probes (Agilent, Palo Alto, CA, USA), selected as previously described (Charbonnier et al., 2005). The probes represent >98% of all ORFs annotated in strains RN4220


G Model

IJMM-50763; No. of Pages 16

4

Primers

Insert

Plasmid

3 primer position from ATG (pb)

Final conc (␮M)

Size (pb)

0.4 0.4 0.4 0.4

31 21 22 28

287 798c 819c

ATTCGGTACCTTCATCGATATTAATTGTTTT AACTGAGAACCCTCCGCCACC TGGTGGCGGAGGGTTCTCAGTT GCAAGAATTCGGATTAACAGTTTTGTCG

KpnI – – EcoRI

GGGGF

AF BR

TTATAGCTTTATTATAAATGAATTCGCTCAATC ACCTGCAGTTAATACAACATCAATCACTTT

EcoRI PstI

gdpS complementation

pC

0.4 0.4

33 30

193

A 1444-2417 F 1R 2F B 3519-4529 R

GCCAGTGAATTCGAGTAAAGAAAGGAATCCG TGACCCCTAGGTATTGTAAGTGAAAACTTA AACTGTTAAC/CCGCGGCTATTATTAAATCATAGTAT GCATGCCTGCAGATATAAAGCTGATTGTAAAAT

EcoRI AvrII (HpaI)/SacII PstI

gdpS::ermC with 1 kb flanking regions

pL7

0.4 0.4 0.4 0.4

31 30 36 33

970 51

lrgA-pro-BamHI-F (Mann et al., 2009) lrgB-KpnI-R (Mann et al., 2009)

CGCGGATCCGAATCGTTATGAAAAACGATTGAATCC

BamHI

lrgAB+

pL8

0.4

36

281a

GCGGGTACCTTAGAAGAATATTGCTACAAAGACAGGC

KpnI

0.4

37

cid 5 H -1045 F cid 5 H + 5 R cid 3 H 2819 F cid 3 H 3871 R

GCAAGGTACCAGGCATGACTAATGCTTCCAAATCA TTTGCCTAGGTGCATGGCGCCATCCCTTTCTAAAT TCAACCGCGGATTCCACCTATTTCAGTTGCAGCA AAACGAATTCCAAATGGAATTAATGAGCGTTCAATA

KpnI AvrII SacII EcoRI

cidABC::kan with 1 kb flanking regions

pL9

0.5 0.5 0.5 0.5

35 35 34 35

1020a 20a

cidABC comp -269 F cidABC comp 2856 R gdpS DC-cid F gdpS DC-cid R

AGTCGGTACCAATTAAGTCATGCCACAACGAAATG TCAGGAATTCTTATAAGAAACGTTTTGCTGCAACTG ATTCGGATCCTTCATCGATATTAATTGTTTT GCAAGGTACCGGATTAACAGTTTTGTCG

KpnI EcoRI BamHI KpnI

pCC

0.5 0.5 0.4 0.4

35 36 31 28

244a

cidABC-gdpS double complementation

DM-1 DM-1 DM-2 DM-2

Amplicon size (pb)

273c 252c 3

1127

Sequence 5 →3

Name gdpS gdpS gdpS gdpS

3 primer position from TAA (pb)

1223 2356 2335 2634

F R F R

NNNN: restriction site; N: mutation. a ATG from lrgA or cidA. b TAA from lrgB or cidC. c Inside CDS sequence.

pL4

228

296 1522 964

45 993

995 1446

28b , c

1050 15b,c 988b 26b , c

287 3

1053 3126 1412

A. Fischer et al. / International Journal of Medical Microbiology xxx (2013) xxx–xxx

Restriction enzyme

ARTICLE IN PRESS


Table 2 Primers used for constructions.



(Gillaspy et al., 2007), Newman (Baba et al., 2002), UAMS-1 (Gillaspy et al., 1995) and SA564 (Somerville et al., 2002). Preparation of labeled nucleic acids for expression microarrays Microarray-based transcription profiling experiments were carried out using 5-h-old biofilms obtained from the three S. aureus parental strains and their corresponding mutants. Total RNA was purified and treated with DNase I (Sigma) as described above. Preparations of 5 ␮g total RNA were labeled by Cy3-dCTP (PerkinElmer) using the SuperScript II (Invitrogen, Basel, Switzerland), and purified as previously described (Scherl et al., 2006). Purified genomic DNA from the sequenced reference strains used for design of the microarray were pooled and labeled with Cy5 dCTP (Charbonnier et al., 2005) for microarray normalization (Talaat et al., 2002). Mixtures of Cy5-labeled genomic DNA and Cy3labeled cDNA were hybridized in a dedicated oven and scanned as previously described (Scherl et al., 2006). Microarray analysis Fluorescence intensities were quantified using Feature Extraction software (Agilent, version 8). Green and red feature data were extracted, processed, and imported into the Partek genomics suite software (Partek Incorporated, St. Louis, MO, USA). Data were normalized to baseline using red channel data as a control and mean to estimate the baseline. Variance analysis of two biological replicates was performed using a false discovery rate of 5% (P value cutoff, 0.05, no P value correction). Significant differences in expression ratios were defined by an arbitrary threshold of 1.5-fold. The maximum fold change observed was around 5. The complete microarray dataset is posted on the Gene Expression Omnibus database (http://www.ncbi.nlm.nih.gov/geo/), accession number GPL10537 for the platform design and GSE48656 for the original dataset. Real-time polymerase chain reaction (qRT-PCR) We quantified mRNA present in UAMS-1, SA113 and SA564 strains (wt) as well as in their respective mutants (gdpS) (Table 3). To standardize comparisons, we used primers and probes for hu, as previously described (Garzoni et al., 2007; Scherl et al., 2006). All experiments were performed with a one-step enzymatic kit in a Stratagene Mx3005P qPCR system (Agilent Technologies). For this experiment we used VersoTM 1-Step qPCR kit with ROX following previously described protocol (Beaume et al., 2011) except that we used 20 ng RNA for the genes of interest and hu. Each probe was assessed for linearity by testing serial RNA dilutions. SYBR Green quantification (Table 3) using a SYBR Green qRT-PCR kit (Stratagene Mx3005P) was used to quantify hla, following a previously described protocol (Beaume et al., 2010) modified to cycle 50 times. c-di-GMP measurement Metabolites were extracted after 3 and 5 h of growth as previously described by Meyer et al. (2010). We diluted an overnight culture to obtain 107 bacteria per mL in a final volume of 0.9 L. For a positive control for c-di-GMP production, we used an E. coli AB1077 (Table 1) culture at OD600 of 0.6, 1 h after arabinose activation. IP-LC/MS The detection of c-di-GMP was performed by an IP-LC/MS method coupled to a BRUKER Daltonics microTOF ESI-TOF mass spectrometer, as described by Liebeke and colleagues (Liebeke et al., 2010) (Agilent HPLC System 1100; Agilent Technologies, USA).

5

Assessment of the biochemical nature of biofilms To identify the composition of biofilm matrices, a 1/50 dilution of an overnight culture in TSB glucose (and erythromycin for deleted strains) was added to 200 ␮L fresh TSB glucose in a 96 well plate. For each strain we added 20 ␮L/mL DispersinB® (Kane Biotech Inc.), or 3 U and 0.1 U of DNase I (Roche Diagnotics GmbH, Mannheim, Germany). DispersinB® is an inhibitor of glucidic biofilm formation while DNase I inhibits eDNA dependent biofilm formation. Controls were grown without DispersinB® or DNase I. Plates were incubated 20 h at 37 ◦ C without agitation. Then supernatant was discarded and biofilms were washed twice with PBS. After biofilms dried, CV staining was performed as described above. Protein-dependent biofilms are susceptible to proteinase K (Qiagen). After 20 h of biofilm formation, we discarded the supernatant and washed the biofilms twice with PBS. A proteinase K solution (0.2 mg/mL in 100 mM TrisNaCl, pH 7.5) was added to each sample biofilm. Wells with control biofilms were filled with proteinase K buffer only (100 mM TrisNaCl, pH 7.5). The biofilms were incubated 2 h at 37 ◦ C then washed twice with TE 1×, dried and stained with CV as described above. Treated biofilms are compared to control biofilms by taking into account the differences in biofilm biomass between wt and mutant strains. Biofilm eDNA was quantified using qPCR as described by Rice et al. (2007). Briefly, mature biofilms were chilled at 4 ◦ C for 1 h and 5 ␮L of 0.5 M EDTA was added. Unwashed biofilms (supernatant discarded) were harvested using a solution of 50 mM Tris-HCl/10 mM EDTA/500 mM NaCl, pH 8.0. Cells were then pelleted and eDNA extracted from the supernatant using first phenol/chloroform/isoamyl alcohol (25:24:1) solution and then chloroform/isoamyl alcohol (24:1) solution at 4 ◦ C. The eDNA was then ethanol precipitated and resuspended in TE. Bacterial biomass was estimated to normalize eDNA amounts recovered from each biofilm. eDNA was then quantified following the procedure described by Rice et al. (2007). Briefly, real-time PCR (Brilliant II SYBR Green qPCR kit; Agilent) was performed on eDNA using four different primer pairs specific for gyAr, fhuA, lysA and leuA (Rice et al., 2007). These genes are chromosomally- encoded and were randomly selected (Rice et al., 2007). To estimate eDNA concentrations, UAMS-1 gDNA was added at known concentrations to the reaction. PCR was performed in a Stratagene Mx3005P qPCR system (Agilent Technologies) using similar cycling parameters as previously described (Rice et al., 2007).

Results GdpS regulates S. aureus biofilm formation To determine whether GdpS contributes to S. aureus biofilm formation, we deleted the entire coding sequence of gdpS in three different S. aureus genetic backgrounds: two strains isolated from patients with osteomyelitis (UAMS-1) or toxic shock syndrome (SA564), and SA113 (Iordanescu and Surdeanu, 1976), a laboratory strain derived from NCTC8325. Although three strains do not permit making general statements, they do provide important clues on the gdpS regulatory pathways. We first confirmed that deletion of gdpS did not affect the growth rates of these strains. Each mutant strain (and its complemented derivative) had a growth curve similar to its respective parent (Supplementary data 2). GdpS transcript expression was not detected in mutant strains (data not shown). Biofilm formation under dynamic flow conditions was assessed using the Biofluxion system (Fig. 1A and Supplementary data 1). Dynamic microscopy allowed us to observe the biofilm




Fig. 1. Biofilm formation increased in gdpS mutant strains. gdpS deletion led to increased biofilm formation 8 h after inoculation (Panel A). Pictures of bacterial adhesion and biofilm formation of wt and gdpS mutant strains UAMS-1 (Aa), SA113 (Ab) and SA564 (Ac) were observed after 3h30 and 8 h using the Biofluxion system. Images were taken using a 10× magnification. (Panel B) Static biofilm quantification in 96 well plates. Mature biofilms (20 h old) were quantified using crystal violet staining. Relative quantities of biofilms were obtained by using the wt strain of each background for normalization (relative quantity of 1). Biofilm production increased in all strains when gdpS was deleted (black). Strains complemented with gdpS (gray) and the GGGGF mutant (light gray) were similar to the wt in their levels of biofilm formation. Data represent mean ± standard error of four independent assays. Significant differences with wt strains are indicated by an asterisk (*P < 0.01).




7

Table 3 Primers and probes used in qRT-PCR. Sequence (5 →3 )

Length (bp)

Final conc (␮M)

Dye/quencher

icaA

F R Probe

GCCATGTGTTGGATGTTGGTT CCCCTTGAGCCCATCTCA CGTTGCTTCCAAAGACCTCCCAATGTTT

21 18 28

0.2 0.2 0.1

FAM/BHQ1

agrA

34F 135R 83T

AAAAGCCTATGGAAATTGCCCTCGCA CAAAGAGAAAACATGGTTACCATTATTAA CTCAAGCACCTCATAAGGATTATCAG

26 29 26

0.2 0.2 0.1

FAM/TAMRA

hla

337 F 437 R –

ATGAGTACTTTAACTTATGGATTCAACGG AGTGTATGACCAATCGAAACATTTG SYBR Green

29 25 –

0.5 0.5 –

–

F R P

CGAAGTCGAAAAAGTAGGAACGA GCTTGGCTAATGACACCTAAAGAGT CATTGGCTTACTCTTCGTACCAGCCGG

23 25 27

0.2 0.2 0.1

FAM/TAMRA

capD

1059F 1134R 1085T

GGAAACGTATAAACCATACGCAGTT TTCAGGGTTGTCTTCCATTAACG ATCATGCAGCAGCACACAAGCACG

25 23 24

0.2 0.2 0.2

FAM/TAMRA

hrtA

36–57 F 141–163 R 111–136 P

CGGAGAAGGTTTGTCTGAAACA ATCCGCCTAATATCGTTAGCAAT AAATGGTGCCTCTGGTTCTGGGAAAA

22 23 26

0.2 0.2 0.1

FAM/TAMRA

363–389 F 421–446 R 392–419 P

TCACGTTATCGGTACACATACACAATC TTCATTTGTTCAGCTCTAATTTTTCG AAGATTCACGTTGTGGTGCTGGACATGA

27 26 28

0.2 0.2 0.1

FAM/TAMRA

hld/RNAIII

367 F 436 R 388 T

TTCACTGTGTCGATAATCCA TGATTTCAATGGCACAAGAT TTTACTAAGTCACCGATTGTTGAAATGA

20 20 28

0.2 0.2 0.1

FAM/TAMRA

HU

1687F 1747R 1708T –

GGTTTCGGTAACTTTGAGG CAGTTTGAGGGTTACGACC CGTGAACGTGCTGCACGTAA SYBR Green (hla)

19 19 20

0.2 0.2 0.1

Primer name

lrgA

hlb

phenotype with minimal experimental intervention. After 3h30 of growth, UAMS-1 gdpS (Fig. 1Aa) and SA564 gdpS (Fig. 1Ac) produced bacterial clusters, which were absent in their respective parental strains. SA113 wt shows as many clusters as SA113 gdpS (Fig. 1Ab). When observed at 8 h, formation of large clusters was recorded in mutant strains but not in their parents except for SA113. SA113 wt and gdpS strains produced similarly high levels of biofilm, whereas deletion of gdpS in strains UAMS-1 and SA564 caused an increase in biofilm formation. Cell density was also observed on 20 h old biofilms using live/dead staining and confirmed Biofluxion observations that gdpS deletion resulted in increased biofilm formation in UAMS-1 and SA564 but not in SA113. Macroscopic examination of biofilms from UAMS-1 and SA564 indicated a thin layer of biofilm in the wt strains, and a thick structured biofilm in the gdpS strains (Fig. 1A and Supplementary data 3). To evaluate the impact of gdpS deletion on biofilm formation after 20 h, biofilms were quantified by CV staining (Fig. 1B). CV staining provides quantitative information on the amounts of biofilm and is used as a reference for comparison across experiments. UAMS-1 gdpS and SA564 gdpS produced approximately 2-fold more biofilm than their respective parental strains. Surprisingly, deletion of gdpS caused a low but statistically significant increase (1.2 fold, t-test P < 0.01) in SA113 gdpS biofilm. However, the biological relevance of this low increase is unclear. Complementation of the gdpS deletion with native gdpS on a low copy plasmid restored biofilm levels to wt levels in all three strains. Point mutations introduced to replace the GdpS GGEEF domain with a GGGGF domain in strain UAMS-1 (UAMS-1 gdpS-GGGGF) did not significantly alter the amount of biofilm formed as compared to UAMS-1 wt (Fig. 1B, 1.3 fold difference, t-test P > 0.05). Compared to UAMS-1 gdpS, UAMS-1 gdpS-GGGGF produced significantly less biofilm (t-test P < 0.01), suggesting that the GGEEF domain is not required to regulate biofilm formation.

FAM/TAMRA –

gdpS is transcribed early during biofilm formation The expression of gdpS was monitored in the three parental strains to determine the phase(s) of biofilm formation when gdpS is expressed (Fig. 2). We measured the relative expression of gdpS after 1h30, 3 h and 5 h of biofilm growth, using time point 1h30 as the reference for each background (relative expression of 1). For each strain, expression of gdpS decreased 3 to 8 fold between 1h30 and 3 h, and 2 to 3 fold between 3 h and 5 h. The expression of gdpS between 1h30 and 3 h decreased less in strain UAMS-1 (3 fold) than in the two other strains (8 fold and 7 fold for SA113 and SA564, respectively). This difference may be due to the 3 fold lower expression of gdpS at 1h30 in UAMS-1 as compared to SA113 and SA564 (data not shown). However, the relative quantity of gdpS mRNA is similar between all strains at 3 h and 5 h (data not shown). Therefore, early expression of gdpS in all three strains suggests it is similarly regulated in these different genetic backgrounds. c-di-GMP production in UAMS-1 wt strain In many well-studied bacteria, proteins containing a GGDEF domain are involved in the production of the second messenger c-di-GMP. However, c-di-GMP is not produced in S. aureus strain RN4220 (Corrigan et al., 2011). We aimed to confirm this result in UAMS-1. To identify c-di-GMP in the metabolites pool resulting from overnight growth, we extracted metabolites from UAMS-1 after 3 and 5 h of growth and used IP-LC/MS (ion Pairing-Liquid Chromatography Mass Spectrometry) (see Materials and Methods) (Fig. 3). The positive control of c-di-GMP production in biological samples was an E. coli strain that produces c-di-GMP upon activation by arabinose (Fig. 3 line 2). In E. coli, c-di-GMP was measured after 34 min of run time (Fig. 3 line 2). The limit of c-di-GMP detection was determined to be around 0.0625 nmol (Dobrindt et al., 2003; Simm et al., 2004). The peaks measured after 23 and 32 min




is the icaADBC operon. To assess its involvement in the GdpS regulatory pathway, we measured icaA expression in our samples using qRT-PCR. Consistent with the biofilm phenotypes, gdpS presence is correlated with decreased icaA expression 2.4-fold in UAMS-1, 1.8-fold in SA113 and 2.6-fold in SA564 (Table 4). GdpS could therefore regulate biofilm formation through modulation of the icaADBC operon expression. However, as this operon is involved in PIA production in S. aureus (Cramton et al., 1999) and as UAMS-1 is not able to produce a glucidic matrix (Cue et al., 2009), GdpS probably also regulates biofilm formation through a different pathway. Indeed, ica operon is also regulated in strains that do not produce biofilms with a glucid-containing matrix in vitro (Dobinsky et al., 2003); but these strains could produce PIA-containing matrix during in vivo infections. The relationship between gdpS, ica and the glucidic matrix formation is complex and remains to be elucidated using in vivo studies. Transcriptomic analyses Fig. 2. gdpS early expression. The expression of gdpS was estimated by qRT-PCR in 1h30 (black), 3 h (light gray) and 5 h (gray) old biofilms in UAMS-1, SA113 and SA564 wt strains. The time point 1h30 was used as a reference to estimate the relative quantity of gdpS mRNA. The expression of gdpS was the highest at 1h30 and then decreased. Data represent mean ± standard deviation of three independent assays.

of run time (Fig. 3 line 2) might be isomers of c-di-GMP or dimers of c-GMP. Without arabinose activation, E. coli is not able to produce c-di-GMP (Fig. 3 Line 5). After 3 h of growth no peak corresponding to c-di-GMP was observed in UAMS-1 wt (Fig. 3 line 3). After 5 h, although the c-di-GMP remained absent, the two peaks at 23 and 33 min were present (Fig. 3 line 4). Two independent attempts failed to detect c-di-GMP in UAMS-1, suggesting this strain might be unable to synthesize c-di-GMP. Thus, in agreement with previous results (Corrigan et al., 2011; Holland et al., 2008), we hypothesized that GdpS may regulate S. aureus biofilm formation by a mechanism independent of c-di-GMP and/or that the amount of c-di-GMP is significantly lower in UAMS-1 than in E. coli. icaADBC factor in S. aureus biofilm formation According to previous results (Corrigan et al., 2011; Holland et al., 2008) and results described above, GdpS might regulate biofilm formation using pathways that do not rely on c-di-GMP. One of the most studied factors in staphylococcal biofilm formation

To find other factors that might be under the control of GdpS, we compared gene expression in our three parental and mutant strain pairs using genome-wide microarrays and targeted qRT-PCR. The number of differentially expressed genes (gene expression difference represented as fold change between the wt and the mutant strains) in each experiment was: 87 genes for UAMS-1 wt vs UAMS-1 gdpS, 152 genes for SA113 wt vs SA113 gdpS and 152 genes for SA564 wt vs SA564 gdpS. Overall, 59%, 43% and 62% of the genes differentially expressed were up-regulated by GdpS in UAMS-1, SA113 and SA564, respectively. Microarray results are shown in Supplementary Tables 1–3. Supplementary Table 4 lists genes that were differentially expressed in at least two microarray analyses. Differentially expressed genes were clustered by functional group categories according to the COG (Clusters of Orthologous Groups) classification (Fig. 4) (NCBI, 2006). We created an additional category of documented S. aureus virulence factors (VF) (Chen et al., 2005). We classified all the genes without COG classification in the category S, which corresponds to genes of unknown function (S). Overall, COG profiles revealed similarities between the three strains. We observed dissimilarities with SA113 for COGs belonging to the ‘Metabolism’ category. Functional categories G (carbohydrate, transport and metabolism), E (amino acid transport and metabolism) and P (inorganic ion transport and metabolism) showed more genes up-regulated by GdpS

Fig. 3. c-di-GMP production in UAMS-1 at 3 h and 5 h of growth. Line 1 represents the standard c-di-GMP compound (extracted ion chromatogram (EIC): m/z = 689.085 ± 0.002). As a positive control we used E. coli producing c-di-GMP upon arabinose activation (line 2). Inactivated E. coli was used as a negative control (line 5). Line 3 represents the EIC (m/z = 689.085 ± 0.002) of an intracellular S. aureus sample after 3 h of growth. Line 4 represents the EIC (m/z = 689.085 ± 0.002) of an intracellular S. aureus sample after 5 h of growth. No c-di-GMP was found in UAMS-1 at 3 h and 5 h but at 5 h (line 4), two compounds released after 23 min (A) and 32 min (B) were also present in E. coli samples (line2). They could represent dimers of c-GMP or isomers of c-di-GMP. The production of c-di-GMP was measured twice for each condition, showing similar results.


ARTICLE IN PRESS


A. Fischer et al. / International Journal of Medical Microbiology xxx (2013) xxx–xxx

9

Table 4 qRT-PCR results. RQ (wt vs gdpS)

hlb

hld

icaA

hrtA

capD

agrA

hla

lrgA

UAMS-1 SA113 SA564

−1.5 −2.5 −2.2

4.9 −1.1 1.9

−2.4 −1.8 −2.7

−5.7 −14 −7.7

3.0 −1.8 2.3

2.5 −1.0 −1.6

−4.3 −1.8 −3.2

1.6 2.2 1.3

Values represent the average of nine values from three experimental replicates from each of three independent biological replicates. Values in bold are significantly different (t-test ≤ 0.05). Standard error and t-test values are in Supplementary Table 5.

in SA113 as compared to UAMS-1 and SA564 (more genes downregulated). We observed two interesting categories: the category M (cell-wall/membrane/envelope biogenesis) had more genes upregulated than down-regulated in all three strains, and the category VF (virulence factors) had more down-regulated genes in all the strains (wt vs gdpS). GdpS is involved in the capsule biogenesis (cap operon) and in the expression of lipoproteins, thus several

genes regulated by GdpS could be involved in biofilm formation. To further test this, we measured the expression of a selection of such genes using qRT-PCR (Table 4). The hemolysins hla and hlb were down-regulated by GdpS, while hld was up-regulated (except in strain SA113). The hemin ABC transporter ATPase protein hrtA was also down-regulated by GdpS, whereas the autolysis inhibitor lrgA was up-regulated by GdpS. One gene from the capsular operon,

Fig. 4. COG representation of microarray results. Genes up- (right part) and down-regulated (left part) by gdpS, after 5 h of biofilm formation in strains UAMS-1 (blue), SA113 (green) and SA564 (red) were assigned functional groups using annotated public database and metabolic pathways databases (Clusters of Orthologous Groups: COG). The percent of genes regulated by gdpS for each COG was calculated by dividing the number of significantly changed genes by the total number of genes belonging to each COG in each strain. Categories are: C: energy production and conversion, G: carbohydrate transport and metabolism, E: amino acid transport and metabolism, F: nucleotide transport and metabolism, H: coenzyme transport and metabolism, I: lipid transport and metabolism, Q: secondary metabolites biosynthesis, P: inorganic ion transport and metabolism, J: translation, ribosomal structure and biogenesis, K: transcription, L: replication, M: cell wall/membrane/envelope biogenesis, D: cell cycle control, cell division, chromosome partitioning, O: posttranslational modification, protein turnover, T: signal transduction mechanisms, V: defense mechanisms, VF for virulence factor, R: general function prediction only and S: unknown function. VF is an additional category containing documented virulence factors (Chen et al., 2005; Garzoni et al., 2007). Underlined COGs are of particular interest (see Results). Results are the mean of three independent microarray experiments. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)




Fig. 5. Production of protein-dependent and glucidic matrices in biofilms. Mature biofilms of wt (black) and gdpS (gray) strains were digested with proteinase K (Panel A) or grown in the presence of DispersinB® (Panel B). Remaining quantity of biofilm formation (estimated using CV staining) is represented in percent of biofilm formation of the treated control (cf. Materials and Methods). Controls for proteinase K experiment were treated only with proteinase K buffer (A). Controls for DispersinB® experiment were grown in TSB glc without DispersinB® (B). No differences were observed between wt and gdpS mutant strains, except SA113 in presence of DipsersinB® (B). Error bars represent standard errors of three independent experiments. *P < 0.01.

capD was up-regulated by GdpS in UAMS-1 and SA564 and downregulated in SA113. Except for hld expression in SA113, regulatory trends obtained from microarrays were confirmed by the qRT-PCR experiments (Table 4). Biochemical nature of the biofilms SA113 is able to produce biofilms with a glucid- and a proteincontaining matrix (Seidl et al., 2008). UAMS-1 has been described as a protein-dependent biofilm producer (Beenken et al., 2004). We tested whether gdpS deletion had an impact on the biochemical nature of the extracellular matrix. Fig. 5A shows the effect of proteinase K treatment on mature biofilms. All strains produced significantly less biofilm in the presence of proteinase K

Fig. 6. GdpS regulates eDNA quantity in biofilm matrices. Biofilms were grown 20 h in presence (black) or absence (light gray) of 3 units (U) of DNase I (Panel A). The percentage of biofilm formation in the presence of DNase I is compared to the nontreated control (100%) for each strain. eDNA in the biofilm matrix was quantified by qPCR, using four pairs of primers (gyrA, fhuA, lysA and leuA) and normalized using the biomass of each biofilm (Panel B). Panel B represents relative quantities of eDNA in UAMS-1 gdpS (black), SA113 gdpS (light gray), SA564 gdpS (gray) and UAMS-1 gdpS-pC (white) as compared to their respective wt strain (eDNA relative quantity of 1). Biofilm formation in gdpS mutant strains is more susceptible to DNase I than their corresponding wt strain (A) and higher amounts of eDNA were recovered from their matrix (B). Error bars represented standard errors of three independent experiments (Panel A and B). *, eDNA amounts are significantly different from wt strain (P < 0.01); ␭, eDNA amount is not different from UAMS-1 wt strain (P > 0.01) and is different from strain UAMS-1 gdpS (P < 0.01).

(P < 0.01) meaning that all strains produced biofilms with a proteincontaining matrix. No difference was recorded between mutants and their parents (Fig. 5A). Addition of DispersinB® resulted in decreased biofilm production in strains SA113 wt and gdpS but did not affect the other strains (Fig. 5B). No difference in glucidic matrix composition was recorded between UAMS-1 and SA564 pairs of wt and mutant strains (Fig. 5B). SA113 is therefore the only strain that produces a glucidic matrix (Seidl et al., 2008) and gdpS deletion caused a slightly increased biofilm formation (15%) in presence of DispersinB® (Fig. 5B). Like biofilm formation experiment presented in Fig. 1B, this increased biofilm formation is statistically significant but it might not be biologically relevant.eDNA in the biofilm matrix was assessed by treating biofilms with 3 units of DNase I (Fig. 6A). We found that, in agreement with previous reports, DNase I decreased biofilm formation in all strains (Rice




Fig. 7. The role of lrgAB and cidABC in GdpS biofilm regulation in strain UAMS-1. lrgAB expression and cidABC deletion effects on biofilm formation in UAMS-1 wt and gdpS mutant strains were assessed using CV staining. UAMS-1 wt was used for normalization (relative quantity of 1). Expression of lrgAB from a plasmid in the gdpS mutant decreased biofilm formation, similar to the cidABC deletion. Strain UAMS-1 wt-lrgAB+ and the complementation strains (pCC) showed similar amounts of biofilm as UAMS-1 wt. Error bars represent standard error of three independent assays. *, biofilm formation is significantly different from strain gdpS (P < 0.05); ␭, biofilm formation is significantly different from wt strain (P < 0.05).

et al., 2007; Seidl et al., 2008; Sharma-Kuinkel et al., 2009), but the remaining biofilm after DNase I treatment was always significantly lower in the mutant strains (Fig. 6A). Three units of DNase I decreased the amount of biofilm by 3-fold in UAMS-1 gdpS and SA113 gdpS strains and by 2-fold in SA564 gdpS strain, while UAMS-1 and SA113 wt strains’ biofilm formation decreased by 2fold, and SA564 wt by 1.5-fold. Moreover, only biofilms formed by mutant strains were significantly degraded by 0.1 unit of DNase I, with all three strains showing a 20–50% decrease in biofilm formation (Supplementary data 4). To confirm that DNase I decreased biofilm formation by degrading eDNA, we quantified eDNA in the matrix by qRT-PCR using SYBR Green and using biomass quantification to normalize eDNA quantity for each strain (Fig. 6B). eDNA is composed of bacterial genomic DNA and all chromosomally-encoded genes should therefore be present in eDNA. Thus using qPCR on randomly selected genes should provide an accurate estimation of the eDNA quantity in the biofilm (Rice et al., 2007). We observed that biofilms of all gdpS mutant strains contained more eDNA than their respective wt strain (3–5 times more). We also observed a similar amount of eDNA in UAMS-1 gdpS-GGGGF as compared to UAMS-1 wt (Fig. 6B). These observations suggest that the GGEEF domain in GdpS is not required for eDNA regulation of biofilm surfaces by GdpS. Molecular determination of GdpS regulation of eDNA production To test whether GdpS regulates eDNA through one of the autolysis systems, we expressed lrgAB in a low copy plasmid in UAMS-1 gdpS. LrgAB is an inhibitor of autolysis and eDNA release as well as a biofilm formation inhibitor (Mann et al., 2009). In addition, our microarray results suggested that gdpS positively regulates lrgAB, meaning that lrgAB deletion might not affect biofilm formation in a gdpS mutant strain. Fig. 7 shows that lrgAB expression in the gdpS mutant strain resulted in slightly decreased biofilm formation. As a control, we used the wt strain UAMS-1 containing the same plasmid

11

with lrgAB. There was no significant difference between UAMS-1 gdpS-lrgAB+ and wt-lrgAB+ (Fig. 7), nor between strains UAMS1 wt-lrgAB+ and wt. We observed a difference between UAMS-1 gdpS-lrgAB+ and UAMS-1 wt (P = 0.05) that could be due either to the use of UAMS-1 wt for normalization or to the high variability observed between replicates. Therefore, restoring lrgAB expression in a plasmid complements the biofilm phenotype of a gdpS deletion, suggesting that gdpS might enhance lrgAB expression. We then assessed biofilm formation in a cidABC-gdpS double mutant (Fig. 7). CidABC is involved in enhanced biofilm formation, autolysis and eDNA release (Rice et al., 2007). LrgAB inhibits CidABC-mediated biofilm formation and GdpS acts on lrgAB expression. Accordingly, we decided to delete cidABC in the gdpS mutant strain UAMS-1 gdpS. No difference in biofilm formation was observed between strain UAMS-1 cidABC gdpS, the complemented strain UAMS-1 cidABC gdpS-pCC and the wt strain containing the complementation plasmid UAMS-1 pCC. Deletion of cidABC in a gdpS mutant resulted in a decreased amount of biofilm getting closer to wt strain level. The mutant strain UAMS-1 cid produced less biofilm compared to the wt strain (data not shown) as previously described in UAMS-1 (Rice et al., 2007). UAMS-1 cidABC gdpS-pCC and wt-pCC strains showed no significant difference as compared to the wt strain, while UAMS-1 cidABC gdpS and wt were different, probably for the same reasons as discussed above in UAMS-1 gdpS-lrgAB+. Therefore, deletion of cidABC complements the biofilm phenotype of the gdpS deletion, suggesting that gdpS might either decrease cidABC expression or inhibit cidABC mediated eDNA release by controlling lrgAB expression (Mann et al., 2009; Sadykov and Bayles, 2012). No differences in cidABC expression could be observed by qRT-PCR between UAMS-1 wt and gdpS mutant strain (data not shown); the second hypothesis is thus more probable. We also quantified eDNA amounts in the biofilm matrix of strains UAMS-1 wt-lrgAB+, gdpS-lrgAB+, cidABC gdpS, cidABC gdpS-pCC and wt-pCC (Fig. 8). The amount of eDNA recovered in biofilms did not differ between strains UAMS-1 wtlrgAB+ and wt-pCC compared to the wt strain. Expressing lrgAB in a gdpS mutant strain significantly decreased the amount of eDNA as compared to gdpS. Regarding the double mutant strain UAMS1 cidABC gdpS, we observed a decrease in eDNA compared to the gdpS strain. We also observed decreased eDNA amounts with UAMS-1 cid when compared to the wt strain (data not shown) as previously described (Rice et al., 2007). The amount of eDNA produced by UAMS-1 cidABC gdpS is similar to UAMS-1 wt and cidABC gdpS-pCC strains. Therefore, these results indicate that gdpS (either directly or indirectly) positively regulates lrgAB expression which in turns negatively regulates cidABC functions to decrease biofilm formation through a reduction in the concentration of eDNA.

Discussion Tu Quoc previously identified several genes involved in biofilm formation by randomly inserting the Mini Mu transposon into the genome of strain S30, which produces high amounts of biofilm (Tu Quoc et al., 2007). One gene identified in this screen was gdpS, which encodes a protein containing a GGEEF domain. The ability of S30 to form glucidic biofilms is probably due to a single mutation in the icaR gene (Stenz et al., unpublished) leading to the constitutive activation of the ica operon and abundant PIA-dependent biofilm formation. We assessed icaA regulation by qRT-PCR and observed that GdpS down-regulates icaA in the genetic backgrounds of our three strains. This observation is opposite to that observed in strain RN4220 (Holland et al., 2008). Therefore, the role of GdpS in S. aureus biofilm formation remained to be elucidated.




Fig. 8. GdpS acts on lrgAB and cidABC to regulate eDNA on biofilm matrix. Strains tested in this figure derive from UAMS-1 background. eDNA concentrations on biofilm surfaces were quantified by qPCR, using four pairs of primers (gyrA (black), fhuA (light gray), lysA (gray) and leuA (dark gray)) and normalized using biofilm biomass for each strain. UAMS-1 wt was used as reference (relative quantity = 1) to compare eDNA amounts between each target. Expression of lrgAB and deletion of cidABC in a gdpS mutant strain decreased the amount of eDNA recovered from the matrix of the biofilm. Strain UAMS-1 wt-lrgAB+ and the complementation strains (pCC) showed similar amounts of eDNA than UAMS-1 wt. Error bars represented standard errors of three independent experiments. *, eDNA amounts are significantly different from UAMS-1 wt (P < 0.01); all the samples are significantly different from UAMS-1 gdpS (P < 0.01).

GdpS is a negative regulator of early biofilm formation In this study, we identified gdpS as a negative regulator of biofilm formation in UAMS-1, SA564 and to a lesser extent SA113; these observations contradict previous studies (Holland et al., 2008; Ishihara et al., 2009; Shang et al., 2009; Tu Quoc et al., 2007). Microscopy experiments revealed that biofilm formation is modified as early as after 3h30 of growth, consistent with our finding that gdpS is transcribed during the early stage of biofilm formation. In addition, gdpS regulates genes from the cap operon which are involved in early biofilm formation (Beenken et al., 2004). Taken together these results suggested that GdpS affects the ability of cells to interact with and adhere to surfaces. However, microscopic observations showing the ability of wt strains to adhere to surfaces (3h30 and 8h00) are not compatible with this hypothesis. The second and perhaps more plausible hypothesis is that GdpS regulates cell-to-cell interactions. Microarrays and qRT-PCR revealed the alpha hemolysin (hla) is down-regulated by GdpS. This hemolysin contributes in cell-to-cell interactions during the early steps of biofilm formation (Caiazza and O’Toole, 2003). GdpS also regulates expression of comG, comF and comA which are also involved in cell-to-cell interactions (Albano et al., 1989; Petersen et al., 2005). During the early steps of biofilm formation, building of the matrix and interactions between cells are required for mushroom like structure building. GdpS regulates biofilm formation independently of c-di-GMP Our results revealed that gdpS inhibits biofilm formation. In a previous study, Ishihara and colleagues showed that S. aureus was able to use exogenous c-di-GMP to enhance biofilm formation

(Ishihara et al., 2009), suggesting that the molecule could contribute to regulation of biofilm production in S. aureus even though cells cannot produce it. Indeed, as previously suggested for RN4220 (Corrigan et al., 2011), we did not observe c-di-GMP production in UAMS-1 wt samples (Liebeke et al., 2010) suggesting that GdpS might not be involved in the production of c-di-GMP in UAMS-1. Holland and colleagues could not observe any diguanylate cyclase activity in vitro of the GGDEF domain of S. epidermidis CSF41498 (Holland et al., 2008). In line with this observation, replacement of the GGDEF domain with a modified GGGGF domain in UAMS-1 strain did not affect biofilm formation. Simm et al. (2009) established the relationship between the number of GGDEF-protein coding genes and the quantity of c-di-GMP produced. In S. aureus, two genes encode GGDEF proteins, GdpS and GdpP. GdpP was shown to use c-di-AMP as a substrate (Corrigan et al., 2011). However, the amount of c-di-GMP, if produced, could be below our detection limit of 0.0625 nmol per dried sample. Taken together these results strongly suggest, as previously reported by Holland et al. for S. epidermidis (Holland et al., 2008) and by Corrigan et al. for S. aureus RN4220 (Corrigan et al., 2011), that GpdS regulates S. aureus biofilm formation independently of c-di-GMP. The regulation of biofilm formation by GdpS is associated with modified expression of genes encoding cell-wall and membrane components, and a decreased expression of virulence genes, as identified by our microarray experiments. Teichoic acids are an important component of the bacterial cell-wall: wall teichoic acids (WTA) are anchored in the cell-wall and linked to the peptidoglycan whereas lipoteichoic acids are only bound to peptidoglycan. Production of WTA is under the control of the tag and tar operons. Microarray analysis revealed tagD positive regulation by GdpS, linking GdpS and WTA. As WTA are likely to inhibit autolysis




(Pasztor et al., 2010), while modulating septal lysis (Atl) during cell division (Schlag et al., 2010), GdpS could potentially influence regulation of autolysis. Indeed, GdpS regulates the expression of the autolysis-inhibitor genes lytM and lrgAB. GdpS also influences expression of the choline transporter cudT that is regulated by mgrA (Anderson et al., 2006) and involved in the stringent response (Luong et al., 2006). The osmoprotectant transport system opuCC is also regulated by GdpS. The expression of genes whose products are involved in transport, osmoprotectant synthesis, or regulating cell-wall biosynthesis may lead to cell lysis or to cell wall weakness (Luong et al., 2006). Taken together, these results suggest that GdpS is linked to cell lysis. Genes involved in virulence processes are almost all down-regulated by GdpS. However, confirmation that deletion of gdpS decreases virulence would require an animal model of infection. Among the genes involved in virulence, we identified the alpha, beta, delta and gamma hemolysins (hla, hlb, hld and hlgAB). They are pore-forming enzymes under the control of the agr system, suggesting a link between gdpS and the quorum sensing regulator agr. In addition, almost all these genes are related to biofilm formation (Ingavale et al., 2005; Jonsson et al., 2008; Luong et al., 2003, 2006; Shang et al., 2009; Trotonda et al., 2008). GdpS regulates eDNA production In this study we reported icaA regulation by gdpS. The ica operon regulates PIA production leading to a biofilm with a glucidic matrix. However, UAMS-1 contains a mutation in the rbf gene (Cue et al., 2009) that precludes this strain’s ability to produce a glucidic matrix. The deletion of gdpS in the glucidic-matrix producing strain SA113 (Seidl et al., 2008) showed the lowest increase in biofilm formation. We hypothesized that GdpS might regulate the composition of the biofilm matrix. However our experiments did not identify any difference in protein or glucidic matrices between wt and gdpS strains, suggesting that GdpS is not involved in this process. Another matrix component, eDNA, is becoming increasingly interesting because of its requirement for biofilm stability (Hsu et al., 2011; Huseby et al., 2010; Kiedrowski and Horswill, 2011; Lou et al., 2011; Mann et al., 2009; Ravaioli et al., 2011; Rice et al., 2007; Seidl et al., 2008; Sharma-Kuinkel et al., 2009). Our results strongly suggest that GdpS could be involved in eDNA regulation. First, gdpS is transcribed at the beginning of biofilm growth during the cell-to-cell interaction step, similar to eDNA in Enterococcus faecalis (Barnes et al., 2012). Second, GdpS is involved in the regulation of the quorum sensing system that dictates eDNA release (Spoering and Gilmore, 2006). Third, gdpS may regulate cell lysis through its effects on expression of cell-wall and membrane genes (Luong et al., 2006), and thus indirectly influence eDNA release. Finally, the autolysis regulator gene lrgA is up-regulated by GdpS, consistent with the hlb down-regulation that is required for eDNA assembly on the biofilm matrix (Huseby et al., 2010). Only biofilms formed by the mutant strains were degraded by 0.1 units of DNase I. However, 3 units of DNase I were sufficient to degrade biofilms in all strains, albeit the parental strains were less affected than the mutants. This result suggests several hypotheses: (i) gdpS mutant strains secrete less eDNA than their respective parents; (ii) eDNA is more easily degraded in UAMS-1 gdpS and SA564 gdpS strains following negative regulation of genes and proteins involved in cellwall biosynthesis; or (iii) the mutant strains released more eDNA than the wt strains, thus becoming more important for the stability of early biofilm. The higher levels of eDNA recovered from gdpS biofilm matrix rejects the first hypothesis but supports the third hypothesis. The second hypothesis is also rejected because eDNA binds to proteins in the matrix, and fewer proteins would mean less eDNA in the matrix; this is contradictory to results from the eDNA quantification experiments.

13

Fig. 9. GdpS regulatory pathway. LytSR and CidR regulate the expression of lrgAB and cidABC respectively to control autolysis and eDNA release during biofilm formation. GdpS positively regulates lrgA transcription which in turn inhibits eDNA release mediated by CidABC, leading to decreased eDNA production and low biofilm formation phenotype. The effect of cidABC mutation in a gdpS mutant strain is likely linked to gdpS action on lrgAB expression following established model of regulation between lrgAB and cidABC (Mann et al., 2009; Sadykov and Bayles, 2012). GdpS also down-regulates the expression of hlb, decreasing eDNA assembly on biofilm matrices (Huseby et al., 2010) leading to low biofilm formation phenotype.

Our observations support the involvement of GdpS in cell lysis to regulate eDNA production. However, a previous study in NCTC8325 strain (Shang et al., 2009) revealed that gdpS deletion did not affect the autolysis rate. We performed autolysis experiments using Triton X-100 on wt and gdpS mutant strains and obtained similar results as Shang and colleagues (data not shown), meaning that gdpS does not change whole cell autolysis rate. However, while low concentrations of oxacillin (0.05 and 1.0 MIC) did not affect the holin-mediated autolysis rate (data not shown and Supplementary data 5), gdpS mutant strains showed increased autolysis (Supplementary data 5) in the presence of higher concentrations of oxacillin (2.0 and 20 MIC), suggesting that GdpS is involved in the regulation of the cid/lrg system (Groicher et al., 2000; Trotonda et al., 2009). The involvement of GdpS in holin-mediated autolysis remains to be precisely elucidated as the duration of incubation and the oxacillin concentrations required to observe an effect on the autolysis rate are higher than previously published (Antignac et al., 2007; Ledala et al., 2006; Trotonda et al., 2009). We hypothesize that eDNA can be produced by GdpS independently from the autolysis at the beginning of the bacterial growth (and thus, during early biofilm formation), but we cannot formally exclude the lysis of a subpopulation of cells, as previously described for eDNA production induced with Triton X-100. In addition, eDNA quantification from biofilms of UAMS-1 containing a GdpS with a modified GGGGF domain revealed no difference with the wt strain, confirming that this domain is not required for GdpS regulation of eDNA production. To confirm that GdpS is involved in eDNA regulation, we more closely assessed the autolysis system by constructing the double mutant gdpS-cid and complementing gdpS with lrgAB on a low copy plasmid. The effects of gdpS deletion were mostly restored in the presence of lrgAB, in terms of biofilm formation and amounts of eDNA, suggesting that gdpS positively regulates lrgAB expression (Fig. 9). CidABC is a positive regulator of biofilm formation and eDNA release as its deletion leads to decreased biofilm formation and decreased eDNA amounts (Rice et al., 2003, 2007). Deletion of cid in a gdpS mutant strain resulted in biofilm production and eDNA concentrations similar to lrgAB-complemented strain, however it more closely restored the wt phenotype. These results show that GdpS inhibits cidABC mediated eDNA production, directly or




indirectly through lrgAB, an inhibitor of cidABC mediated autolysis (Mann et al., 2009) (Fig. 9). In contrast to the current literature (Holland et al., 2008; Ishihara et al., 2009; Shang et al., 2009; Tu Quoc et al., 2007), our experiments using in-frame deletions of gdpS showed significant increase in biofilm production in UAMS-1 and SA564 strains. These discrepancies might be a consequence of a strain-dependent GdpS phenotype. However, Shang and colleagues showed that inframe gdpS deletion in S. aureus NCTC8325 strain does not change biofilm phenotype (Shang et al., 2009). SA113, which derives from NCTC8325, did not show biologically relevant modification in biofilm formation. In their study, Holland et al. mainly worked with S. epidermidis but showed that gdpS from S. aureus (strain RN4220) restores phenotypes produced by a gdpS deletion in S. epidermidis (Holland et al., 2008). RN4220 is also closely related to NCTC8325, and thus to SA113. However, in their mutant strains they observed a decrease in biofilm formation, based on using NaCl supplemented medium to favor biofilm formation. It is possible that GdpS functions differently in S. aureus and S. epidermidis but allows complementation between species. Finally, Ishihara and colleagues worked with MS2507, a clinical strain producing high amounts of biofilms and deleted gdpS using a transposon (Ishihara et al., 2009). Their procedure that was very similar to that of Tu Quoc showed a similar decrease in biofilm formation in the gdpS mutant strains. The differences observed using different deletion strategies in a variety of strains show that GdpS regulation could be more complex. Despite the differences between studies, we demonstrated a new regulatory pathway for GdpS. Its regulation of membrane and cell-wall components, and the lrgAB-cidABC autolysis system, confirms that GdpS is an inhibitor of biofilm stability. This inhibition likely occurs through decreasing eDNA concentrations in the biofilm matrix. We hypothesize that eDNA release regulated by gdpS can occur independently from autolysis during early biofilm formation. Acknowledgments This work was supported by funding from the Swiss National Science Foundation (Grants 31003A-118309 to P.L., and 3100A0112370/1 to J.S.) and by the Deutsche Forschungsgemeinschaft (SFB/TRR34 to H.M. and M.L.). We would like to thank Prof. Kenneth Bayles for his advices with autolysis mutant constructions and Dr. Vladimir Lazarevic for his advices. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ijmm. 2013.10.010. References Al-Talib, H.I., Yean, C.Y., Al-Jashamy, K., Hasan, H., 2010. Methicillin-resistant Staphylococcus aureus nosocomial infection trends in Hospital Universiti Sains Malaysia during 2002–2007. Ann. Saudi Med. 30, 358–363. Albano, M., Breitling, R., Dubnau, D.A., 1989. Nucleotide sequence and genetic organization of the Bacillus subtilis comG operon. J. Bacteriol. 171, 5386–5404. Allesen-Holm, M., Barken, K.B., Yang, L., Klausen, M., Webb, J.S., Kjelleberg, S., Molin, S., Givskov, M., Tolker-Nielsen, T., 2006. A characterization of DNA release in Pseudomonas aeruginosa cultures and biofilms. Mol. Microbiol. 59, 1114–1128. Anderson, K.L., Roberts, C., Disz, T., Vonstein, V., Hwang, K., Overbeek, R., Olson, P.D., Projan, S.J., Dunman, P.M., 2006. Characterization of the Staphylococcus aureus heat shock, cold shock, stringent, and SOS responses and their effects on logphase mRNA turnover. J. Bacteriol. 188, 6739–6756. Antignac, A., Sieradzki, K., Tomasz, A., 2007. Perturbation of cell wall synthesis suppresses autolysis in Staphylococcus aureus: evidence for coregulation of cell wall synthetic and hydrolytic enzymes. J. Bacteriol. 189, 7573–7580.

Baba, T., Takeuchi, F., Kuroda, M., Yuzawa, H., Aoki, K., Oguchi, A., Nagai, Y., Iwama, N., Asano, K., Naimi, T., Kuroda, H., Cui, L., Yamamoto, K., Hiramatsu, K., 2002. Genome and virulence determinants of high virulence community-acquired MRSA. Lancet 359, 1819–1827. Barnes, A.M., Ballering, K.S., Leibman, R.S., Wells, C.L., Dunny, G.M., 2012. Enterococcus faecalis produces abundant extracellular structures containing DNA in the absence of cell lysis during early biofilm formation. MBio 3. Bayles, K.W., 2007. The biological role of death and lysis in biofilm development. Nat. Rev. Microbiol. 5, 721–726. Beaume, M., Hernandez, D., Docquier, M., Delucinge-Vivier, C., Descombes, P., Francois, P., 2011. Orientation and expression of methicillin-resistant Staphylococcus aureus small RNAs by direct multiplexed measurements using the nCounter of NanoString technology. J. Microbiol. Methods 84, 327–334. Beaume, M., Hernandez, D., Farinelli, L., Deluen, C., Linder, P., Gaspin, C., Romby, P., Schrenzel, J., Francois, P., 2010. Cartography of methicillin-resistant S. aureus transcripts: detection, orientation and temporal expression during growth phase and stress conditions. PLoS ONE 5, e10725. Beenken, K.E., Dunman, P.M., McAleese, F., Macapagal, D., Murphy, E., Projan, S.J., Blevins, J.S., Smeltzer, M.S., 2004. Global gene expression in Staphylococcus aureus biofilms. J. Bacteriol. 186, 4665–4684. Blattner, F.R., Plunkett III, G., Bloch, C.A., Perna, N.T., Burland, V., Riley, M., Collado-Vides, J., Glasner, J.D., Rode, C.K., Mayhew, G.F., Gregor, J., Davis, N.W., Kirkpatrick, H.A., Goeden, M.A., Rose, D.J., Mau, B., Shao, Y., 1997. The complete genome sequence of Escherichia coli K-12. Science 277, 1453–1474. Brunskill, E.W., Bayles, K.W., 1996. Identification and molecular characterization of a putative regulatory locus that affects autolysis in Staphylococcus aureus. J. Bacteriol. 178, 611–618. Caiazza, N.C., O’Toole, G.A., 2003. Alpha-toxin is required for biofilm formation by Staphylococcus aureus. J. Bacteriol. 185, 3214–3217. Chaignon, P., Sadovskaya, I., Ragunah, C., Ramasubbu, N., Kaplan, J.B., Jabbouri, S., 2007. Susceptibility of staphylococcal biofilms to enzymatic treatments depends on their chemical composition. Appl. Microbiol. Biotechnol. 75, 125–132. Charbonnier, Y., Gettler, B.M., Francois, P., Bento, M., Renzoni, A., Vaudaux, P., Schlegel, W., Schrenzel, J., 2005. A generic approach for the design of wholegenome oligoarrays, validated for genomotyping, deletion mapping and gene expression analysis on Staphylococcus aureus. BMC Genomics 6, 95. Charpentier, E., Anton, A.I., Barry, P., Alfonso, B., Fang, Y., Novick, R.P., 2004. Novel cassette-based shuttle vector system for Gram-positive bacteria. Appl. Environ. Microbiol. 70, 6076–6085. Chen, L., Yang, J., Yu, J., Yao, Z., Sun, L., Shen, Y., Jin, Q., 2005. VFDB: a reference database for bacterial virulence factors. Nucleic Acids Res. 33, D325–D328. Christen, B., Christen, M., Paul, R., Schmid, F., Folcher, M., Jenoe, P., Meuwly, M., Jenal, U., 2006. Allosteric control of cyclic di-GMP signaling. J. Biol. Chem. 281, 32015–32024. Corrigan, R.M., Abbott, J.C., Burhenne, H., Kaever, V., Grundling, A., 2011. c-di-AMP is a new second messenger in Staphylococcus aureus with a role in controlling cell size and envelope stress. PLoS Pathog. 7, e1002217. Corrigan, R.M., Rigby, D., Handley, P., Foster, T.J., 2007. The role of Staphylococcus aureus surface protein SasG in adherence and biofilm formation. Microbiology 153, 2435–2446. Cramton, S.E., Gerke, C., Schnell, N.F., Nichols, W.W., Gotz, F., 1999. The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation. Infect. Immun. 67, 5427–5433. Cucarella, C., Solano, C., Valle, J., Amorena, B., Lasa, I.I., Penades, J.R., 2001. Bap, a Staphylococcus aureus surface protein involved in biofilm formation. J. Bacteriol. 183, 2888–2896. Cue, D., Lei, M.G., Luong, T.T., Kuechenmeister, L., Dunman, P.M., O’Donnell, S., Rowe, S., O’Gara, J.P., Lee, C.Y., 2009. Rbf promotes biofilm formation by Staphylococcus aureus via repression of icaR, a negative regulator of icaADBC. J. Bacteriol. 191, 6363–6373. Dobinsky, S., Kiel, K., Rohde, H., Bartscht, K., Knobloch, J.K., Horstkotte, M.A., Mack, D., 2003. Glucose-related dissociation between icaADBC transcription and biofilm expression by Staphylococcus epidermidis: evidence for an additional factor required for polysaccharide intercellular adhesin synthesis. J. Bacteriol. 185, 2879–2886. Dobrindt, U., Agerer, F., Michaelis, K., Janka, A., Buchrieser, C., Samuelson, M., Svanborg, C., Gottschalk, G., Karch, H., Hacker, J., 2003. Analysis of genome plasticity in pathogenic and commensal Escherichia coli isolates by use of DNA arrays. J. Bacteriol. 185, 1831–1840. Dyer, D.W., Rock, M.I., Lee, C.Y., Iandolo, J.J., 1985. Generation of transducing particles in Staphylococcus aureus. J. Bacteriol. 161, 91–95. Garzoni, C., Francois, P., Huyghe, A., Couzinet, S., Tapparel, C., Charbonnier, Y., Renzoni, A., Lucchini, S., Lew, D.P., Vaudaux, P., Kelley, W.L., Schrenzel, J., 2007. A global view of Staphylococcus aureus whole genome expression upon internalization in human epithelial cells. BMC Genomics 8, 171. Gillaspy, A.F., Hickmon, S.G., Skinner, R.A., Thomas, J.R., Nelson, C.L., Smeltzer, M.S., 1995. Role of the accessory gene regulator (agr) in pathogenesis of staphylococcal osteomyelitis. Infect. Immun. 63, 3373–3380. Gillaspy, A.F., Worell, V., Orvis, J., Roe, B.A., Dyer, D.W., Iandolo, J.J., 2007. Staphylococcus aureus subsp. aureus NCTC 8325, complete genome. Internet Communication. Gjermansen, M., Ragas, P., Tolker-Nielsen, T., 2006. Proteins with GGDEF and EAL domains regulate Pseudomonas putida biofilm formation and dispersal. FEMS Microbiol. Lett. 265, 215–224. Gotz, F., 2002. Staphylococcus and biofilms. Mol. Microbiol. 43, 1367–1378.




Groicher, K.H., Firek, B.A., Fujimoto, D.F., Bayles, K.W., 2000. The Staphylococcus aureus lrgAB operon modulates murein hydrolase activity and penicillin tolerance. J. Bacteriol. 182, 1794–1801. Heijstra, B.D., Pichler, F.B., Liang, Q., Blaza, R.G., Turner, S.J., 2009. Extracellular DNA and Type IV pili mediate surface attachment by Acidovorax temperans. Antonie Van Leeuwenhoek 95, 343–349. Holland, L.M., O’Donnell, S.T., Ryjenkov, D.A., Gomelsky, L., Slater, S.R., Fey, P.D., Gomelsky, M., O’Gara, J.P., 2008. A staphylococcal GGDEF domain protein regulates biofilm formation independently of cyclic dimeric GMP. J. Bacteriol. 190, 5178–5189. Houston, P., Rowe, S.E., Pozzi, C., Waters, E.M., O’Gara, J.P., 2011. Essential role for the major autolysin in the fibronectin-binding protein-mediated Staphylococcus aureus biofilm phenotype. Infect. Immun. 79, 1153–1165. Hsu, C.Y., Lin, M.H., Chen, C.C., Chien, S.C., Cheng, Y.H., Su, I.N., Shu, J.C., 2011. Vancomycin promotes the bacterial autolysis, release of extracellular DNA, and biofilm formation in vancomycin non-susceptible Staphylococcus aureus. FEMS Immunol. Med. Microbiol. 63, 236–247. Huseby, M.J., Kruse, A.C., Digre, J., Kohler, P.L., Vocke, J.A., Mann, E.E., Bayles, K.W., Bohach, G.A., Schlievert, P.M., Ohlendorf, D.H., Earhart, C.A., 2010. Beta toxin catalyzes formation of nucleoprotein matrix in staphylococcal biofilms. Proc. Natl. Acad. Sci. U. S. A. 107, 14407–14412. Hussain, M., Haggar, A., Heilmann, C., Peters, G., Flock, J.I., Herrmann, M., 2002. Insertional inactivation of Eap in Staphylococcus aureus strain Newman confers reduced staphylococcal binding to fibroblasts. Infect. Immun. 70, 2933–2940. Hussain, M., Haggar, A., Peters, G., Chhatwal, G.S., Herrmann, M., Flock, J.I., Sinha, B., 2008. More than one tandem repeat domain of the extracellular adherence protein of Staphylococcus aureus is required for aggregation, adherence, and host cell invasion but not for leukocyte activation. Infect. Immun. 76, 5615–5623. Ingavale, S., van, W.W., Luong, T.T., Lee, C.Y., Cheung, A.L., 2005. Rat/MgrA, a regulator of autolysis, is a regulator of virulence genes in Staphylococcus aureus. Infect. Immun. 73, 1423–1431. Iordanescu, S., Surdeanu, M., 1976. Two restriction and modification systems in Staphylococcus aureus NCTC8325. J. Gen. Microbiol. 96, 277–281. Ishihara, Y., Hyodo, M., Hayakawa, Y., Kamegaya, T., Yamada, K., Okamoto, A., Hasegawa, T., Ohta, M., 2009. Effect of cyclic bis(3 –5 )diguanylic acid and its analogs on bacterial biofilm formation. FEMS Microbiol. Lett. 301, 193–200. Izano, E.A., Amarante, M.A., Kher, W.B., Kaplan, J.B., 2008. Differential roles of poly-N-acetylglucosamine surface polysaccharide and extracellular DNA in Staphylococcus aureus and Staphylococcus epidermidis biofilms. Appl. Environ. Microbiol. 74, 470–476. Janzon, L., Lofdahl, S., Arvidson, S., 1989. Identification and nucleotide sequence of the delta-lysin gene, hld, adjacent to the accessory gene regulator (agr) of Staphylococcus aureus. Mol. Gen. Genet. 219, 480–485. Jonsson, I.M., Lindholm, C., Luong, T.T., Lee, C.Y., Tarkowski, A., 2008. MgrA regulates staphylococcal virulence important for induction and progression of septic arthritis and sepsis. Microbes Infect. 10, 1229–1235. Kaplan, J.B., Ragunath, C., Velliyagounder, K., Fine, D.H., Ramasubbu, N., 2004. Enzymatic detachment of Staphylococcus epidermidis biofilms. Antimicrob. Agents Chemother. 48, 2633–2636. Kiedrowski, M.R., Horswill, A.R., 2011. New approaches for treating staphylococcal biofilm infections. Ann. N. Y. Acad. Sci. 1241, 104–121. Kirkpatrick, C.L., Viollier, P.H., 2010. Cell dispersal in biofilms: an extracellular DNA masks nature’s strongest glue. Mol. Microbiol. 77, 801–804. Kogan, G., Sadovskaya, I., Chaignon, P., Chokr, A., Jabbouri, S., 2006. Biofilms of clinical strains of Staphylococcus that do not contain polysaccharide intercellular adhesin. FEMS Microbiol. Lett. 255, 11–16. Kreth, J., Vu, H., Zhang, Y., Herzberg, M.C., 2009. Characterization of hydrogen peroxide-induced DNA release by Streptococcus sanguinis and Streptococcus gordonii. J. Bacteriol. 191, 6281–6291. Lasa, I., 2006. Towards the identification of the common features of bacterial biofilm development. Int. Microbiol. 9, 21–28. Lauderdale, K.J., Boles, B.R., Cheung, A.L., Horswill, A.R., 2009. Interconnections between Sigma B, agr, and proteolytic activity in Staphylococcus aureus biofilm maturation. Infect. Immun. 77, 1623–1635. Lazarevic, V., Beaume, M., Corvaglia, A., Hernandez, D., Schrenzel, J., Francois, P., 2011. Epidemiology and virulence insights from MRSA and MSSA genome analysis. Future Microbiol. 6, 513–532. Ledala, N., Wilkinson, B.J., Jayaswal, R.K., 2006. Effects of oxacillin and tetracycline on autolysis, autolysin processing and atl transcription in Staphylococcus aureus. Int. J. Antimicrob. Agents 27, 518–524. Liebeke, M., Meyer, H., Donat, S., Ohlsen, K., Lalk, M., 2010. A metabolomic view of Staphylococcus aureus and Its Ser/Thr kinase and phosphatase deletion mutants: involvement in cell wall biosynthesis. Chem. Biol. 17, 820–830. Lim, B., Beyhan, S., Meir, J., Yildiz, F.H., 2006. Cyclic-diGMP signal transduction systems in Vibrio cholerae: modulation of rugosity and biofilm formation. Mol. Microbiol. 60, 331–348. Lou, Q., Zhu, T., Hu, J., Ben, H., Yang, J., Yu, F., Liu, J., Wu, Y., Fischer, A., Francois, P., Schrenzel, J., Qu, D., 2011. Role of the SaeRS two-component regulatory system in Staphylococcus epidermidis autolysis and biofilm formation. BMC Microbiol. 11, 146. Luong, T.T., Dunman, P.M., Murphy, E., Projan, S.J., Lee, C.Y., 2006. Transcription profiling of the mgrA regulon in Staphylococcus aureus. J. Bacteriol. 188, 1899–1910. Luong, T.T., Newell, S.W., Lee, C.Y., 2003. Mgr, a novel global regulator in Staphylococcus aureus. J. Bacteriol. 185, 3703–3710. Mangold, M., Siller, M., Roppenser, B., Vlaminckx, B.J., Penfound, T.A., Klein, R., Novak, R., Novick, R.P., Charpentier, E., 2004. Synthesis of group A streptococcal

15

virulence factors is controlled by a regulatory RNA molecule. Mol. Microbiol. 53, 1515–1527. Mann, E.E., Rice, K.C., Boles, B.R., Endres, J.L., Ranjit, D., Chandramohan, L., Tsang, L.H., Smeltzer, M.S., Horswill, A.R., Bayles, K.W., 2009. Modulation of eDNA release and degradation affects Staphylococcus aureus biofilm maturation. PLoS ONE 4, e5822. Meyer, H., Liebeke, M., Lalk, M., 2010. A protocol for the investigation of the intracellular Staphylococcus aureus metabolome. Anal. Biochem. 401, 250–259. Mootz, J.M., Malone, C.L., Shaw, L.N., Horswill, A.R., 2013. Staphopains modulate Staphylococcus aureus biofilm integrity. Infect. Immun. 81, 3227–3238. Mrak, L.N., Zielinska, A.K., Beenken, K.E., Mrak, I.N., Atwood, D.N., Griffin, L.M., Lee, C.Y., Smeltzer, M.S., 2012. saeRS and sarA Act synergistically to repress protease production and promote biofilm formation in Staphylococcus aureus. PLoS ONE 7, e38453. NCBI, 2006. Phylogenetic Classification of Proteins Encoded in Complete Genomes. Niven, D.J., Fick, G.H., Kirkpatrick, A.W., Grant, V., Laupland, K.B., 2010. Cost and outcomes of nosocomial bloodstream infections complicating major traumatic injury. J. Hosp. Infect. 76, 296–299. Novick, R.P., 1991. Genetic systems in staphylococci. Methods Enzymol. 204, 587–636. O’Toole, G.A., Kolter, R., 1998. Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30, 295–304. Olson, M.E., Nygaard, T.K., Ackermann, L., Watkins, R.L., Zurek, O.W., Pallister, K.B., Griffith, S., Kiedrowski, M.R., Flack, C.E., Kavanaugh, J.S., Kreiswirth, B.N., Horswill, A.R., Voyich, J.M., 2013. Staphylococcus aureus nuclease is an SaeRSdependent virulence factor. Infect. Immun. 81, 1316–1324. Pasztor, L., Ziebandt, A.K., Nega, M., Schlag, M., Haase, S., Franz-Wachtel, M., Madlung, J., Nordheim, A., Heinrichs, D.E., Gotz, F., 2010. Staphylococcal major autolysin (Atl) is involved in excretion of cytoplasmic proteins. J. Biol. Chem. 285, 36794–36803. Peters, G., Pulverer, G., 1984. Pathogenesis and management of Staphylococcus epidermidis ‘plastic’ foreign body infections. J. Antimicrob. Chemother. 14 (Suppl. D), 67–71. Petersen, F.C., Tao, L., Scheie, A.A., 2005. DNA binding-uptake system: a link between cell-to-cell communication and biofilm formation. J. Bacteriol. 187, 4392–4400. Pohl, K., Francois, P., Stenz, L., Schlink, F., Geiger, T., Herbert, S., Goerke, C., Schrenzel, J., Wolz, C., 2009. CodY in Staphylococcus aureus: a regulatory link between metabolism and virulence gene expression. J. Bacteriol. 191, 2953–2963. Raad, I., 1998. Intravascular-catheter-related infections. Lancet 351, 893–898. Ravaioli, S., Campoccia, D., Visai, L., Pirini, V., Cangini, I., Corazzari, T., Maso, A., Poggio, C., Pegreffi, F., Montanaro, L., Arciola, C.R., 2011. Biofilm extracellular-DNA in 55 Staphylococcus epidermidis clinical isolates from implant infections. Int. J. Artif. Organs 34, 840–846. Renzoni, A., Francois, P., Li, D., Kelley, W.L., Lew, D., Vaudaux, P., Schrenzel, J., 2004. Modulation of fibronectin adhesins and other virulence factors in a teicoplaninresistant derivative of methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 48, 2958–2965. Rice, K.C., Bayles, K.W., 2008. Molecular control of bacterial death and lysis. Microbiol. Mol. Biol. Rev. 72, 85–109 (table). Rice, K.C., Firek, B.A., Nelson, J.B., Yang, S.J., Patton, T.G., Bayles, K.W., 2003. The Staphylococcus aureus cidAB operon: evaluation of its role in regulation of murein hydrolase activity and penicillin tolerance. J. Bacteriol. 185, 2635–2643. Rice, K.C., Mann, E.E., Endres, J.L., Weiss, E.C., Cassat, J.E., Smeltzer, M.S., Bayles, K.W., 2007. The cidA murein hydrolase regulator contributes to DNA release and biofilm development in Staphylococcus aureus. Proc. Natl. Acad. Sci. U. S. A. 104, 8113–8118. Ross, P., Mayer, R., Weinhouse, H., Amikam, D., Huggirat, Y., Benziman, M., de, V.E., Fidder, A., de, P.P., Sliedregt, L.A., 1990. The cyclic diguanylic acid regulatory system of cellulose synthesis in Acetobacter xylinum, Chemical synthesis and biological activity of cyclic nucleotide dimer, trimer, and phosphothioate derivatives. J. Biol. Chem. 265, 18933–18943. Ross, P., Weinhouse, H., Aloni, Y., Michaeli, D., Weinberger-Ohana, P., Mayer, R., Braun, S., de, V.E., van der Marel, G.A., van Boom, J.H., Benziman, M., 1987. Regulation of cellulose synthesis in Acetobacter xylinum by cyclic diguanylic acid. Nature 325, 279–281. Ryan, R.P., Fouhy, Y., Lucey, J.F., Dow, J.M., 2006. Cyclic di-GMP signaling in bacteria: recent advances and new puzzles. J. Bacteriol. 188, 8327–8334. Ryjenkov, D.A., Tarutina, M., Moskvin, O.V., Gomelsky, M., 2005. Cyclic diguanylate is a ubiquitous signaling molecule in bacteria: insights into biochemistry of the GGDEF protein domain. J. Bacteriol. 187, 1792–1798. Sadykov, M.R., Bayles, K.W., 2012. The control of death and lysis in staphylococcal biofilms: a coordination of physiological signals. Curr. Opin. Microbiol. 15, 211–215. Scherl, A., Francois, P., Charbonnier, Y., Deshusses, J.M., Koessler, T., Huyghe, A., Bento, M., Stahl-Zeng, J., Fischer, A., Masselot, A., Vaezzadeh, A., Galle, F., Renzoni, A., Vaudaux, P., Lew, D., Zimmermann-Ivol, C.G., Binz, P.A., Sanchez, J.C., Hochstrasser, D.F., Schrenzel, J., 2006. Exploring glycopeptide-resistance in Staphylococcus aureus: a combined proteomics and transcriptomics approach for the identification of resistance-related markers. BMC Genomics 7, 296. Schlag, M., Biswas, R., Krismer, B., Kohler, T., Zoll, S., Yu, W., Schwarz, H., Peschel, A., Gotz, F., 2010. Role of staphylococcal wall teichoic acid in targeting the major autolysin Atl. Mol. Microbiol. 75, 864–873. Seidl, K., Goerke, C., Wolz, C., Mack, D., Berger-Bachi, B., Bischoff, M., 2008. Staphylococcus aureus CcpA affects biofilm formation. Infect. Immun. 76, 2044–2050. Shang, F., Xue, T., Sun, H., Xing, L., Zhang, S., Yang, Z., Zhang, L., Sun, B., 2009. The Staphylococcus aureus GGDEF domain-containing protein, GdpS, influences




protein A gene expression in a cyclic diguanylic acid-independent manner. Infect. Immun. 77, 2849–2856. Sharma-Kuinkel, B.K., Mann, E.E., Ahn, J.S., Kuechenmeister, L.J., Dunman, P.M., Bayles, K.W., 2009. The Staphylococcus aureus LytSR two-component regulatory system affects biofilm formation. J. Bacteriol. 191, 4767–4775. Simm, R., Morr, M., Kader, A., Nimtz, M., Romling, U., 2004. GGDEF and EAL domains inversely regulate cyclic di-GMP levels and transition from sessility to motility. Mol. Microbiol. 53, 1123–1134. Simm, R., Morr, M., Remminghorst, U., Andersson, M., Romling, U., 2009. Quantitative determination of cyclic diguanosine monophosphate concentrations in nucleotide extracts of bacteria by matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry. Anal. Biochem. 386, 53–58. Somerville, G.A., Beres, S.B., Fitzgerald, J.R., DeLeo, F.R., Cole, R.L., Hoff, J.S., Musser, J.M., 2002. In vitro serial passage of Staphylococcus aureus: changes in physiology, virulence factor production, and agr nucleotide sequence. J. Bacteriol. 184, 1430–1437. Spoering, A.L., Gilmore, M.S., 2006. Quorum sensing and DNA release in bacterial biofilms. Curr. Opin. Microbiol. 9, 133–137. Tal, R., Wong, H.C., Calhoon, R., Gelfand, D., Fear, A.L., Volman, G., Mayer, R., Ross, P., Amikam, D., Weinhouse, H., Cohen, A., Sapir, S., Ohana, P., Benziman, M., 1998. Three cdg operons control cellular turnover of cyclic di-GMP in Acetobacter xylinum: genetic organization and occurrence of conserved domains in isoenzymes. J. Bacteriol. 180, 4416–4425. Talaat, A.M., Howard, S.T., Hale, W., Lyons, R., Garner, H., Johnston, S.A., 2002. Genomic DNA standards for gene expression profiling in Mycobacterium tuberculosis. Nucleic Acids Res. 30, e104. Thomas, V.C., Hiromasa, Y., Harms, N., Thurlow, L., Tomich, J., Hancock, L.E., 2009. A fratricidal mechanism is responsible for eDNA release and contributes to biofilm development of Enterococcus faecalis. Mol. Microbiol. 72, 1022–1036. Thomas, V.C., Thurlow, L.R., Boyle, D., Hancock, L.E., 2008. Regulation of autolysisdependent extracellular DNA release by Enterococcus faecalis extracellular proteases influences biofilm development. J. Bacteriol. 190, 5690–5698.

Thompson, K.M., Abraham, N., Jefferson, K.K., 2010. Staphylococcus aureus extracellular adherence protein contributes to biofilm formation in the presence of serum. FEMS Microbiol. Lett. 305, 143–147. Toledo-Arana, A., Merino, N., Vergara-Irigaray, M., Debarbouille, M., Penades, J.R., Lasa, I., 2005. Staphylococcus aureus develops an alternative, ica-independent biofilm in the absence of the arlRS two-component system. J. Bacteriol. 187, 5318–5329. Trotonda, M.P., Tamber, S., Memmi, G., Cheung, A.L., 2008. MgrA represses biofilm formation in Staphylococcus aureus. Infect. Immun. 76, 5645–5654. Trotonda, M.P., Xiong, Y.Q., Memmi, G., Bayer, A.S., Cheung, A.L., 2009. Role of mgrA and sarA in methicillin-resistant Staphylococcus aureus autolysis and resistance to cell wall-active antibiotics. J. Infect. Dis. 199, 209–218. Tu Quoc, P.H., Genevaux, P., Pajunen, M., Savilahti, H., Georgopoulos, C., Schrenzel, J., Kelley, W.L., 2007. Isolation and characterization of biofilm formation-defective mutants of Staphylococcus aureus. Infect. Immun. 75, 1079–1088. Vilain, S., Pretorius, J.M., Theron, J., Brozel, V.S., 2009. DNA as an adhesin: Bacillus cereus requires extracellular DNA to form biofilms. Appl. Environ. Microbiol. 75, 2861–2868. Vuong, C., Gerke, C., Somerville, G.A., Fischer, E.R., Otto, M., 2003. Quorum-sensing control of biofilm factors in Staphylococcus epidermidis. J. Infect. Dis. 188, 706–718. Whitchurch, C.B., Tolker-Nielsen, T., Ragas, P.C., Mattick, J.S., 2002. Extracellular DNA required for bacterial biofilm formation. Science 295, 1487. Yang, S.J., Rice, K.C., Brown, R.J., Patton, T.G., Liou, L.E., Park, Y.H., Bayles, K.W., 2005. A LysR-type regulator, CidR, is required for induction of the Staphylococcus aureus cidABC operon. J. Bacteriol. 187, 5893–5900. Zafar, A., Stone, M., Ibrahim, S., Parveen, Z., Hasan, Z., Khan, E., Hasan, R., Wain, J., Bamford, K., 2011. Prevalent genotypes of meticillin-resistant Staphylococcus aureus: report from Pakistan. J. Med. Microbiol. 60, 56–62. Zielinska, A.K., Beenken, K.E., Mrak, L.N., Spencer, H.J., Post, G.R., Skinner, R.A., Tackett, A.J., Horswill, A.R., Smeltzer, M.S., 2012. sarA-mediated repression of protease production plays a key role in the pathogenesis of Staphylococcus aureus USA300 isolates. Mol. Microbiol. 86, 1183–1196.


Aspartate inhibits Staphylococcus aureus biofilm formation.

Nanoscale Plasma Coating Inhibits Formation of Staphylococcus aureus Biofilm.

Rot is a key regulator of Staphylococcus aureus biofilm formation.

Characterization of Staphylococcus aureus Biofilm Formation in Urinary Tract Infection.

SaeRS-dependent inhibition of biofilm formation in Staphylococcus aureus Newman.

Aminoglycoside inhibition of Staphylococcus aureus biofilm formation is nutrient dependent.

Burn Serum Increases Staphylococcus aureus Biofilm Formation via Oxidative Stress.

The Quorum Sensing Inhibitor Hamamelitannin Increases Antibiotic Susceptibility of Staphylococcus aureus Biofilms by Affecting Peptidoglycan Biosynthesis and eDNA Release.

Effect of licorice extract on cell viability, biofilm formation and exotoxin production by Staphylococcus aureus.

Cadmium modulates biofilm formation by Staphylococcus epidermidis.

An Electrostatic Net Model for the Role of Extracellular DNA in Biofilm Formation by Staphylococcus aureus.

Staphylococcus aureus glucose-induced biofilm accessory proteins, GbaAB, influence biofilm formation in a PIA-dependent manner.

Effect of NaCl on Biofilm Formation of the Isolate from Staphylococcus aureus Outbreak Linked to Ham.

Ciprofloxacin-eluting nanofibers inhibits biofilm formation by Pseudomonas aeruginosa and a methicillin-resistant Staphylococcus aureus.

Ethanol and Isopropyl Alcohol Exposure Increases Biofilm Formation in Staphylococcus aureus and Staphylococcus epidermidis.

Inactivation of the Autolysis-Related Genes lrgB and yycI in Staphylococcus aureus Increases Cell Lysis-Dependent eDNA Release and Enhances Biofilm Development In Vitro and In Vivo.

Biofilm-formation by Staphylococcus aureus and Staphylococcus epidermidis isolates from subclinical mastitis in conditions mimicking the udder environment.

Hyaluronan Modulation Impacts Staphylococcus aureus Biofilm Infection.

Biofilm formation by Staphylococcus aureus from food contact surfaces in a meat-based broth and sensitivity to sanitizers.

Novel Nucleoside Diphosphatase Contributes to Staphylococcus aureus Virulence.

Newly-synthesized chalcones-inhibition of adherence and biofilm formation of methicillin-resistant Staphylococcus aureus.

Filaments in curved streamlines: Rapid formation of Staphylococcus aureus biofilm streamers.

Presence of Pseudomonas aeruginosa influences biofilm formation and surface protein expression of Staphylococcus aureus.

The Staphylococcus aureus protein-coding gene gdpS modulates sarS expression via mRNA-mRNA interaction.