Gene expression profiling studies in regenerating nerves in a mouse model for CMT1X: uninjured Cx32-knockout peripheral nerves display expression profile of injured wild type nerves.

YEXNR-11862; No. of pages: 11; 4C: Experimental Neurology xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Experimental Neurology journal homepage: www.elsevier.com/locate/yexnr

1

Regular Article

5Q13

Mona Freidin a,⁎,1, Samantha Asche-Godin b,1, Charles K. Abrams c

9

a r t i c l e

10 11 12 13 14

Article history: Received 23 July 2014 Revised 13 October 2014 Accepted 18 October 2014 Available online xxxx

15 16 17 18 19 20 21

Keywords: CMT1X Regeneration Peripheral nerve injury Schwann cells Non-myelinating Differential gene expression

a b s t r a c t

P

i n f o

22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41

2011). X-linked Charcot–Marie–Tooth disease (CMT1X) is an inherited peripheral neuropathy associated with mutations in the human gene for Connexin32 (Cx32), GJB1. Cx32 gap junction proteins are found in the non-compact myelin of the paranodes and Schmidt–Lanterman incisures in myelinated peripheral nerve providing intracellular channels between adjacent myelin loops shortening the radial diffusion of small molecules between the Schwann Cell nucleus and adaxonal membrane at least 300 times (Abrams and Bennett, 2000; BaliceGordon et al., 1998; Scherer et al., 1995). Over 300 CMT1X mutations have been identified (http://www.molgen.ua.ac.be/cmtmutations/ Mutations/Mutations.cfm). Disruption of the myelin communication pathway by mutations in Cx32 has been proposed as a mechanism in CMT1X. Typical features of CMT1X include a delayed onset until the second decade, initial involvement of distal nerves, and axonal loss and moderate reductions in peripheral nerve conduction velocities (Ionasescu, 1995; Yiu et al., 2011).

56 57

E

D

X-linked Charcot–Marie–Tooth disease (CMT1X) is an inherited peripheral neuropathy caused by mutations in GJB1, the human gene for Connexin32 (Cx32). This present study uses Ilumina Ref8-v2 BeadArray to examine the expression profiles of injured and uninjured sciatic nerves at 5, 7, and 14 days post-crush injury (dpi) from Wild Type (WT) and Cx32-knockout (Cx32KO) mice to identify the genes and signaling pathways that are dysregulated in the absence of Schwann cell Cx32. Given the assumption that loss of Schwann cell Cx32 disrupts the regeneration and maintenance of myelinated nerve leading to a demyelinating neuropathy in CMT1X, we initially hypothesized that nerve crush injury would result in significant increases in differential gene expression in Cx32KO mice relative to WT nerves. However, microarray analysis revealed a striking collapse in the number of differentially expressed genes at 5 and 7 dpi in Cx32KO nerves relative to WT, while uninjured and 14 dpi time points showed large numbers of differentially regulated genes. Further comparisons within each genotype showed limited changes in Cx32KO gene expression following crush injury when compared to uninjured Cx32KO nerves. By contrast, WT nerves exhibited robust changes in gene expression at 5 and 7 dpi with no significant differences in gene expression by 14 dpi relative to uninjured WT nerve samples. Taken together, these data suggest that the gene expression profile in uninjured Cx32KO sciatic nerve strongly resembles that of a WT nerve following injury and that loss of Schwann cell Cx32 leads to a basal state of gene expression similar to that of an injured WT nerve. These findings support a role for Cx32 in non-myelinating and regenerating populations of Schwann cells in normal axonal maintenance in re-myelination, and regeneration of peripheral nerve following injury. Disruption of Schwann cell–axonal communication in CMT1X may cause dysregulation of signaling pathways that are essential for the maintenance of intact myelinated peripheral nerves and to establish the necessary conditions for successful regeneration and remyelination following nerve injury. © 2014 Published by Elsevier Inc.

R

R

E

c

Department of Neuroscience, Albert Einstein College of Medicine, Bronx, NY 10461, USA Department of Neurology, State University of New York, Downstate Medical Center, Brooklyn, NY 11203, USA Department of Neurology, State University of New York, Brooklyn, NY 11203, USA

T

b

O

a

R O

6 7 8

C

3

F

4

Gene expression profiling studies in regenerating nerves in a mouse model for CMT1X: Uninjured Cx32-knockout peripheral nerves display expression profile of injured wild type nerves

2

46 44 43 45

N C O

42

Introduction

48 49

Connexins are a large family of homologous integral membrane proteins that form cell–cell channels or gap junctions as well as single-cell membrane hemichannels (Abrams and Rash, 2009; Kar et al., 2012) and provide a low resistance pathway for the diffusion of small molecules and ions between coupled cells (Kumar and Gilula, 1996). Recent data also suggests that connexins help regulate cell growth and apoptotic or necrotic cell death, independent of the formation of functional gap junction channels (Lin et al., 2003; Omori et al., 2007; Vinken et al.,

50 51 52 53 54 55

Q1

U

47

⁎ Corresponding author at: Albert Einstein College of Medicine, Dept. Neuroscience, 1300 Morris Park Avenue, Bronx, NY 10461, USA. E-mail address: [email protected] (M. Freidin). 1 M. Freidin and S. Asche-Godin contributed equally to this manuscript.

http://dx.doi.org/10.1016/j.expneurol.2014.10.014 0014-4886/© 2014 Published by Elsevier Inc.

Please cite this article as: Freidin, M., et al., Gene expression profiling studies in regenerating nerves in a mouse model for CMT1X: Uninjured Cx32-knockout peripheral nerves display ..., Exp. Neurol. (2014), http://dx.doi.org/10.1016/j.expneurol.2014.10.014

58 59 60 61 62 63 64 65 66 67 68 69 70 71

Progress of peripheral neuropathy in Cx32KO mice

100

111 112

Cx32KO mice develop histopathologic signs of demyelinating neuropathy beginning at approximately three months that progresses with increasing age (Anzini et al., 1997; Scherer et al., 1998). Myelinated motor fibers are more affected than myelinated sensory fibers at all ages. The Cx32 gene is located on the X-chromosome and, like other X-linked genes, is randomly inactivated. Heterozygous Cx32KO +/− female mice have a milder phenotype with fewer demyelinated and re-myelinated axons than age-matched homozygous Cx32KO−/− female and Cx32KO−/Y male mice reflecting the clinical patterns for human CMT1X. These findings indicate that loss of function of Cx32 Schwann cells is sufficient to cause an inherited demyelinating neuropathy and supports the hypothesis that Cx32 has an essential role in Schwann cells both in mice and in humans.

113

Gene profiling studies

114 115

Gene expression profiling facilitates the measurement of the relative regulation of thousands of genes in a single RNA sample. Using microarray analysis, Iacobas and colleagues compared Cx32KO and Cx43KO brains and found strong overlaps in sets of regulated genes, leading the authors to suggest that the brain transcriptome contains “connexin-dependent regulomes” (Iacobas et al., 2007). Similar studies examining peripheral nerves of WT or connexin-null mice have not been published. Earlier microarray studies validated the use of mouse models of peripheral nerve injury and have identified several Schwann cell-specific and cell cycle genes involved in proliferation and differentiation during sciatic nerve regeneration (Kury et al., 2002; Ten Asbroek et al., 2006). The current study uses IIlumina MouseRef8-v2 BeadArray to compare the expression profiles in uninjured and injured sciatic nerves from age-matched Cx32KO and WT mice. The present studies used 5-week old mice to limit the potential effects of axonal pathologies that develop in Cx32KO mice beginning between two and three months of age (Sargiannidou et al., 2009; Scherer et al., 1998). Given the apparent limited developmental effects in Cx32KO mice, we predicted

92 93 94 95 96 97

101 102 103 104 105 106 107 108 109 110

116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132

C

90 91

E

88 89

R

86 87

R

84 85

O

82 83

C

80 81

N

78 79

U

77

148

F

99

75 76

Methods Animals and surgery

R O

98

Cx32 protein and mRNA are co-regulated with the expression of myelin-specific genes during development and during myelination as well as during regeneration and repair of injured peripheral nerves (Bondurand et al., 2001; Nagarajan et al., 2002). Sohl et al. (1996) report that following sciatic nerve injury (a period of increased SC proliferation) SC expression of Cx32 followed the same time course as several myelin genes; indicating that expression of Cx32 is related to regeneration associated re-myelination. Thus, mutations in or loss of Cx32 would be predicted to disrupt the repair and regeneration of injured peripheral nerve. Xenograph transplant experiments in nude mice demonstrated that Schwann cells with a loss-of-function CMT1X mutation in Cx32 (Val181Ala) were severely impaired in their ability to support the earliest stages of regeneration of myelinated fibers (Abrams et al., 2003), while Schwann cells expressing a less severe mutation (Glu102Gly) supported normal early regeneration (Sahenk and Chen, 1998). The abnormalities associated with the Val181Ala mutation in these experiments occur at a time of Schwann cell proliferation and dedifferentiation, when no myelin is present, indicating an additional functional role for Cx32 in non-myelinating Schwann cells. Further evidence from our lab demonstrates that loss of Cx32 decreases proliferation in cultured Schwann cells from Cx32-knockout (Cx32KO) mice as compared to Wild Type (WT) (Freidin et al., 2009). These findings and others (Freidin et al., 2009; Mambetisaeva et al., 1999; Sohl et al., 1996) suggest that mutations in Cx32 might influence both nonmyelinating and myelinating SC functions.

133 134 135 136 137 138 139 140 141 142 143 144 145 146 147

149

A colony of C57Bl/6 WT and Cx32KO mice was bred in-house. The Cx32KO mice were bred from founders that had been extensively backcrossed into C57Bl/6 (generously provided by S. Bennett, U. Ottawa, Canada). All animals were provided food and water ad libitum and housed according to the Guide for the Care and Use of Laboratory Animals. For nerve crush studies, age-matched, 35–37 day-old WT and Cx32KO male mice were induced and anesthetized using isoflorane. With minimal perturbation of the overlying muscle and fascia, the sciatic nerve was exposed and crushed 5 mm distal to the sciatic notch for 30 s with ultrafine curved hemostats until translucent. The crush site was then marked with India ink and the skin closed with surgical staples. The mice were allowed to recover in their home cages. To minimize pain, all mice received ibuprofen (4.7 ml children's ibuprofen suspension in 500 ml water) for 12 h prior to surgery and for 36 h following surgery, as per IPUPAC guidelines. Cage mates that did not undergo surgery served as uninjured age-matched controls. The mice were sacrificed at 5, 7, and 14 dpi for tissue collection. A 5 mm segment was collected distal to the crush site and stored in RNALater (Ambion) at −80 °C, as per manufacturer's suggestions. For uninjured nerve samples, a 5 mm segment was collected distal to the sciatic notch and processed as for crush samples. Nerve samples from four mice were pooled for each time point in an experimental series. Each experimental time series was repeated six times, for a total of six biological replicates.

150

RNA purification and labeling

175

RNA was extracted and purified from pooled nerve samples using RNAeasy Lipid Mini kit (Qiagen, Country), as per manufacturer's instructions. Purified RNA (500 ng) was amplified and labeled using the Illumina TotalPrep RNA Amplification Kit (Ambion/Life Technologies). Biotin-labeled cRNA was stored at −80 °C until needed.

176

Microarray hybridization, quality control, and normalization

181

Labeled cRNA was outsourced to the Keck Microarray Section of Yale Center for Genome Analysis (Yale University, New Haven, CT) for microarray processing, hybridization, and background normalization using IIlumina MouseRef8-v2 BeadArray BeadChip technology. cRNA quality was confirmed prior to hybridization by the Keck microarray facility. Following hybridization and labeling, the arrays were scanned and the output normalized in BeadStudio (Illumina) for quality control, background, and data export. Each BeadArray chip contained eight cRNA samples permitting hybridization of single biological replicate for the full time series:

182

P

73 74

significant changes in gene expression following peripheral nerve crush injury and during regeneration in Cx32KO mice as compared to WT. Microarray analysis, however, showed a biphasic response, with a dramatic decline in the number of differentially regulated genes (DEG) at 5 and 7 days post injury (5 and 7 dpi) and significant differences in DEG from uninjured Cx32KO mice as compared to WT. Further comparisons of uninjured and injured nerves within each genotype demonstrated that Cx32KO nerves underwent relatively few changes in gene expression in following crush injury as compared to uninjured Cx32KO nerves. As predicted, WT samples exhibited robust changes in gene expression. Taken together, these data suggest that the gene expression profile in uninjured Cx32KO sciatic nerve strongly resembles that of a WT nerve following a crush injury and that loss of Schwann cell Cx32 leads to a basal state of gene expression similar to that in injured WT nerve.

D

Cx32 in non-myelinating Schwann cells and peripheral nerve regeneration

T

72

O

M. Freidin et al. / Experimental Neurology xxx (2014) xxx–xxx

E

2


151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174

177 178 179 180

183 184 185 186 187 188 189 190 191


219

Real time PCR validation

220 221

RNA was extracted and purified from pooled nerve samples as described. RNA samples were subjected to DNAse treatment (Turbo DNA-free Kit, Ambion) to remove chromosomal DNA contamination and quantitated by absorbance at OD260. cDNA from total RNA (5 μg) was synthesized using the Superscript VILO cDNA synthesis kit (Invitrogen), according to manufacturer's suggestions. Qualitative Real Time PCR was performed using 15 μl reactions containing 75 ng sciatic nerve cDNA and SsoFast Sybr Green Supermix (Biorad) on a Chromo4 DNA Engine system with Opticon3 Monitor software (Bio-Rad). Validated primer pairs for TATA binding protein, Actin-b, GAPDH, S100b, and, c-fos were obtained from SABiosciences (Qiagen). Sequences for validated primers for CANX, CYC1, and p75NGFR were obtained through PrimerBank (Spandidos et al., 2010). The sequences for these primers were as follows: CANX-For ATGGAAGGGAAGTGGTTACTGT; CANX-Rev GCTTTGTAGGTGACCTTTGGAG; CYC1-For CAGCTTCCATTGCGGACAC; CYC1-Rev GGCACTCACGGCAGAATGAA; p75NGFR-For CAATGTCCACCA GGAAAACGA; p75NGFR-Rev GGAAGTTAGGGGCAAGTCG. Data were preprocessed and analyzed for relative expression levels using GenEx5.4 (MultiD Analyses, Germany). Samples with CTN33 were considered above the limit of detection. Stable housekeeping reference genes were determined for sciatic nerve samples using geNorm and NormFinder programs embedded in GenEx5.4 prior to performing gene expression studies (Vandesompele et al., 2002; Andersen et al., 2004; Mestdagh et al., 2009). Real time PCR experiments were conducted using MIQE guidelines and suggested checklists (Bustin et al., 2009, 2010).

215 216 217

222 223 224 225 226 227 228 229 230 231 232 Q2 233 234 235 236 237 238 239 240 241 Q4242 Q3 Q5 Q7243 Q6

T

213 214

C

211 212

E

209 210

R

207 208

244

Results

245

Differential gene regulation between WT and Cx32KO at each time point

246

To address the role of Cx32 in the maintenance and regeneration of peripheral nerve, this study compared gene expression profiles of sciatic nerves from uninjured WT and Cx32KO mice and injured nerve samples at 5, 7, and 14 after crush. Pooled sciatic nerve samples from age-

247 248 249

Differential gene regulation over time for each genotype

281

To evaluate differences in gene regulation between uninjured and injured nerves for each genotype, DEG for WT and Cx32KO were assessed with respect to time following crush injury. Comparisons within each genotype group were made to determine differential gene expression in uninjured mice against that of mice at 5, 7, and 14 dpi.

282 283

R

205 206

N C O

203 204

U

201 202

F

218

Log2-transformed data from all BeadChip experiments were imported from BeadStudio (Illumina) into Partek Genomic Suite for statistical analysis. Following removal of batch effects, mixed-model ANOVA was used to identify differentially expressed genes. Comparisons between Cx32KO and WT at each time point were used to generate lists of DEG based on relative expression levels (fold-change) greater than 1.5 and false discovery rate (FDR) corrected p-values (B-H pValue) derived from the Benjamini–Hochberg step-up procedure (Benjamini and Hochberg, 1995) to account for multiple testing. FDRcorrected gene lists were also determined for each genotype with respect to time based on comparisons of uninjured versus 5, 7, or 14 dpi. Functional and pathway analyses of gene lists at each time were conducted using Ingenuity Pathway Analysis (IPA), GOMiner (Zeeberg et al., 2003, 2005), Mouse Genome Database (Blake et al., 2014), and Mouse Genome Informatics (MGI) Batch Query (URL: http://www. informatics.jax.org) online analysis tools. Gene ontology (GO) annotations and GOSlim datasets were obtained or investigator-defined using EMBL QuickGO (URL: http://www.ebi.ac.uk/QuickGO/) and MGI Batch Query tools.

O

200

R O

Microarray analysis and statistical tests

196 197

250 251

P

199

194 195

matched uninjured and injured WT and Cx32KO mice were taken from sites distal to the crush and processed for microarray using Illumina MouseRef8-v2 BeadArray. ANOVA was conducted on the complete data set using Partek Genomics Suite (Partek, Inc, St. Louis MI). Post-test comparisons with Benjamini–Hochberg (Benjamini and Hochberg, 1995; Hochberg and Benjamini, 1990) multiple test correction and false discovery rate (FDR) (Noble, 2009) created lists of significantly regulated genes in Cx32KO as compared to WT for each experimental group. In the uninjured nerve samples, 640 differentially expressed genes (DEG) were identified in the uninjured Cx32KO relative to WT, with downregulation of 316 and up-regulation of 324 genes (Fig. 1, Table 1). Relative expression levels of several differentially regulated Schwann cell genes (c-Fos, p75NGFR, and S100b) were validated by real time PCR (Supplementary Fig. 1) using RNA collected from uninjured WT and Cx32KO sciatic nerves. The number of DEG decreased dramatically at early times after injury with differential expression in Cx32KO nerves of only 24 and 20 genes at 5 dpi and 7 dpi, respectively. At 14 dpi, the differences in the number of altered genes re-emerged, rising to 891 DEG in Cx32KO nerve relative to WT. Thus, initial responses to nerve injury are similar in WT and Cx32KO, but significant differences in gene expression appear in uninjured and regenerating (14dpi) Cx32KO nerves relative to WT. Uninjured and 14dpi Cx32KO nerves shared 311 DEG relative to WT, representing 48.6% and 34.9% of regulated genes for each time point, respectively (Fig. 2). Further comparison at the other time points showed five genes in common at 5 dpi and 7 dpi, comprising 20.8% and 23.8% of DEG at each time point. These findings indicate that the greatest differential gene regulation occurs in uninjured and regenerating (14 dpi) Cx32KO nerves.

E

198

uninjured nerve and nerve at 5, 7 and 14 dpi for Cx32KO and WT samples. Six Illumina MouseRef-8 v2.0 BeadChips were used for the gene expression analysis, corresponding to six replicate time series and six biological replicates for each time point. .Experiments were designed, performed, and analyzed based on MAIME (Minimum Information About a Microarray Experiment) guidelines (Brazma, 2009).

D

192 193

3

Fig. 1. Gene expression profile of Cx32KO nerve samples crush injury relative to WT. The number of differentially regulated genes in Cx32KO nerves relative to WT is dramatically reduced at 5 and 7 dpi. Ratio of all corrected Log2 transformed raw gene expression values for Cx32KO versus WT nerves at 5, 7, and 14 days post injury (dpi).


252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280

284 285 286

t1:9 t1:10 t1:11 t1:12

Uninjured 5 dpi 7 dpi 14 dpi

640 (316↑, 324↓) 24 (11↑, 13↓) 20 (7↑, 13↓) 891 (383↑, 508↓)

287 288

296 297

Comparison of differentially regulated genes in uninjured Cx32KO nerves and genes regulated in WT nerves following injury

298

To test the observation that uninjured Cx32KO gene expression follows a pattern similar to injured WT, the number of regulated genes in uninjured Cx32KO relative to uninjured WT (see Table 1) were compared with WT DEG (relative to uninjured WT; see Table 2) at 5 and 7 dpi (Fig. 3). 520 and 1162 genes, or approximately 83% of DEG, are shared between injured WT nerves at 5 and 7 dpi (versus uninjured WT) and uninjured Cx32KO (versus uninjured WT) (Fig. 3A). Similar comparisons of DEG within each genotype reveal a high degree of

C

E

305

R

303 304

Gene ontology (GO) enrichment analysis assigns biological and functional groupings to lists of differentially expressed genes based on commercially and publically assembled GO databases. Numerous software tools are available for GO analysis and provide detailed statistical results to illustrate the biological significance of regulated genes. Lists of differentially regulated genes from each Cx32KO versus WT time point were probed for GO term enrichment using the GOminer

R

301 302

Gene ontology (GO) functional analysis of gene expression profiles in uninjured and injured Cx32KO mice compared to WT

O

299 300

overlap in the WT gene lists at 5 and 7 dpi (relative to uninjured WT) (Fig. 2B), with 1160 shared genes or 88.9% and 83.5% of 5 and 7 dpi WT DEG in common. Fig. 2C compares gene lists in injured Cx32KO nerves relative to uninjured with 21 shared genes shared between at 5 and 7 dpi; representing only 10% (21/221 DEG) of genes in the Cx32KO 5 dpi group and the entire 7 dpi gene list. These observations are particularly striking given the large number of regulated WT genes relative to uninjured WT at these early time points (1307 and 1392, respectively; Table 2) and the relatively small number of DEG in Cx32KO mice (compared to uninjured Cx32KO) at 5 and 7 dpi (221 and 21, respectively; Table 2). Thus, the gene expression profile in uninjured Cx32KO peripheral nerve shows limited changes following injury and closely shares the expression profile of injured WT nerves.

C

293 294

t2:7 t2:8 t2:9

N

291 292

221 (102↑,119↓) 21 (12↑,9↓) 159 (123↑,36↓)

U

289 290

1399 (669↑,730↓) 1392 (667↑,725↓) 0

T

295

As summarized in Table 2, dramatic differences in gene regulation were observed following crush injury in WT nerves relative to uninjured WT nerves. 1399 and 1392 WT genes changed at 5 dpi and 7 dpi, respectively, compared to uninjured WT. Strikingly, by 14 dpi, no significant differences were detected in WT nerves compared to uninjured. Crush injury followed a different pattern in Cx32KO nerves with comparatively few DEG in Cx32KO nerves at 5 dpi and 7 dpi (221 and 21 genes) compared to uninjured Cx32KO. Unlike WT, 14 dpi Cx32KO samples showed a significant regulation of 159 genes nerves versus uninjured.

Uninj vs 5 dpi Uninj vs 7 dpi Uninj vs 14 dpi

t2:6

F

Total DEG 32KO vs WT (#↑, #↓)

32KO total DEG (#↑, #↓)

O

Days post injury (dpi)

t2:1 t2:2 t2:3 t2:4 t2:5

WT total DEG (#↑, #↓)

R O

t1:8

Table 2 Differentially expressed genes for WT and Cx32KO nerves at 5, 7, and 14 dpi relative to uninjured nerves for each genotype. Corrected gene lists for each genotype with respect to time were determined comparing uninjured versus 5, 7, or 14 dpi for relative expression levels (fold-change) greater than 1.5 and FDR p b 0.05 for all comparisons.

P

Table 1 Differentially expressed genes in uninjured and injured Cx32KO nerves at 5, 7, and 14 dpi relative to WT. Following removal of batch effects, mixed-model Analysis of Variation (ANOVA) was used to identify differentially expressed genes (DEG) from Log2 transformed raw data. Gene lists were also determined for each genotype with respect to time based on comparisons of uninjured versus 5, 7, or 14 dpi. (Uninj: FDR p b 0.05; 5 dpi FDR p b 0.1; 7 dpi FDR p b 0.2; 14 dpi p b 0.05).

D

t1:1 t1:2 t1:3 t1:4 t1:5 t1:6 t1:7


E

4

Fig. 2. Venn diagram comparing differentially expressed genes in Cx32KO nerves relative to WT following crush injury. Venn diagram illustrating the overlap of differentially expressed genes in Cx32KO nerve samples relative to WT at each time point (A). Venn diagrams of up-regulated (B) and down-regulated (C) genes in Cx32KO nerves relative to WT.


306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327

5

P

R O

O

F


T

C

E R R

332

Given the inherent redundancy of GO databases, the creation of consolidated lists of GO terms (GOSlims) that are based on existing relationships between terms in the ontologies provide a corrected summary of the larger GO annotation sets. GOSlims, whether curated or user-defined, facilitate a more circumscribed classification and

N C O

330 331

(Zeeberg et al., 2005) software tool assigning biological and functional GO terms for each gene list. This analysis yielded significant enrichment scores for over 900 GO functional groups which, in turn, encompassed a large number of overlapping genes, GO terms, and GO identifiers, making meaningful interpretation difficult without further refinement.

U

328 329

E

D

Fig. 3. Comparison of shared genes in uninjured Cx32KO nerves and injured WT. DEG for uninjured Cx32KO (relative to uninjured WT) were compared to the gene lists in WT nerves (relative to uninjured WT) at 5 and 7 dpi demonstrate a high degree of overlap between injured WT nerves and uninjured Cx32KO nerves (A); with greater than 75% of DEG shared between uninjured Cx32KO and injured WT at 7 dpi versus uninjured WT. Comparison of DEG from WT at 5 and 7 dpi relative to uninjured WT (B) and Cx32KO at 5 and 7 dpi relative to uninjured Cx32KO (C) shows a high degree of overlap in WT nerves.

Fig. 4. Schwann/myelin GOSlim functional analysis of Cx32KO vs WT for uninjured and injured groups at 5, 7, and 14 days post-injury. Gene lists for each experimental time group were analyzed for enrichment of Schwann/Myelin GOSlim functional categories using the GOMiner online tool. Enrichment scores for each GOSlim term were calculated using Fisher's exact test, with corrections. By convention, a functional category is considered over-expressed or enriched with enrichment scores N1. Enrichment scores N3 correspond to significant overexpression (p b 0.05).


333 334 335 336 337

6

352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371

Functional analysis of myelin and Schwann cell GO terms Highly significant Myelin/Schwann GOSlim enrichment scores were obtained for compact myelin, myelin sheath, myelin assembly, and myelination GOSlim terms at 5 dpi and, to a lesser value, at 14 dpi (Fig. 4A). The 7 dpi gene list returned a significant GO enrichment score of 150 for the compact myelin term, as well. Schwann cell differentiation and Schwann cell development GOSlim terms generated enrichment scores greater than 3 for the 14 dpi gene list (Fig. 4B). Further classification showed that only the uninjured Cx32KO (relative to uninjured WT) gene list achieved enrichment scores greater than one; specifically for genes associated with the myelin maintenance, negative regulation of myelination, and myelination GOSlim terms. Myelin/ Schwann GOSlim terms for NGF binding, myelination of peripheral nerve, peripheral nerve development, and constituent myelin sheath were enriched (score N 1) at 14 dpi. Taken together, the Myelin/ Schwann GOSlim functional analysis suggests that loss of Cx32 results in a dysregulation of genes associated with the temporal response to peripheral nerve injury as well as genes involved in functional pathways involved with regeneration.

382

Expression of genes associated with functional pathways

383 384

GO annotations are the gene products associated with a GO term and are generated by a combination of electronic/bioinformatic strategies and manual curation. Using QuickGo and MGI batch inquiry tools, GO gene annotations associated with the Schwann/Myelin GOSlim and Immune Response GOSlims were created and compared to the lists of differentially regulated genes for the Cx32KO versus WT uninjured and 5, 7, and 14 dpi groups.

385 386 387 388 389 390 391 392 393 394 395 396 397 398

R

R

O

C

378 379

nerves relative to WT; with decreased expression in twelve genes and increases in three genes (Figs. 6A and B). The myelin genes Mag and P0 were significantly reduced in Cx32KO relative to WT after crush injury, with down-regulation of P0 at 7dpi and Mag at both 5 and 7 dpi. Only Myo5a, a motor protein gene associated with RNA transport in Schwann cells (Canclini et al., 2013), was increased in uninjured Cx32KO compared to WT nerves. To begin to examine the potential interconnectivity of regulated Schwann/Myelin GOSlim genes, an interaction network of Schwann/ Myelin GOSlim DEG was generated using the Ingenuity Pathway Analysis (IPA) tool (Supplementary Fig. 2). This user-curated network illustrates the potential relationships between differentially regulated

N

376 377

Fig. 5. Immune/stress response GOSlim functional analysis of Cx32KO vs WT for uninjured and injured groups at 5, 7, and 14 days post-injury. Gene lists for each experimental group were analyzed for enrichment of Immune/Stress Response GOSlim functional categories using the GOMiner online too. Enrichment for Immune/Stress Response terms were observed in uninjured and 14 dpi injured Cx32KO nerves relative to WT.

U

374 375

E

380 381

Functional analysis of immune response GO terms To examine the regulation of GO functional categories with respect to immune response, the gene lists for uninjured and injured Cx32KO nerve samples (relative to WT) were reprobed with the Immune/Stress Response GOSlim. The majority of enrichment scores greater than one were obtained for uninjured and 14 dpi genes lists, including regulation of response to biotic stimulus, response to stress, defense response, and inflammatory response (Fig. 5). Analysis of the 5 dpi gene list did show GO enrichment for the regulation of immune system process and immune response GOSlim terms; reflecting a further shift in functional gene regulation of Cx32KO nerves toward biological response terms associated with injured nerve relative to WT.

372 373

F

351

O

349 350

R O

347 348

P

345 346

D

344

E

342 343

T

340 341

visualization of regulated functional groups for a particular data set. Custom Myelin/Schwann GOSlim and Immune/Stress Response GOSlim term lists were generated based on GO annotations associated with myelination, regeneration, peripheral nerve injury, and Schwann cell behavior for the Myelin/Schwann GOSlim and enriched immune response GO annotations for the Immune/Stress Response GOSlim using the QuickGO term tool (European Bioinformatics Institute). Employing GOMiner, these custom GOSlims were subsequently used to reprobe each list of significantly regulated genes in uninjured, 5, 7, and 14 dpi Cx32KO samples relative to WT. The analysis generated enrichment scores for the GOSlim terms. By convention, a GO term is considered “enriched” with a score greater than one and “significantly enriched” with a score greater than three.

C

338 339


Gene expression profiles within the Schwann/Myelin GOSlim The Schwann/Myelin GOSlim terms comprised 157 genes, after compensating for overlaps across GO annotations. Of these common Schwann/Myelin GOSlim genes, 25 genes were significantly regulated in Cx32KO nerves relative to WT for at least one time point (Fig. 6). Four genes, p75NGFR, Pou3f1, Cxcr4, and Ednrb, were significantly upregulated in both uninjured and regenerating 14 dpi Cx32KO nerves relative to WT (Fig. 6B). The majority of Schwann/Myelin GOSlim DEG (15/25 genes) showed significant regulation in only 14 dpi Cx32KO

Fig. 6. Differential gene expression of genes associated with Schwann/myelin GOSlim terms in uninjured and injured Cx32KO nerves vs WT. After compensating for overlaps across Schwann/Myelin GO gene annotations, a list of 157 Schwann/Myelin GOSlim genes was generated. This list was compared to DEG from uninjured and injured Cx32KO nerves relative to WT. 25 genes were significantly regulated in Cx32KO nerves relative to WT for at least one time point. A: Down-regulated genes. B: Up-regulated genes.


399 400 401 402 403 404 405 406 407 408 409 410


430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447

Fig. 7. DEG associated with cytokine/chemokine signaling pathways in uninjured and 14 dpi Cx32KO nerves vs WT. A consensus gene list for the chemokine and cytokine signaling pathway was generated and cross-referenced to the Immune/Stress Response GOSlim gene creating a consensus cytokine/chemokine gene list for analysis. This gene list was used to probe DEG from uninjured and injured Cx32KO nerves relative to WT. A: Down-regulated genes. B: Up-regulated genes.

p75NGFR, a member of the TNFR-superfamily of cytokine receptors, is expressed in non-myelinating and immature Schwann cells and is highly regulated during development, myelination, and in regenerating peripheral nerve (Tomita et al., 2007; Zhou and Li, 2007). p75NGFR serves as a marker for non-myelinating Schwann cells in mature nerve and de-differentiated Schwann cells following nerve injury and is significantly upregulated in uninjured and regenerating 14 dpi Cx32KO nerves compared to WT. The transcription factor c-Jun is a master regulator of the Schwann cell injury response (Arthur-Farraj et al., 2012; Fontana et al., 2012), providing the switches necessary for the de-differentiation and differentiation of the Schwann cell program following nerve crush or axotomy (Arthur-Farraj et al., 2012; Fontana et al., 2012). Examination of c-Jun expression in WT nerves shows increased levels at 5 dpi relative to uninjured WT, in agreement with earlier reports showing induction of c-Jun in Schwann cells following crush injury (Shy et al., 1996; Soares et al., 2001; Stewart, 1995). By contrast, differential regulation of c-Jun was not observed in Cx32KO nerves at any time following injury relative to uninjured Cx32KO nerves. Direct comparison each time point following injury revealed upregulation of c-Jun in regenerating Cx32KO nerves at 14 dpi relative to WT. To explore the intersection of c-Jun signaling pathways with the regulation of p75NGFR, a c-Jun GOSlim was generated using QuickGo, KEGG, and MGI batch inquiry tools. A consensus gene list was subsequently created using the c-Jun GOSlim gene annotations. The c-Jun GOSlim contained 11 distinct GO categories and 3844 gene annotations. Following removal of duplicates, a consensus c-Jun GOSlim gene list was created. Of the 413 unique c-Jun GOSlim genes, 23 and 18 genes overlapped with the Schwann/Myelin and Immune GOSlim gene annotations, respectively. Comparison of the three gene lists found only p75NGFR in common. Analysis of the c-Jun GOSlim gene list identified 36 significantly regulated in uninjured and 14 dpi Cx32KO samples relative to WT (Fig. 8). Cross comparison of regulated c-Jun GOSlim genes with Schwann/Myelin GOSlim genes revealed that only p75NGFR and TGFβ1 were shared between the two gene lists; with differential regulation of p75NGFR in both uninjured and 14 dpi and TGFβ1 in 14 dpi Cx32KO nerves relative to WT. Similar evaluation of regulated c-Jun GOSlim genes with Immune GOSlim gene lists revealed 11 common genes; again sharing p75NGFR as a differentially regulated gene in uninjured and 14 dpi Cx32KO nerves. Finally, a network diagram of differentially expressed c-Jun GOSlim genes was generated using IPA (Supplementary Fig. 4); illustrating the connections between regulated genes in the c-Jun pathway and DEG associated with immune response, Schwann cell, and myelin genes in Cx32KO nerves relative to WT.

456

Discussion

501

This study examined the expression profiles of injured and uninjured sciatic nerves from WT and Cx32KO mice to identify the genes and functional or signaling pathways that are dysregulated in the absence of Schwann cell Cx32. Based on the assumption that loss of Schwann cell Cx32 disrupts the regeneration and maintenance of myelinated nerve leading to a demyelinating neuropathy in CMT1X, we initially hypothesized that nerve crush injury would result in significant increases in differential gene expression in Cx32KO mice relative

502

O

F

455

R O

428 429

Regulation of p75NGFR and Jun signaling pathways

P

426 427

448 449

D

424 425

regulated in only uninjured Cx32KO and three in 14 dpi Cx32KO nerves as compared to WT (Figs. 7A and B). An interaction network composed of differentially expressed cytokine and chemokine genes from the uninjured and 14dpi data sets was generated using IPA (Supplementary Fig. 3), illustrating the interconnections associated with genes involved in inflammatory and immune response pathways in Cx32KO peripheral nerves relative to WT.

E

422 423

T

420 421

C

418 419

E

416 417

Gene expression profiles within the Immune GOSlim The Immune GOSlim is associated with 5413 gene annotations. After compensating for overlaps, the Immune GOSlim gene list was reduced to 191 unique genes. Differences in genes associated with immune response did not significantly differ between Cx32KO and WT following crush injury at 5 and 7 dpi. However, 75.4% (144/191 genes) of the Immune GOSlim gene list were differentially regulated in Cx32KO as compared to WT in uninjured and 14 dpi nerves Thus, early responses to injury do not differ between WT and Cx32KO but the gene expression pathways associated with immune responses are altered in uninjured and regenerating (14 dpi) Cx32KO nerves relative to WT nerves. Given the complexity and interrelationships of the genes associated with immune and stress response signaling pathways, Ingenuity Pathway Analysis (IPA) was conducted that compared Cx32KO versus WT gene lists for each time point. Consistent with Immune GOSlim gene annotation analysis, IPA identified significant regulation of the chemokine/ cytokine immune response signaling pathway in uninjured and 14 dpi Cx32KO nerve samples (relative to WT). Chemokines belong to a family of inflammatory cytokines that regulate a host of inflammatory and immune biological processes involved with cellular activation, differentiation, and survival (Comerford and McColl, 2011; Pineau and Lacroix, 2009). Responses to peripheral nerve injury, including Wallerian degeneration and nerve regeneration, involve coordinated activation of chemokine and cytokine pathways (Dubovy et al., 2013; Patodia and Raivich, 2012). To begin the analysis, a consensus chemokine/cytokine gene list was generated by cross-referencing genes associated with chemokine and cytokine signaling as identified by IPA, KEGG (Kanehisa et al., 2012) and InnateDB tools (Breuer et al., 2013; Lynn et al., 2008). This final consensus list of 343 chemokine/cytokine genes was then compared to the lists of DEG identified from the Immune GOSlim gene list. The resulting cross comparison found 23 regulated genes in common (Fig. 7). Nine of these cytokine/chemokine genes were regulated in both uninjured and 14 dpi Cx32KO samples relative to WT (Fig. 7A.), while nine were

R

415

R

414

N C O

413

genes associated with Schwann cell differentiation, myelination, and regeneration and the impact and the effects due to loss of Schwann cell Cx32.

U

411 412

7


450 451 452 453 454

457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500

503 504 505 506 507 508 509


days 14 and 28 post-injury (Hall et al., 1997) as Schwann cells redifferentiate to mature myelinating and non-myelinating phenotypes upon contact with regenerating axons (Hall et al., 1997; Jessen and Mirsky, 2008). As predicted, WT nerves responded with a significant regulation of large numbers of genes following crush injury, with 1399 and 1392 genes at 5 and 7 dpi, respectively and no significant differences in gene expression at 14 dpi compared to uninjured WT nerve; consistent with a return to uninjured expression levels in successfully regenerating nerves. By contrast, Cx32KO nerves showed limited changes in gene expression following injury as compared to uninjured Cx32KO nerves, with significant regulation of only 221 and 21 genes at 5 and 7 dpi and significant regulation of 159 genes at 14 dpi,. The initial and reparative responses to nerve injury require controlled modulation of the timing, degree, and specificity of gene expression for successful nerve regeneration to occur. Loss of functional Schwann cell Cx32 appears to disrupt these processes, contributing to a dysregulation of regenerative signals in Cx32KO nerves. Isoforms of axonal- and Schwann cell-derived Nrg1 have been implicated in the regulation of peripheral nerve demyelination and regeneration following injury (Chang et al., 2013; Fricker et al., 2011; Stassart et al., 2013. Significant changes in Nrg1 expression were not detected in Cx32KO nerves relative to WT at any time points examined. While regulation of Nrg1 receptors ErbB2 and ErbB3 is essential to peripheral nerve responses to injury (Mukhatyar et al., 2013; Nicolino et al., 2009), the probes for ErbB2 and ErbB3 were not present on Illumina Mouse Ref8-v2 chips, precluding the ability to address regulation of ErbB2 and ErbB3 genes in these studies. c-Jun is a master regulator of Schwann cell response to peripheral nerve injury (Arthur-Farraj et al., 2012; Pham et al., 2009). It is rapidly upregulated following nerve injury in mice and rats in concurrence with Wallerian degeneration (Camara-Lemarroy et al., 2010; Parkinson et al., 2008). Activation of c-Jun governs Schwann cell response to injury including myelin clearance, trophic factor expression, and regenerative potential in injured peripheral nerves (Jessen and Mirsky, 2008). Accordingly, mice with a Schwann cell specific deletion of c-Jun display results in neuronal death, disruption of the Schwann repair cell, delayed myelin degeneration, impaired myelin clearing, and impaired regeneration following injury (Arthur-Farraj et al., 2012) Klein et al. examined c-Jun in three mouse models of CMT1 and found increased immunolabeling for c-Jun in myelinating Cx32KO Schwann cells in adult mice in a spatial association with demyelinating axons, suggesting that c-Jun might also be a marker for pre-demyelinating axonal processes in disease models of peripheral nerves (Klein et al., 2014). We found an increased expression of c-Jun in Cx32KO nerves relative to WT at 14 dpi, a period of axonal regeneration and re-myelination, but did not detect significant changes in Cx32KO nerves relative to WT at other time points. Failure to detect differences in c-Jun expression may reflect the relatively young ages used these studies, which precedes the age at which c-Jun might be activated due to demyelination and other axonal changes that appear in older Cx32KO peripheral nerves (Sargiannidou et al., 2009; Scherer et al., 1998). Nerve injury is associated with the de-differentiation and reprogramming of Schwann cells to a repair cell phenotype; with corresponding increases in c-Jun and declines in Egr2, a pro-myelinating transcription regulator (Parkinson et al., 2008; Pham et al., 2009). Subsequent transient upregulation of Pou3f1 (Oct-6/SCIP) triggers and sustained re-induction of Egr2 phenotype triggers Schwann cell re-differentiation. Induction of myelin-specific genes ensues with successful re-differentiation toward a mature myelinating phenotype (Mandemakers et al., 2000; Svaren and Meijer, 2008). Increases in c-Jun and Pou3f1 along with decreased Egr2 were observed in 14dpi Cx32KO nerves relative to WT; further supporting a dysregulation of the Schwann cell program in the absence of functional Cx32. However, no significant changes in c-Jun were observed within genotype in Cx32KO nerves relative to uninjured at any time point, suggesting either a baseline shift toward less mature or injured Cx32KO Schwann cell

520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546

D

T

C

E

R

518 519

R

516 517

O

515

C

513 514

to WT. However, microarray analysis revealed that the uninjured and regenerating 14dpi groups showed the most DEG with 640 and 891 genes, respectively for uninjured and 14 dpi Cx32KO versus WT and a striking collapse in the number of DEG at 5 and 7 dpi in Cx32KO nerves relative to WT. A comparison of uninjured nerves to injured nerves at 5, 7, and 14 dpi within each genotype showed limited changes in Cx32KO gene expression at all three time points; while expression profiles in WT exhibited robust changes at 5 and 7 dpi and no significant differences at 14 dpi. These findings suggest that the gene expression profiles of uninjured and regenerating 14 dpi nerves lacking functional Schwann cell Cx32 most closely resemble that of injured WT nerves at 5 and 7 dpi; providing a revised perspective for understanding the cellular mechanisms in CMT1X. Disruption of peripheral nerve myelin does not occur in Cx32KO mice until three months of age (Scherer et al., 1998; Vavlitou et al., 2010). At two months, prior to the appearance of active demyelination, axonal degeneration becomes evident in uninjured peripheral nerves of Cx32KO mice with increases in β-amyloid precursor protein, increases in neurofilament packing, and reduced diameters of large myelinated fibers (Vavlitou et al., 2010). The present study specifically used 5-week old mice to limit the potential effects of axonal pathologies that appear in Cx32KO mice at two months of age. The significant differences in the gene expression profiles of uninjured Cx32KO mice relative to WT further suggest that loss of Cx32 disturbs normal Schwann cell signaling pathways at developmental time points preceding signs of axonopathy. Peripheral nerve injury results in axonal degeneration and loss of axonal contact, a process during which Schwann cells of the distal stump de-differentiate to an immature phenotype (Mirsky et al., 2008; Yang et al., 2012); with down-regulation of pro-myelinating genes and increases in immature or non-myelinating Schwann cell genes (Allodi et al., 2012). Peak up-regulation of the immature Schwann cell markers, such as p75NGFR, typically occurs between five and eight days following injury in C57Bl/6 mice, concurrent with down-regulation of Cx32, P0 (MPZ), MBP, and other major myelin genes (Barrette et al., 2010; Bolin and Shooter, 1993). Genes associated with immature or dedifferentiated Schwann cells decline to uninjured levels between

N

511 512

U

510

E

Fig. 8. c-Jun GOSlim DEG in uninjured and injured 14 dpi Cx32KO nerves vs WT. A consensus c-Jun GOSlim gene list was created and used to probe DEG from uninjured and injured Cx32KO relative to WT. 36 significantly regulated genes were identified in uninjured and 14 dpi Cx32KO samples relative to WT. A: Down-regulated genes. B: Up-regulated genes.

P

R O

O

F

8


547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612


634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 Q8 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678

703

O

F

Acknowledgments

R O

632 633

P

630 631

679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702

D

628 629

mutations displayed decreased axonal diameter and delayed regeneration as compared to axons that regenerate into grafts of normal human nerve (Abrams et al., 2003; Sahenk and Chen, 1998). Mouse models of CMT1X provide additional evidence of axonal pathology in CMT1X. Recent studies re-examining Cx32KO mice identified axonal pathology prior to demyelination, including a reduction in the diameter of myelinated axons and other cytoskeletal changes associated with slowed axonal transport and axonopathy (Vavlitou et al., 2010). Disturbance of Schwann cell–axonal signaling and support of axonal function would provide a means for myelination-independent axonal pathology observed in CMT1X. Loss of functional Schwann cell Cx32 in uninjured and 14 dpi peripheral nerves leads to a gene expression profile similar to that of an injured WT nerve, with upregulation of genes associated with immature and injured Schwann cell phenotypes. Non-myelinating and regenerating populations of Schwann cells require Cx32 for normal axonal maintenance and the re-myelination, and regeneration of peripheral nerve following injury. Dysregulation of Schwann cell–axonal communication in Cx32KO mice contributes to the disruption of the immune response and differentiation pathways that are essential for successful nerve regeneration following injury and for the maintenance of normal intact peripheral nerves. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.expneurol.2014.10.014.

This work was supported by grants from Muscular Dystrophy 704 Association and NINDS (5R01NS050705-06) awarded to CKA. 705 Q9

E

626 627

T

624 625

C

622 623

E

620 621

R

619

R

617 618

N C O

615 616

phenotypes or an inability to properly respond to the injury. Examination of WT responses to injury followed predicted patterns with, significant increases in c-Jun at 5dpi relative to uninjured WT. p75NGFR is a marker for immature or non-myelinating Schwann cells and is co-localized with c-Jun following nerve injury (Fontana et al., 2012). We found an increased expression of p75NGFR in uninjured and 14dpi Cx32KO nerves relative to WT, further supporting the conclusion that Cx32KO Schwann cells display a basal immature or injured phenotype. These findings are consistent with recent reports showing increased immunolabeling for p75NGFR in non-myelinating and supernumerary Schwann cells in three CMT1 mouse models (Guenard et al., 1996; Klein et al., 2014). The effects of p75NGFR on Schwann cells after injury are complex as p75NGFR has roles in both Schwann cell apoptosis (Syroid et al., 2000) and myelination, depending on ligand presentation and intracellular binding partners (Cosgaya et al., 2002; Provenzano et al., 2008; Teng et al., 2005; Tep et al., 2012). Signaling through p75NGFR can lead to activation of c-Jun-dependent downstream signaling pathways to regulate Schwann cell survival and differentiation (Lindwall Blom et al., 2014; Shin et al., 2013; Yeiser et al., 2004). Interestingly, c-Fos, which forms the AP1 transcription factor complex with c-Jun, was significantly upregulated in uninjured and 14dpi Cx32KO nerves, relative to WT. Divergent classes of differentially regulated genes in uninjured and injured Cx32KO nerves are associated with the p75NGFR and c-Jun signaling pathways, as illustrated in IPA networks in Supplementary Figs. 2, 3, and 4. That loss of Cx32 influences expression of these major markers of Schwann cell differentiation, suggests Cx32 plays an important role in modulating expression of mature Schwann cell phenotype. Wallerian degeneration is an innate immune response to peripheral nerve injury in which rapid release of pro-inflammatory cytokines by Schwann cells induces macrophage recruitment and activation to the site of injury. Macrophage-mediated cytokine and chemokine production contributes further to the molecular and cellular events in injured peripheral nerves during the later phases of Wallerian degeneration (Cheepudomwit et al., 2008; Li et al., 2013). Mice with the delayed Wallerian degeneration (WldS) mutation have a slower break down of distal axons for weeks after injury (Barrette et al., 2010). Nerve injury triggers increased differential expression of genes associated with axonal degeneration, inflammation, immune response, and growth factors/cytokines their receptors in WT as compared to WldS mice (Barrette et al., 2010). Interestingly, many of these same immune response genes and biological processes were upregulated or enriched in uninjured and 14 dpi Cx32KO nerves (relative to WT), further supporting that loss of Cx32 promotes a shift toward a gene expression profile resembling an injured or de-differentiated repair of WT Schwann cell. Mutations in GJB1 encoding Cx32 cause CMT1X. However, the cellular mechanisms underlying disruption of functional Cx32 and the demyelinating axonal pathology associated with CMT1X are not understood. More than 300 mutations in GJB1 have been identified, affecting all regions of the Cx32 protein. Loss-of-function GJB1/CMT1X mutations abolish Cx32 protein expression or limit production of functional Cx32 channels (Braathen, 2012; Ionasescu et al., 1996; Scherer et al., 1999) and appear to cause a similar degree of neuropathy. Moreover, studies examining GJB1/CMTX mutants that are associated with less severe disease pathology support partial loss-of-function with alterations in protein trafficking and biophysical changes in Cx32 channel properties (Scherer and Kleopa, 2012). These findings address the effects of GJB1/ CMT1X mutations on Cx32 gap junction activity in mature myelinating Schwann cells, but fail to fully account for disruption of Cx32 function in non-myelinating, regenerating or immature Schwann cells. Axonal pathology secondary to demyelination is a feature of CMT1X. As demonstrated in transplant models in which human nerve segments are transplanted into sciatic nerves of nude mice, mouse axons regenerate into the transplanted segments and are re-myelinated by the human Schwann cells from the graft. Nerve grafts from patients with CMT1X

U

613 614

9

References

706

Abrams, C.K., Bennett, M.V.L., 2000. Hereditary Human Diseases caused by connexin mutations. In: Peracchia, C. (Ed.), Gap Junctions — Molecular Basis of Cell Communication in Health and Disease. Academic Press. Abrams, C.K., Rash, J.E., 2009. Connexins in the nervous system. In: Harris, A.L., Locke, D. (Eds.), Connexins: A Guide. Humana Press, pp. 323–358. Abrams, C.K., Freidin, M., Bukauskas, F., Dobrenis, K., Bargiello, T.A., Verselis, V.K., Bennett, M.V., Chen, L., Sahenk, Z., 2003. Pathogenesis of X-linked Charcot–Marie–Tooth disease: differential effects of two mutations in connexin 32. J. Neurosci. 23, 10548–10558. Allodi, I., Udina, E., Navarro, X., 2012. Specificity of peripheral nerve regeneration: interactions at the axon level. Prog. Neurobiol. 98, 16–37. Anzini, P., Neuberg, D.H., Schachner, M., Nelles, E., Willecke, K., Zielasek, J., Toyka, K.V., Suter, U., Martini, R., 1997. Structural abnormalities and deficient maintenance of peripheral nerve myelin in mice lacking the gap junction protein connexin 32. J. Neurosci. 17, 4545–4551. Arthur-Farraj, P.J., Latouche, M., Wilton, D.K., Quintes, S., Chabrol, E., Banerjee, A., Woodhoo, A., Jenkins, B., Rahman, M., Turmaine, M., Wicher, G.K., Mitter, R., Greensmith, L., Behrens, A., Raivich, G., Mirsky, R., Jessen, K.R., 2012. c-Jun reprograms Schwann cells of injured nerves to generate a repair cell essential for regeneration. Neuron 75, 633–647. Balice-Gordon, R.J., Bone, L.J., Scherer, S.S., 1998. Functional gap junctions in the Schwann cell myelin sheath. J. Cell Biol. 142, 1095–1104. Barrette, B., Calvo, E., Vallieres, N., Lacroix, S., 2010. Transcriptional profiling of the injured sciatic nerve of mice carrying the Wld(S) mutant gene: identification of genes involved in neuroprotection, neuroinflammation, and nerve regeneration. Brain Behav. Immun. 24, 1254–1267. Benjamini, Y., Hochberg, Y., 1995. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B Methodol. 57, 289–300. Blake, J.A., Bult, C.J., Eppig, J.T., Kadin, J.A., Richardson, J.E., Mouse Genome Database, G., 2014. The Mouse Genome Database: integration of and access to knowledge about the laboratory mouse. Nucleic Acids Res. 42, D810–D817. Bolin, L.M., Shooter, E.M., 1993. Neurons regulate Schwann cell genes by diffusible molecules. J. Cell Biol. 123, 237–243. Bondurand, N., Girard, M., Pingault, V., Lemort, N., Dubourg, O., Goossens, M., 2001. Human Connexin 32, a gap junction protein altered in the X-linked form of Charcot–Marie–Tooth disease, is directly regulated by the transcription factor SOX10. Hum. Mol. Genet. 10, 2783–2795. Braathen, G.J., 2012. Genetic epidemiology of Charcot–Marie–Tooth disease. Acta Neurol. Scand. Suppl. iv-22. Brazma, A., 2009. Minimum Information About a Microarray Experiment (MIAME) — successes, failures, challenges. ScientificWorldJournal 9, 420–423. Breuer, K., Foroushani, A.K., Laird, M.R., Chen, C., Sribnaia, A., Lo, R., Winsor, G.L., Hancock, R.E., Brinkman, F.S., Lynn, D.J., 2013. InnateDB: systems biology of innate immunity and beyond—recent updates and continuing curation. Nucleic Acids Res. 41, D1228–D1233.

707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750


D

P

R O

O

F

Nicolino, S., Panetto, A., Raimondo, S., Gambarotta, G., Guzzini, M., Fornaro, M., Battiston, B., Tos, P., Geuna, S., Perroteau, I., 2009. Denervation and reinnervation of adult skeletal muscle modulate mRNA expression of neuregulin-1 and ErbB receptors. Microsurgery 29, 464–472. Noble, W.S., 2009. How does multiple testing correction work? Nat. Biotechnol. 27, 1135–1137. Omori, Y., Li, Q., Nishikawa, Y., Yoshioka, T., Yoshida, M., Nishimura, T., Enomoto, K., 2007. Pathological significance of intracytoplasmic connexin proteins: implication in tumor progression. J. Membr. Biol. 218, 73–77. Parkinson, D.B., Bhaskaran, A., Arthur-Farraj, P., Noon, L.A., Woodhoo, A., Lloyd, A.C., Feltri, M.L., Wrabetz, L., Behrens, A., Mirsky, R., Jessen, K.R., 2008. c-Jun is a negative regulator of myelination. J. Cell Biol. 181, 625–637. Patodia, S., Raivich, G., 2012. Downstream effector molecules in successful peripheral nerve regeneration. Cell Tissue Res. 349, 15–26. Pham, K., Nassiri, N., Gupta, R., 2009. c-Jun, krox-20, and integrin beta4 expression following chronic nerve compression injury. Neurosci. Lett. 465, 194–198. Pineau, I., Lacroix, S., 2009. Endogenous signals initiating inflammation in the injured nervous system. Glia 57, 351–361. Provenzano, M.J., Xu, N., Ver Meer, M.R., Clark, J.J., Hansen, M.R., 2008. p75NTR and sortilin increase after facial nerve injury. Laryngoscope 118, 87–93. Sahenk, Z., Chen, L., 1998. Abnormalities in the axonal cytoskeleton induced by a connexin32 mutation in nerve xenografts. J. Neurosci. Res. 51, 174–184. Sargiannidou, I., Vavlitou, N., Aristodemou, S., Hadjisavvas, A., Kyriacou, K., Scherer, S.S., Kleopa, K.A., 2009. Connexin32 mutations cause loss of function in Schwann cells and oligodendrocytes leading to PNS and CNS myelination defects. J. Neurosci. 29, 4736–4749. Scherer, S.S., Kleopa, K.A., 2012. X-linked Charcot–Marie–Tooth disease. J. Peripher. Nerv. Syst. 17 (Suppl. 3), 9–13. Scherer, S.S., Deschenes, S.M., Xu, Y.T., Grinspan, J.B., Fischbeck, K.H., Paul, D.L., 1995. Connexin32 is a myelin-related protein in the PNS and CNS. J. Neurosci. 15, 8281–8294. Scherer, S.S., Xu, Y.T., Nelles, E., Fischbeck, K., Willecke, K., Bone, L.J., 1998. Connexin32null mice develop demyelinating peripheral neuropathy. Glia 24, 8–20. Scherer, S.S., Bone, L.J., Deschenes, S.M., Abel, A., Balice-Gordon, R.J., Fischbeck, K.H., 1999. The role of the gap junction protein connexin32 in the pathogenesis of X-linked Charcot-Marie-Tooth disease. Novartis Found. Symp. 219, 175–185 [discussion 185–177]. Shin, Y.K., Jang, S.Y., Park, J.Y., Park, S.Y., Lee, H.J., Suh, D.J., Park, H.T., 2013. The Neuregulin-Rac-MKK7 pathway regulates antagonistic c-jun/Krox20 expression in Schwann cell dedifferentiation. Glia 61, 892–904. Shy, M.E., Shi, Y., Wrabetz, L., Kamholz, J., Scherer, S.S., 1996. Axon-Schwann cell interactions regulate the expression of c-jun in Schwann cells. J. Neurosci. Res. 43, 511–525. Soares, H.D., Chen, S.C., Morgan, J.I., 2001. Differential and prolonged expression of FoslacZ and Jun-lacZ in neurons, glia, and muscle following sciatic nerve damage. Exp. Neurol. 167, 1–14. Sohl, G., Gillen, C., Bosse, F., Gleichmann, M., Muller, H.W., Willecke, K., 1996. A second alternative transcript of the gap junction gene connexin32 is expressed in murine Schwann cells and modulated in injured sciatic nerve. Eur. J. Cell Biol. 69, 267–275. Stassart, R.M., Fledrich, R., Velanac, V., Brinkmann, B.G., Schwab, M.H., Meijer, D., Sereda, M.W., Nave, K.A., 2013. A role for Schwann cell-derived neuregulin-1 in remyelination. Nat. Neurosci. 16, 48–54. Stewart, H.J., 1995. Expression of c-Jun, Jun B, Jun D and cAMP response element binding protein by Schwann cells and their precursors in vivo and in vitro. Eur. J. Neurosci. 7, 1366–1375. Svaren, J., Meijer, D., 2008. The molecular machinery of myelin gene transcription in Schwann cells. Glia 56, 1541–1551. Syroid, D.E., Maycox, P.J., Soilu-Hanninen, M., Petratos, S., Bucci, T., Burrola, P., Murray, S., Cheema, S., Lee, K.F., Lemke, G., Kilpatrick, T.J., 2000. Induction of postnatal schwann cell death by the low-affinity neurotrophin receptor in vitro and after axotomy. J. Neurosci. 20, 5741–5747. Ten Asbroek, A.L., Van Ruissen, F., Ruijter, J.M., Baas, F., 2006. Comparison of Schwann cell and sciatic nerve transcriptomes indicates that mouse is a valid model for the human peripheral nervous system. J. Neurosci. Res. 84, 542–552. Teng, H.K., Teng, K.K., Lee, R., Wright, S., Tevar, S., Almeida, R.D., Kermani, P., Torkin, R., Chen, Z.Y., Lee, F.S., Kraemer, R.T., Nykjaer, A., Hempstead, B.L., 2005. ProBDNF induces neuronal apoptosis via activation of a receptor complex of p75NTR and sortilin. J. Neurosci. 25, 5455–5463. Tep, C., Kim, M.L., Opincariu, L.I., Limpert, A.S., Chan, J.R., Appel, B., Carter, B.D., Yoon, S.O., 2012. Brain-derived neurotrophic factor (BDNF) induces polarized signaling of small GTPase (Rac1) protein at the onset of Schwann cell myelination through partitioningdefective 3 (Par3) protein. J. Biol. Chem. 287, 1600–1608. Tomita, K., Kubo, T., Matsuda, K., Fujiwara, T., Yano, K., Winograd, J.M., Tohyama, M., Hosokawa, K., 2007. The neurotrophin receptor p75NTR in Schwann cells is implicated in remyelination and motor recovery after peripheral nerve injury. Glia 55, 1199–1208. Vavlitou, N., Sargiannidou, I., Markoullis, K., Kyriacou, K., Scherer, S.S., Kleopa, K.A., 2010. Axonal pathology precedes demyelination in a mouse model of X-linked demyelinating/ type I Charcot–Marie–Tooth neuropathy. J. Neuropathol. Exp. Neurol. 69, 945–958. Vinken, M., Decrock, E., De Vuyst, E., Ponsaerts, R., D'Hondt, C., Bultynck, G., Ceelen, L., Vanhaecke, T., Leybaert, L., Rogiers, V., 2011. Connexins: sensors and regulators of cell cycling. Biochim. Biophys. Acta 1815, 13–25. Yang, D.P., Kim, J., Syed, N., Tung, Y.J., Bhaskaran, A., Mindos, T., Mirsky, R., Jessen, K.R., Maurel, P., Parkinson, D.B., Kim, H.A., 2012. p38 MAPK activation promotes denervated Schwann cell phenotype and functions as a negative regulator of Schwann cell differentiation and myelination. J. Neurosci. 32, 7158–7168.

N

C

O

R

R

E

C

T

Camara-Lemarroy, C.R., Guzman-de la Garza, F.J., Fernandez-Garza, N.E., 2010. Molecular inflammatory mediators in peripheral nerve degeneration and regeneration. Neuroimmunomodulation 17, 314–324. Canclini, L., Wallrabe, H., Di Paolo, A., Kun, A., Calliari, A., Sotelo-Silveira, J.R., Sotelo, J.R., 2013. Association of myosin Va and Schwann cells-derived RNA in mammal myelinated axons, analyzed by immunocytochemistry and confocal FRET microscopy. Methods San Diego Calif. Chang, H.M., Shyu, M.K., Tseng, G.F., Liu, C.H., Chang, H.S., Lan, C.T., Hsu, W.M., Liao, W.C., 2013. Neuregulin facilitates nerve regeneration by speeding Schwann cell migration via ErbB2/3-dependent FAK pathway. PLoS ONE 8, e53444. Cheepudomwit, T., Guzelsu, E., Zhou, C., Griffin, J.W., Hoke, A., 2008. Comparison of cytokine expression profile during Wallerian degeneration of myelinated and unmyelinated peripheral axons. Neurosci. Lett. 430, 230–235. Comerford, I., McColl, S.R., 2011. Mini-review series: focus on chemokines. Immunol. Cell Biol. 89, 183–184. Cosgaya, J.M., Chan, J.R., Shooter, E.M., 2002. The neurotrophin receptor p75NTR as a positive modulator of myelination. Science 298, 1245–1248. Dubovy, P., Jancalek, R., Kubek, T., 2013. Role of inflammation and cytokines in peripheral nerve regeneration. Int. Rev. Neurobiol. 108, 173–206. Fontana, X., Hristova, M., Da Costa, C., Patodia, S., Thei, L., Makwana, M., Spencer-Dene, B., Latouche, M., Mirsky, R., Jessen, K.R., Klein, R., Raivich, G., Behrens, A., 2012. c-Jun in Schwann cells promotes axonal regeneration and motoneuron survival via paracrine signaling. J. Cell Biol. 198, 127–141. Freidin, M., Asche, S., Bargiello, T.A., Bennett, M.V., Abrams, C.K., 2009. Connexin 32 increases the proliferative response of Schwann cells to neuregulin-1 (Nrg1). Proc. Natl. Acad. Sci. U. S. A. 106, 3567–3572. Fricker, F.R., Lago, N., Balarajah, S., Tsantoulas, C., Tanna, S., Zhu, N., Fageiry, S.K., Jenkins, M., Garratt, A.N., Birchmeier, C., Bennett, D.L., 2011. Axonally derived neuregulin-1 is required for remyelination and regeneration after nerve injury in adulthood. J. Neurosci. 31, 3225–3233. Guenard, V., Montag, D., Schachner, M., Martini, R., 1996. Onion bulb cells in mice deficient for myelin genes share molecular properties with immature, differentiated non-myelinating, and denervated Schwann cells. Glia 18, 27–38. Hall, S.M., Li, H., Kent, A.P., 1997. Schwann cells responding to primary demyelination in vivo express p75NTR and c-erbB receptors: a light and electron immunohistochemical study. J. Neurocytol. 26, 679–690. Hochberg, Y., Benjamini, Y., 1990. More powerful procedures for multiple significance testing. Stat. Med. 9, 811–818. Iacobas, D.A., Iacobas, S., Spray, D.C., 2007. Connexin-dependent transcellular transcriptomic networks in mouse brain. Prog. Biophys. Mol. Biol. 94, 169–185. Ionasescu, V.V., 1995. Charcot–Marie–Tooth neuropathies: from clinical description to molecular genetics. Muscle Nerve 18, 267–275. Ionasescu, V., Ionasescu, R., Searby, C., 1996. Correlation between connexin 32 gene mutations and clinical phenotype in X-linked dominant Charcot–Marie–Tooth neuropathy. Am. J. Med. Genet. 63, 486–491. Jessen, K.R., Mirsky, R., 2008. Negative regulation of myelination: relevance for development, injury, and demyelinating disease. Glia 56, 1552–1565. Kanehisa, M., Goto, S., Sato, Y., Furumichi, M., Tanabe, M., 2012. KEGG for integration and interpretation of large-scale molecular data sets. Nucleic Acids Res. 40, D109–D114. Kar, R., Batra, N., Riquelme, M.A., Jiang, J.X., 2012. Biological role of connexin intercellular channels and hemichannels. Arch. Biochem. Biophys. Klein, D., Groh, J., Wettmarshausen, J., Martini, R., 2014. Nonuniform molecular features of myelinating Schwann cells in models for CMT1: distinct disease patterns are associated with NCAM and c-Jun upregulation. Glia 62, 736–750. Kumar, N.M., Gilula, N.B., 1996. The gap junction communication channel. Cell 84, 381–388. Kury, P., Greiner-Petter, R., Cornely, C., Jurgens, T., Muller, H.W., 2002. Mammalian achaete scute homolog 2 is expressed in the adult sciatic nerve and regulates the expression of Krox24, Mob-1, CXCR4, and p57kip2 in Schwann cells. J. Neurosci. 22, 7586–7595. Li, M., Guo, W., Zhang, P., Li, H., Gu, X., Yao, D., 2013. Signal flow and pathways in response to early Wallerian degeneration after rat sciatic nerve injury. Neurosci. Lett. 536, 56–63. Lin, J.H., Yang, J., Liu, S., Takano, T., Wang, X., Gao, Q., Willecke, K., Nedergaard, M., 2003. Connexin mediates gap junction-independent resistance to cellular injury. J. Neurosci. 23, 430–441. Lindwall Blom, C., Martensson, L.B., Dahlin, L.B., 2014. Nerve injury-induced c-Jun activation in Schwann cells is JNK independent. BioMed. Res. Int. 2014, 392971. Lynn, D.J., Winsor, G.L., Chan, C., Richard, N., Laird, M.R., Barsky, A., Gardy, J.L., Roche, F.M., Chan, T.H., Shah, N., Lo, R., Naseer, M., Que, J., Yau, M., Acab, M., Tulpan, D., Whiteside, M.D., Chikatamarla, A., Mah, B., Munzner, T., Hokamp, K., Hancock, R.E., Brinkman, F.S., 2008. InnateDB: facilitating systems-level analyses of the mammalian innate immune response. Mol. Syst. Biol. 4, 218. Mambetisaeva, E.T., Gire, V., Evans, W.H., 1999. Multiple connexin expression in peripheral nerve, Schwann cells, and Schwannoma cells. J. Neurosci. Res. 57, 166–175. Mandemakers, W., Zwart, R., Jaegle, M., Walbeehm, E., Visser, P., Grosveld, F., Meijer, D., 2000. A distal Schwann cell-specific enhancer mediates axonal regulation of the Oct-6 transcription factor during peripheral nerve development and regeneration. EMBO J. 19, 2992–3003. Mirsky, R., Woodhoo, A., Parkinson, D.B., Arthur-Farraj, P., Bhaskaran, A., Jessen, K.R., 2008. Novel signals controlling embryonic Schwann cell development, myelination and dedifferentiation. J. Peripher. Nerv. Syst. 13, 122–135. Mukhatyar, V., Pai, B., Clements, I., Srinivasan, A., Huber, R., Mehta, A., Mukhopadaya, S., Rudra, S., Patel, G., Karumbaiah, L., Bellamkonda, R., 2013. Molecular sequelae of topographically guided peripheral nerve repair. Ann. Biomed. Eng. Nagarajan, R., Le, N., Mahoney, H., Araki, T., Milbrandt, J., 2002. Deciphering peripheral nerve myelination by using Schwann cell expression profiling. Proc. Natl. Acad. Sci. U. S. A. 99, 8998–9003.

U

751 752 753 754 755 756 757 Q10 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 Q11 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 Q12 834 835 836


E

10


837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922


Zeeberg, B., Qin, H., Narasimhan, S., Sunshine, M., Cao, H., Kane, D., Reimers, M., Stephens, R., Bryant, D., Burt, S., Elnekave, E., Hari, D., Wynn, T., Cunningham-Rundles, C., Stewart, D., Nelson, D., Weinstein, J., 2005. High-throughput GoMiner, an ‘industrialstrength’ integrative gene ontology tool for interpretation of multiple-microarray experiments, with application to studies of Common Variable Immune Deficiency (CVID). BMC Bioinforma. 6, 168. Zhou, X.F., Li, H.Y., 2007. Roles of glial p75NTR in axonal regeneration. J. Neurosci. Res. 85, 1601–1605.

N C O

R

R

E

C

T

E

D

P

R O

O

F

Yeiser, E.C., Rutkoski, N.J., Naito, A., Inoue, J., Carter, B.D., 2004. Neurotrophin signaling through the p75 receptor is deficient in traf6–/– mice. J. Neurosci. 24, 10521–10529. Yiu, E.M., Geevasinga, N., Nicholson, G.A., Fagan, E.R., Ryan, M.M., Ouvrier, R.A., 2011. A retrospective review of X-linked Charcot–Marie–Tooth disease in childhood. Neurology 76, 461–466. Zeeberg, B., Feng, W., Wang, G., Wang, M., Fojo, A., Sunshine, M., Narasimhan, S., Kane, D., Reinhold, W., Lababidi, S., Bussey, K., Riss, J., Barrett, J., Weinstein, J., 2003. GoMiner: a resource for biological interpretation of genomic and proteomic data. Genome Biol. 4, R28.

U

923 924 925 926 927 928 929 930

11


931 932 933 934 935 936 937 938

Synaptoid profiles in regenerating crustacean peripheral nerves.

Amniotic mesenchymal stem cells display neurovascular tropism and aid in the recovery of injured peripheral nerves.

Microsurgery of peripheral nerves.

Retrograde factors in peripheral nerves.

Are there somatostatin-containing nerves in the rat gut? Immunohistochemical evidence for a new type of peripheral nerves.

Autograft suture in peripheral nerves.

Iatrogenic lesions of peripheral nerves.

Noninvasive imaging of peripheral nerves.

Gunshot Wounds of Peripheral Nerves.

Advanced imaging of peripheral nerves.

Properties of tyrosine hydroxylase in peripheral nerves.

In vitro and in vivo optimization of infrared laser treatment for injured peripheral nerves.

Rerouting peripheral nerves for spinal cord lesions.

Normal and sonographic anatomy of selected peripheral nerves. Part II: Peripheral nerves of the upper limb.

Introduction of a New Suture Method in Repair of Peripheral Nerves Injured with a Sharp Mechanism.

Progenitors in Peripheral Nerves Launch Heterotopic Ossification.

Carboxypeptidase M in brain and peripheral nerves.

The repair Schwann cell and its function in regenerating nerves.

Fiber counts of regenerating peripheral nerves in axolotls and the effect of metamorphosis.

Retrograde axonal transport of rapidly migrating labelled proteins and glycoproteins in regenerating peripheral nerves.

The effect of triiodothyronine on axonal transport in regenerating peripheral nerves.

Regeneration of peripheral nerves after injury.

Peripheral development of avian trigeminal nerves.

Diffusion tensor imaging of peripheral nerves.