Transgenic Res DOI 10.1007/s11248-014-9835-7
BRIEF COMMUNICATION
Generation of bi-transgenic pigs overexpressing human lactoferrin and lysozyme in milk Dan Cui • Jia Li • Linlin Zhang • Shen Liu Xiao Wen • Qiuyan Li • Yaofeng Zhao • Xiaoxiang Hu • Ran Zhang • Ning Li
•
Received: 11 March 2014 / Accepted: 6 September 2014 Ó Springer International Publishing Switzerland 2014
Abstract Intensive swine production industry uses antibiotics to treat diseases and improve pig growth. This can not only cause antibiotic resistance, but can also pollute the environment or eventually affect human public health. To date, human lactoferrin (hLF) and human lysozyme (hLZ) have been known as nonadaptive but interactive antimicrobial members and could act in concert against bacteria, which contribute to host defense. Therefore, their expression in pigs might be an alternative strategy for replacing antibiotics in the pig production industry. In our study, we produced hLF and hLZ bi-transgenic pigs and assessed the milk’s antibacterial ability. Integration of both transgenes was confirmed by PCR and southern blot. Both the hLF and hLZ were expressed in the mammary gland of bi-transgenic pigs, as detected by western blotting. The expression amounts were 6.5 g/L for hLF and 1.1 mg/L for hLZ using ELISA. Interestingly, pig milk containing hLF and hLZ had synergistic antimicrobial activity. Our results
D. Cui J. Li L. Zhang Y. Zhao X. Hu R. Zhang N. Li (&) State Key Laboratory for Agrobiotechnology, China Agricultural University, Beijing 100193, People’s Republic of China e-mail: [email protected] S. Liu X. Wen Q. Li GenProtein Biotech Ltd., Beijing 100193, People’s Republic of China
suggest an alternative approach for avoiding the use of antibiotics in the pig industry, which would be of great benefit to the commercial swine production. Keywords Human lactoferrin Human lysozyme Bi-transgenic Pig
Introduction Pork, which is mainly supplied by China, USA, and the European Union, is the world’s most widely consumed meat accounting for more than half of the meat consumption. With the global population and economy growth, the intensive swine production industry has been employed to meet the global demand for a faster and larger growth of pigs. However, this type of production also brings problems related to the potential for rapid spread of diseases, which includes respiratory disease, pneumonia, enteric diseases, and diarrhea. These will finally result in serious economic losses, poor performance of pig growth and carcass composition (Fairbrother et al. 2005; Coker et al. 2011). Traditionally, producers, veterinarians and other food chain participants utilize antibiotics to treat illness and protect pigs from being attacked by diseases as well as to promote growth (Addison 1984; McEwen and Fedorka-Cray 2002). Nonetheless, the use of antibiotics not only cause antibiotic resistance to microorganisms but also pollute the
123
Transgenic Res
environment by disseminating from pig’s feces and urine, which would exert unprecedented effects on human public health (Barton 2000). Thus, the breeding of pigs with better growth performance and disease resistance is critical in pig production industry when taken economical, ethical, human health and animal welfare issues into consideration. Researchers seek alternative strategies after banning of antibiotics as a growth promoter in pig industries in the European Union in 2006. Some of the researchers change the nutritional composition for post-weaning colibacillosis (PWC) that caused by Escherichia coli specifically affecting the small intestine at the first 3–10 days after weaning (Pluske et al. 2002). Additionally, the application of transgenic technologies to improve the growth performance and disease resistance is another promising measure for newborn piglets (Weidle et al. 1991; Muller et al. 1992). Lactoferrin (LF) and lysozyme (LZ) are non-adaptive but interactive antimicrobial members with a high level of expression in human milk, which are considered as the two most important candidate genes for transgenic animal production. Both proteins expressed by the genes might contribute to host defense, protecting the newborns from being attacked by a large number of pathogens. Lactoferrin (LF), which is an 80 kDa iron-binding glycoprotein of the transferrin family, was first described in bovine milk in 1939 and later was isolated from human milk in 1960 (Groves 1960; Johannson 1960). This protein is mainly found in the gateways of exocrine glands such as the digestive, respiratory and reproductive systems, which indicates its primary role involved in defending against invading pathogens in a non-specific manner (Lonnerdal 2003). LF is responsible for a multitude of physiological functions (Sanchez et al. 1992; Brock 1995; Lonnerdal and Iyer 1995; Levay and Viljoen 1995; Steijns and van Hooijdonk 2000; Brock 2012), such as regulation of iron homeostasis (Tang et al. 2010), bacteriostatic or bactericidal effects, as well as other functions relevant to immune modulation (Shau et al. 1992; Zimecki et al. 1995; Brock 2002; Ward et al. 2002; Spadaro et al. 2008). Lysozyme (LZ) is a hydrolytic enzyme discovered by Fleming in 1921. It has antimicrobial function by cleaving the b-(1,4)glycosidic bond between N-acetylmuramic acid and N-acetylglucosamine in peptidoglycan and subse-
123
quently causing bacterial cell wall lyse (Salton 1957; Mir 1977; Callewaert and Michiels 2010). Therefore, gram-positive bacteria containing N-acetylmuramic acid and N-acetylglucosamine in its cell wall are much more susceptible to LZ than gram-negative bacteria. The antimicrobial activity of lysozyme has been extensively studied in vitro and in vivo including milk, blood serum, saliva and lungs (Carroll 1980; Lee-Huang et al. 1999; Sexton et al. 1996). In addition, accumulating evidence reveals that human lysozyme (hLZ) expressed in transgenic mice and pigs has antimicrobial activity (Maga et al. 1998; Brundige et al. 2008; Cooper et al. 2011, 2013). Previous studies show that both of the defense factors interact with each other (Soukka et al. 1991) and enhance the antimicrobial effect. Richard et al. demonstrated that LF could enhance the killing effect of LZ on gram-negative bacteria (Ellison et al. 1991). LF and LZ also have synergic properties for a type of gram-positive bacteria known as S. epidermidis isolates (Leitch and Willcox 1998). In addition, Soukka and Samaranayake demonstrated that LZ and apo-LF exhibit an enhanced bacteria activity against Streptococcus mutants (serotype c) and Candida isolates (Soukka et al. 1991; Samaranayake et al. 2001). Thus, these lead us to speculate that with a high level expression of human lactoferrin (hLF) and hLZ should be an alternative strategy to improve disease resistance. hLF expressed in transgenic mice with high expression level up to 8 g/L have been obtained in our previous work (Liu et al. 2004) and later hLF transgenic cow have been cloned by SCNT (3.4 g/L) (Yang et al. 2008). Another work by Liu et al. (2012) in our group used a modified hLZ vector to generate transgenic mice that could efficiently express hLZ in its milk. These previous results shed light on the production hLF and hLZ bi-transgenic pigs with enhanced ability of disease resistance. Here we report the generation of the hLF and hLZ bi-transgenic pigs. The expression of hLF was up to 6.5 g/L, while the expression of hLZ was relatively low at 1.1 mg/L in milk of transgenic pig. Intriguingly, the hLF and hLZ in the milk of transgenic pigs had the co-operative bacteriostatic activity to M. lysodeikticus even with such a relative low level of hLZ. Our results suggest a potential alternative strategy for the improvement of disease resistance in the pig industry.
Transgenic Res
Materials and methods Construction of the hLF BAC and pBAC-hLFhLZ-Neo BAC containing the entire hLF genomic sequence was purified by a large-construct kit (Qiagen, Germany). pBAC-hLF-hLZ-Neo constructed by Liu (Liu et al. 2012) was purified in the same way.
finally held at 72 °C for 7 min. The amplified products were 1,961 bp, 1,581 bp and 533 bp respectively. The primers for hLZ were: hLZ-F: TGCTGG GTGCCTGAGATTCA and hLZ-R: AGTTCA AAATGG GAAATAACTGG. PCR was performed under followed conditions: 94 °C for 5 min, 30 cycles at 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s, and 72 °C for 7 min. The product was 120 bp. Southern blotting
Generation of transgenic pig Approximately 1 9 106 fetal fibroblasts were transfected with 4–5 lg of each hLF BAC and pBAC-hLFhLZ-Neo vectors. After 24 h, the cells were transferred to six 10-cm plates with selective medium containing G418 (500 lg/mL, Promega). The selection process lasted nearly 10 days. Resistant clones were collected using of cloning cylinder (Sigma, USA) and transferred to 24-well plates. After 48 h, sub-confluent cells were harvested. Half of the cells were subjected to genotyping, and the rest were cryopreserved in liquid nitrogen. After identifying the positive clone, somatic cell nuclear transfer (SCNT) was conducted as described using the cells cryopreserved (Zhang et al. 2006; Wei et al. 2009). Each of the surrogate sows received 300 embryos. Pregnancy was determined by abdominal ultrasound examination 1 month after the SCNT. Approximately 110 days later, piglets were delivered by natural birth. All procedures were guaranteed by animal welfare following instructions approved by the China Council on Animal Care and Protocols. Genotyping of transgenic pig Genomic DNA was prepared from ear tissues using the phenol method. Three pairs of hLF BAC specific primers and one pair of hLZ gene specific primers were used to identify the transgenic pigs. The primers for hLF are as follows: hLF-50 -F: TGCTTTGTT TGTATTGAGGGTC and hLF-50 -R: CCAGGAAC AAACTTACGGAG; hLF-30 -F: TTCCTTCCACCAC TGTTGAG and hLF-30 -R: CAAATACCTCT GCCGCTGTT; hLF-CDS-F: AGGACACAGACAG CAGACAC and hLF-CDS-R: CAGCCCTCTTCT TCCTCTTC. PCR reactions were: 94 °C for 5 min, 30 cycles at 94 °C for 30 s, 60.6 °C for 30 s, then 72 °C for 2 min, 1 min 40 s, 45 s, respectively, and
Genomic DNA was extracted from ear tissues using phenol method. Ten micrograms of DNA for each pig were digested with EcoR I overnight to detect hLF BAC gene. Then the digested products were separated on a 0.8 % agarose gel and transferred to Hybond TMN? membrane (Amersham, Piscataway, NJ) and hybridized with a 710 bp hLF BAC specific probe that was produced by PCR using hLF BAC as a template and a PCR reaction mixture containing DIGdUTP. Similarly, 10 lg of DNA for each pig were digested by EcoR I overnight to detect hLZ gene according to a protocol in previous research (Liu et al. 2012). Quantitative real-time PCR (qRT-PCR) and copy number calculation Ear tissues were used for DNA isolation as described in southern blot. Primers for qRT-PCR were designed using Primer Express software (ABI). The primers for hLF were hLF-F: GGAAGTCTACGGGACCGAA AGA and hLF-R: CACAGCCACGGCATAATAGT GAG. The primers for hLZ were: hLZ-F: TGC TGGGTGCCTGAGATTCA and hLZ-R: AGTTCAA AATGG GAAATAACTGG. Myostatin (MSTN) was used as internal control and was amplified using MSTN-F: TCTGAGACCCGTCAAGACTCCTA and MSTN-R: TGTCAAGTTTCAGAGATCGGATTC. Each sample was performed in triplicate on LightCycler 480 I (Roche). Copy numbers were calculated as described (Liu et al. 2012). Western blotting Milk from transgenic pigs and wild type pigs were harvested at 3, 6, 9, 12, 15, 18, 21, 24 h, 2, 3, 5, 7 days of lactation. Milk was defatted by centrifugation at 4 °C for 10 min at 4,500 rpm. Milk obtained was
123
Transgenic Res
mixed with loading buffer and then separated on 10 % polyacrylamide tris–glycine gels. Separated proteins were electrophoretically transferred to nitrocellulose membranes (Amersham Pharmacia, UK), blocked with 3 % BSA in TBST at 4 °C for 1 h, and then detected with hLF and hLZ specific primary antibodies (1:100,000 dilution for hLF and 1:5,000 dilution for hLZ; Biological Inc, USA) as described in our previous research (Liu et al. 2004, 2012). Then they were incubated with goat anti-rabbit secondary antibodies (1:10,000 dilution; ZSGB-Bio, China) for 1 h at room temperature, followed by three times wash in TBST. The membranes were subjected to luminolbased chemiluminescence with commercial substrate (Millipore,USA) and Kodak film. Purified hLF from hLF transgenic cow was used as the positive control. In terms of hLZ we chose natural hLZ standard as a positive control.
Enzyme-linked immunosorbent assay (ELISA) Milk from transgenic pigs and its littermate control was subjected to ELISA by the use of quantification kits for hLF (Calbiochem, USA) and hLZ proteins (Biomedical Technologies Inc, USA) according to the manufacturer’s instructions. In order to determine the hLF and hLZ proteins in the milk,we did a dilution of milk in 1:400,000 and 1:100, respectively. Briefly, 100 lL of diluted samples were added to the precoated wells. After the incubation for 1 h and extensively washing, plates were incubated with 100 lL of detection antibody for 1 h, following by washing as above and then 100 lL HRP solution was added, and subsequently colorimetric reaction was developed with the substrate TMB. The absorbance value was measured at 450 nm.
Assessment of the antibacterial activity of transgenic pig milk LB agar-plates containing M. lysodeikticus were used to examine the antibacterial activity of the milk. Sixmm filter papers were plated on to the surface of the plates and 10 lL milk (in tenfolds dilution) were pipetted to it. After 24 h, bacteriostatic activity was assessed from the size of the area of growth inhibition noted around the discs.
123
Assessment of the growth prompting effect of transgenic pig milk The F1 piglets were divided into three groups: bitransgenic positive piglets fed bi-transgenic milk; wild type piglets fed bi-transgenic milk or wild type milk. We weighed each three piglets in each group every 7 days. Statistical analysis The experimental data were analyzed by one-way ANOVA using SPSS 14 software. P value \ 0.05 was considered significant.
Results and discussion Transgenic pigs were produced by somatic cell nuclear transfer (SCNT). Duroc fibroblasts were cotransfected with vectors of hLF BAC and pBAC-hLFhLZ-Neo (Fig. 1a) and then were selected with G418. Among 16 G418-resistant colonies obtained, three (4#, 13#, 16#) of them integrated both of the vectors. Colonies of 13# and 16# that had better quality and viability were chosen to perform SCNT. A total of 2,680 reconstructed embryos were transferred into eight surrogate pig recipients, of which only four surrogate pigs became pregnant. Five piglets were born by the surrogate pig receiving embryos from 13# (No. 1–5) colony and 12 piglets (No. 341–351, 317) were born from 16# colony. Of the 17 piglets produced, three females (No. 1, 3, 5) were found to harbor both the hLF and hLZ transgenes, as evidenced by PCR (Fig. 1b), and were designated as the transgenic founders. Southern blotting was conducted to confirm the presence of the transgenes. With the specific probes for hLF and hLZ, we detected the 2.2 and 3.3 kb bands, respectively (Fig. 1c). These results showed that both transgenes were integrated into the genome of all three transgenic founders. The hLF transgenic inserts were 3.4 ± 0.3 and with regard to hLZ were 2.4 ± 0.8 in each of the transgenic positive pigs using qRT-PCR. No. 1 and No. 3 died at different time points and No. 5 survived until now. No. 5 female founder was mated with a wild type boar. Among the seven offspring that were produced, three of them (one was female and two were male) integrated both transgenes as determined by PCR (data not shown).
Transgenic Res Fig. 1 Generation of hLF and hLZ bi-transgenic pigs. a Schematic presentation of the hLF and hLZ constructs used for microinjection. hLZ BAC sequence replaced the hLF genomic region by homologous recombination in the pBAC-hLF-hLZ-Neo vector. Double-arrow lines stand for the primers for PCR verification or southern blot probes. b PCR detection of transgenic founders. M1, 1 kb DNA ladder; M2, 100 bp DNA ladder; P positive plasmid control, N negative control; The amplified products for hLF 50 , cds, 30 are 1,961 bp, 1,581 bp, 528 bp respectively. The product for hLZ is 120 bp. c Southern blot analysis of transgenic founders. DNA of ear tissues shows the 2.2 kb positive band for hLF and 3.3 kb band for hLZ. 1c, 5c, 10c, plasmid control of different copies of hLF or hLZ; N, a sex and age matched wild-type control
In addition to the identification of transgenic piglets, we also evaluated the expression of the two proteins using western blot and ELISA. Milk was collected from the bi-transgenic pig (No. 5) and its littermate control. We observed a strong band for hLF and a weak band for hLZ according to SDS-PAGE (Fig. 2a). Furthermore, western blot displayed the expected molecular weights (MW) with 80 kDa for hLF and 14.7 kDa for hLZ (Fig. 2b). To determine the expression of both proteins in the bi-transgenic pig, milk collected at different time points was skimmed
and subjected to ELISA. Our results exhibited that the highest expression level for hLF in the pig’s milk reaching to 9.4 g/L on the third day, with an average of 6.5 g/L in the founder line. The expression of hLF is three to four times higher than that found in human milk (1–2 g/L) (Masson and Heremans 1971; Sanchez et al. 1992; Levay and Viljoen 1995). Besides, hLF expressed in the bi-transgenic pig is six to eight times higher compared with that found in pig colostrum (1.1–1.3 g/L). This high expression level of hLF could be attributed to the use of hLF BAC construct that
123
Transgenic Res Fig. 2 Expression of hLF and hLZ in bi-transgenic pig. a SDS-PAGE of 5# transgenic founder at 12 h, 1, 2, 3, 5, 7 days after parturition. b Western blot was performed and samples were detected with specific antibodies for hLF and hLZ at 3 h, 12 h, 1, 2, 3, 5, 7 days after parturition. N milk of non-transgenic pig, hLF purified from transgenic cattle expressing hLF; hLZ natural hLZ standard
contained multiple regulatory elements and specific sequences such as locus control regions (LCR) and matrix-attachment regions (MAR), which probably obviated ‘‘position effect’’ and guaranteed a better performance of an exogenous gene expression (Giraldo and Montoliu 2001). On the contrary to hLF, the expression level of hLZ was relatively low, with an average of 1.1 mg/L. This expression was much lower than that detected in human milk (0.2–0.4 g/L) (Mathur et al. 1990; Hennart et al. 1991; Montagne et al. 1998, 2001). However, hLZ was 17 times higher than the endogenous expression of pig lysozyme in milk (0.065 mg/L). While the relative low level expression of hLZ was likely caused by the low copy number of exogenous gene, but it was still three times higher than our previously established hLZ transgenic pig using pBC1 vectors (Tong et al. 2011). No cross reactions with porcine LF were observed in terms of the western blot and ELISA performed for hLF (data not shown). We performed antibacterial experiments to determine the function of the hLF and hLZ in the milk of bitransgenic pig. Filter papers were placed on the agar plates containing M. lysodeikticus and the anti-
123
bacteria activity was estimated by the transparent zones around them after 24 h incubation at 32 °C. Bitransgenic milk had a small transparent zone and no transparent zone was found with the milk from a nontransgenic pig (Fig. 3a). This indicated that the milk from hLF and hLZ bi-transgenic pig had bacteriostatic effects when compared with control milk. Previous investigators described a similar finding with respect to the antimicrobial effect by the combination of LF and LZ (Ellison et al. 1991; Leitch and Willcox 1998, 1999; Soukka et al. 1991; Samaranayake et al. 2001). There are mainly two mechanisms that could be responsible for their synergetical antimicrobial effect. On the one hand, LF is a highly cationic protein and it has been shown that LF is able to bind the LPS layer of gram-negative bacteria or release lipoteichoic acid from gram-positive bacteria, then neutralizes the negative charge of the cell wall and finally increases the permeability of peptidoglycan to lysozyme, allows to lyse of it (Morse 1965). On the other hand, LF could promote lysozyme to lyse peptidoglycan through removing cations by its metal chelating capacity (Ellison et al. 1988). These might explain why with such a relative low level of hLZ and high level of hLF
Transgenic Res
Fig. 3 Functional analysis of milk obtained from the bitransgenic pig. a Lysoplate assay for lytic activity of the bitransgenic milk against M. lysodeikticus. Small white circles are 6-mm quantitative filter papers spotted with 10 lL milk sample (in tenfolds dilution) and transparent zones around the quantitative filter papers indicate the ability of bacterial lyse. PChLF 8 lg, 8 micrograms hLF purified protein; PChLZ 1 lg, 1
micrograms hLZ natural standard; Control, milk from nontransgenic pig; NC, water. b Weight change (Data were presented as mean ± SD) of piglets before weaning (n = 3 each). One-way ANOVA were used for statistical analysis (spss 14). Neg, wild type control piglets fed wild type milk; TR, bitransgenic piglets fed bi-transgenic milk; TRneg, bi-transgenic negative piglets fed bi-transgenic milk
still had bacteriostatic effect against M. lysodeikticus. Our results also showed that with only high level of LF protein could not exhibit the antimicrobial effect, which was consistent with Humphrey et al. (2002) who reported the combination of 5 % LF and 10 % LZ was more effective to improve intestinal health, while 5 % LF alone would not exert this effect. Similarly, Suzuki et al. (1989) demonstrated that the combination of LZ (80 mg/L) and apo-LF (500 mg/L) could significantly enhance the growth-inhibitory effect against E. coli 0111 and the combination was much more effective than LZ, apo-LF or sat LF alone. The F1 piglets were divided into three groups as described in the materials and methods, and then three piglets were weighed in each group every 7 days to determine the weight change before weaning. The average weight of bi-transgenic milk fed piglets was slight heavier than those fed wild type milk during this period. To assess the physical condition of those pigs, we also measured a variety of markers in routine blood and blood chemistry tests. There were no significant differences found in each group (data not shown). In summary, we reported the production of hLF and hLZ bi-transgenic pig with efficient BAC vectors. The milk of the transgenic pigs had antimicrobial effect in vitro. Our results suggest an alternative approach for antibiotics use in the pig industry. Further studies are needed to improve the expression level of hLZ using
more efficient vectors. In addition, challenging the piglets with bacteria causing disease such as diarrhea would provide more solid evidence for the anti-disease function of the bi-transgenic pig milk. Last but not least, further studies also need to improve the expression of porcine endogenous LF and LZ so as to eliminate the safety concerns of foreign genes’ transgenesis. However, efficient vectors are needed due to the relatively low expression level of porcine LZ (0.065 mg/L) and LF (1.1–1.3 g/L). Acknowledgments We thanked Dr. Jin He, Sergio Ardanza, Amanda Wiinamaki, Priya Rao, and Ashok Rao for critical discussions and reading of the manuscript. This work was supported by National Program of Transgenical Breeding Project of China (Project No. 2013ZX08006).
References Addison JB (1984) Antibiotics in sediments and run-off waters from feedlots. Residue rev 92:1–28 Barton MD (2000) Antibiotic use in animal feed and its impact on human healt. Nutr Res Rev 13(2):279–299. doi:10. 1079/095442200108729106 Britigan BE, Serody JS, Cohen MS (1994) The role of lactoferrin as an anti-inflammatory molecule. Adv Exp Med Biol 357:143–156 Brock J (1995) Lactoferrin: a multifunctional immunoregulatory protein? Immunol Today 16(9):417–419 Brock JH (2002) The physiology of lactoferrin. Biochem Cell Biol 80(1):1–6
123
Transgenic Res Brock JH (2012) Lactoferrin–50 years on. Biochem Cell Biol 90(3):245–251. doi:10.1139/o2012-018 Brundige DR, Maga EA, Klasing KC, Murray JD (2008) Lysozyme transgenic goats’ milk influences gastrointestinal morphology in young pigs. J nutr 138(5):921–926 Callewaert L, Michiels CW (2010) Lysozymes in the animal kingdom. J Biosci 35(1):127–160 Carroll MA (1980) The right to treatment and involuntary commitment. J Med Philos 5(4):278–291 Coker RJ, Hunter BM, Rudge JW, Liverani M, Hanvoravongchai P (2011) Emerging infectious diseases in southeast Asia: regional challenges to control. Lancet 377(9765):599–609. doi:10.1016/S0140-6736(10)62004-1 Cooper CA, Brundige DR, Reh WA, Maga EA, Murray JD (2011) Lysozyme transgenic goats’ milk positively impacts intestinal cytokine expression and morphology. Transgenic Res 20(6):1235–1243. doi:10.1007/s11248-011-9489-7 Cooper CA, Nelson KM, Maga EA, Murray JD (2013) Consumption of transgenic cows’ milk containing human lactoferrin results in beneficial changes in the gastrointestinal tract and systemic health of young pigs. Transgenic Res 22(3):571–578. doi:10.1007/s11248-012-9662-7 Ellison RT 3rd, Giehl TJ (1991) Killing of gram-negative bacteria by lactoferrin and lysozyme. J Clin Invest 88(4):1080–1091. doi:10.1172/JCI115407 Ellison RT 3rd, Giehl TJ, LaForce FM (1988) Damage of the outer membrane of enteric gram-negative bacteria by lactoferrin and transferrin. Infect Immun 56(11):2774–2781 Fairbrother JM, Nadeau E, Gyles CL (2005) Escherichia coli in postweaning diarrhea in pigs: an update on bacterial types, pathogenesis, and prevention strategies. Anim health res rev 6(1):17–39 Giraldo P, Montoliu L (2001) Size matters: use of YACs, BACs and PACs in transgenic animals. Transgenic Res 10(2):83–103 Groves ML (1960) The isolation of a red protein from milk. J Am Chem Soc 82(13):3345–3350 Hennart PF, Brasseur DJ, Delogne-Desnoeck JB, Dramaix MM, Robyn CE (1991) Lysozyme, lactoferrin, and secretory immunoglobulin A content in breast milk: influence of duration of lactation, nutrition status, prolactin status, and parity of mother. Am J Clin Nutr 53(1):32–39 Humphrey BD, Huang N, Klasing KC (2002) Rice expressing lactoferrin and lysozyme has antibiotic-like properties when fed to chicks. J nutr 132(6):1214–1218 Johanson B (1960) Isolation of an iron-containing red protein from human milk. Acta Chem Scand 14(2):510–512 Lee-Huang S, Huang PL, Sun Y, Huang PL, Kung HF, Blithe DL, Chen HC (1999) Lysozyme and RNases as anti-HIV components in beta-core preparations of human chorionic gonadotropin. Proc Natl Acad Sci USA 96(6):2678–2681 Leitch EC, Willcox MD (1998) Synergic antistaphylococcal properties of lactoferrin and lysozyme. J Med Microbiol 47(9):837–842 Leitch EC, Willcox MD (1999) Elucidation of the antistaphylococcal action of lactoferrin and lysozyme. J Med Microbiol 48(9):867–871 Levay PF, Viljoen M (1995) Lactoferrin: a general review. Haematologica 80(3):252–267 Liu Z, Zhao C, Fan B, Dai Y, Zhao Z, Wang L, Zheng M, Feng J, Chen Y, Duan Y, Li N (2004) Variable expression of
123
human lactoferrin gene in mice milk driven by its 90 KB upstream flanking sequences. Anim biotechnol 15(1):21–31. doi:10.1081/ABIO-120029810 Liu S, Li X, Lu D, Shang S, Wang M, Zheng M, Zhang R, Tang B, Li Q, Dai Y, Li N (2012) High-level expression of bioactive recombinant human lysozyme in the milk of transgenic mice using a modified human lactoferrin BAC. Transgenic Res 21(2):407–414. doi:10.1007/s11248-0119536-4 Lonnerdal B (2003) Nutritional and physiologic significance of human milk proteins. Am J Clin Nutr 77(6):1537S–1543S Lonnerdal B, Iyer S (1995) Lactoferrin: molecular structure and biological function. Annu Rev Nutr 15:93–110. doi:10. 1146/annurev.nu.15.070195.000521 Maga EA, Anderson GB, Cullor JS, Smith W, Murray JD (1998) Antimicrobial properties of human lysozyme transgenic mouse milk. J Food Prot 61(1):52–56 Masson PL, Heremans JF (1971) Lactoferrin in milk from different species. Comp Biochem Physiol B Comp Biochem 39(1):119–129 Mathur NB, Dwarkadas AM, Sharma VK, Saha K, Jain N (1990) Anti-infective factors in preterm human colostrum. Acta Paediatr Scand 79(11):1039–1044 Matsuda Y, Saoo K, Hosokawa K, Yamakawa K, Yokohira M, Zeng Y, Takeuchi H, Imaida K (2007) Post-initiation chemopreventive effects of dietary bovine lactoferrin on 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone-induced lung tumorigenesis in female A/J mice. Cancer Lett 246(1–2):41–46. doi:10.1016/j.canlet.2006.01.034 McEwen SA, Fedorka-Cray PJ (2002) Antimicrobial use and resistance in animals. Clin infect dis 34(Suppl 3):S93– S106. doi:10.1086/340246 Mir MA (1977) Lysozyme: a brief review. Postgrad Med J 53(619):257–259 Montagne P, Cuilliere ML, Mole C, Bene MC, Faure G (1998) Microparticle-enhanced nephelometric immunoassay of lysozyme in milk and other human body fluids. Clin Chem 44(8 Pt 1):1610–1615 Montagne P, Cuilliere ML, Mole C, Bene MC, Faure G (2001) Changes in lactoferrin and lysozyme levels in human milk during the first twelve weeks of lactation. Adv Exp Med Biol 501:241–247 Morse SI (1965) Biological attributes of staphylococcal cell walls. Ann N Y Acad Sci 128(1):191–213 Muller M, Brenig B, Winnacker EL, Brem G (1992) Transgenic pigs carrying cDNA copies encoding the murine Mx1 protein which confers resistance to influenza virus infection. Gene 121(2):263–270 Pluske JR, Pethick DW, Hopwood DE, Hampson DJ (2002) Nutritional influences on some major enteric bacterial diseases of pig. Nutr Res Rev 15(2):333–371. doi:10.1079/ NRR200242 Salton MR (1957) The properties of lysozyme and its action on microorganisms. Bacteriol Rev 21(2):82–100 Samaranayake YH, Samaranayake LP, Pow EH, Beena VT, Yeung KW (2001) Antifungal effects of lysozyme and lactoferrin against genetically similar, sequential Candida albicans isolates from a human immunodeficiency virus-infected southern Chinese cohort. J Clin Microbiol 39(9):3296–3302 Sanchez L, Calvo M, Brock JH (1992) Biological role of lactoferrin. Arch Dis Child 67(5):657–661
Transgenic Res Sexton C, Buss D, Powell B, O’Connor M, Rainer R, Woodruff R, Cruz J, Pettenati M, Rao PN, Case LD (1996) Usefulness and limitations of serum and urine lysozyme levels in the classification of acute myeloid leukemia: an analysis of 208 cases. Leuk Res 20(6):467–472 Shau H, Kim A, Golub SH (1992) Modulation of natural killer and lymphokine-activated killer cell cytotoxicity by lactoferrin. J Leukoc Biol 51(4):343–349 Soukka T, Lumikari M, Tenovuo J (1991) Combined inhibitory effect of lactoferrin and lactoperoxidase system on the viability of Streptococcus mutans, serotype c. Scand J Dent Res 99(5):390–396 Spadaro M, Caorsi C, Ceruti P, Varadhachary A, Forni G, Pericle F, Giovarelli M (2008) Lactoferrin, a major defense protein of innate immunity, is a novel maturation factor for human dendritic cells. FASEB J 22(8):2747–2757. doi:10. 1096/fj.07-098038 Steijns JM, van Hooijdonk AC (2000) Occurrence, structure, biochemical properties and technological characteristics of lactoferrin. Br J Nutr 84(Suppl 1):S11–S17 Suzuki T, Yamauchi K, Kawase K, Tomita M, Kiyosawa I, Okonogi S (1989) Collaborative bacteriostatic activity of bovine lactoferrin with lysozyme against Escherichia coli 0111. Agric Biol Chem 53(6):1705–1706 Tang L, Wu JJ, Ma Q, Cui T, Andreopoulos FM, Gil J, Valdes J, Davis SC, Li J (2010) Human lactoferrin stimulates skin keratinocyte function and wound re-epithelialization. Br J Dermatol 163(1):38–47. doi:10.1111/j.1365-2133.2010. 09748.x
Tong J, Wei H, Liu X, Hu W, Bi M, Wang Y, Li Q, Li N (2011) Production of recombinant human lysozyme in the milk of transgenic pigs. Transgenic Res 20(2):417–419. doi:10. 1007/s11248-010-9409-2 Ward PP, Uribe-Luna S, Conneely OM (2002) Lactoferrin and host defense. Biochem cell biol 80(1):95–102 Wei HX, Zhang K, Ma YF, Li Y, Li QY, Dai YP, Li N (2009) Stage-dependent effect of leptin on development of porcine embryos derived from parthenogenetic activation and transgenic somatic cell nuclear transfer. J Reprod Dev 55(2):99–104 Weidle UH, Lenz H, Brem G (1991) Genes encoding a mouse monoclonal antibody are expressed in transgenic mice, rabbits and pigs. Gene 98(2):185–191 Yang P, Wang J, Gong G, Sun X, Zhang R, Du Z, Liu Y, Li R, Ding F, Tang B, Dai Y, Li N (2008) Cattle mammary bioreactor generated by a novel procedure of transgenic cloning for large-scale production of functional human lactoferrin. PLoS One 3(10):e3453. doi:10.1371/journal. pone.0003453 Zhang Y, Pan D, Sun X, Sun G, Wang X, Liu X, Li Y, Dai Y, Li N (2006) Production of porcine cloned transgenic embryos expressing green fluorescent protein by somatic cell nuclear transfer. Sci China Ser C 49(2):164–171 Zimecki M, Mazurier J, Spik G, Kapp JA (1995) Human lactoferrin induces phenotypic and functional changes in murine splenic B cells. Immunology 86(1):122–127
123
BRIEF COMMUNICATION
Generation of bi-transgenic pigs overexpressing human lactoferrin and lysozyme in milk Dan Cui • Jia Li • Linlin Zhang • Shen Liu Xiao Wen • Qiuyan Li • Yaofeng Zhao • Xiaoxiang Hu • Ran Zhang • Ning Li
•
Received: 11 March 2014 / Accepted: 6 September 2014 Ó Springer International Publishing Switzerland 2014
Abstract Intensive swine production industry uses antibiotics to treat diseases and improve pig growth. This can not only cause antibiotic resistance, but can also pollute the environment or eventually affect human public health. To date, human lactoferrin (hLF) and human lysozyme (hLZ) have been known as nonadaptive but interactive antimicrobial members and could act in concert against bacteria, which contribute to host defense. Therefore, their expression in pigs might be an alternative strategy for replacing antibiotics in the pig production industry. In our study, we produced hLF and hLZ bi-transgenic pigs and assessed the milk’s antibacterial ability. Integration of both transgenes was confirmed by PCR and southern blot. Both the hLF and hLZ were expressed in the mammary gland of bi-transgenic pigs, as detected by western blotting. The expression amounts were 6.5 g/L for hLF and 1.1 mg/L for hLZ using ELISA. Interestingly, pig milk containing hLF and hLZ had synergistic antimicrobial activity. Our results
D. Cui J. Li L. Zhang Y. Zhao X. Hu R. Zhang N. Li (&) State Key Laboratory for Agrobiotechnology, China Agricultural University, Beijing 100193, People’s Republic of China e-mail: [email protected] S. Liu X. Wen Q. Li GenProtein Biotech Ltd., Beijing 100193, People’s Republic of China
suggest an alternative approach for avoiding the use of antibiotics in the pig industry, which would be of great benefit to the commercial swine production. Keywords Human lactoferrin Human lysozyme Bi-transgenic Pig
Introduction Pork, which is mainly supplied by China, USA, and the European Union, is the world’s most widely consumed meat accounting for more than half of the meat consumption. With the global population and economy growth, the intensive swine production industry has been employed to meet the global demand for a faster and larger growth of pigs. However, this type of production also brings problems related to the potential for rapid spread of diseases, which includes respiratory disease, pneumonia, enteric diseases, and diarrhea. These will finally result in serious economic losses, poor performance of pig growth and carcass composition (Fairbrother et al. 2005; Coker et al. 2011). Traditionally, producers, veterinarians and other food chain participants utilize antibiotics to treat illness and protect pigs from being attacked by diseases as well as to promote growth (Addison 1984; McEwen and Fedorka-Cray 2002). Nonetheless, the use of antibiotics not only cause antibiotic resistance to microorganisms but also pollute the
123
Transgenic Res
environment by disseminating from pig’s feces and urine, which would exert unprecedented effects on human public health (Barton 2000). Thus, the breeding of pigs with better growth performance and disease resistance is critical in pig production industry when taken economical, ethical, human health and animal welfare issues into consideration. Researchers seek alternative strategies after banning of antibiotics as a growth promoter in pig industries in the European Union in 2006. Some of the researchers change the nutritional composition for post-weaning colibacillosis (PWC) that caused by Escherichia coli specifically affecting the small intestine at the first 3–10 days after weaning (Pluske et al. 2002). Additionally, the application of transgenic technologies to improve the growth performance and disease resistance is another promising measure for newborn piglets (Weidle et al. 1991; Muller et al. 1992). Lactoferrin (LF) and lysozyme (LZ) are non-adaptive but interactive antimicrobial members with a high level of expression in human milk, which are considered as the two most important candidate genes for transgenic animal production. Both proteins expressed by the genes might contribute to host defense, protecting the newborns from being attacked by a large number of pathogens. Lactoferrin (LF), which is an 80 kDa iron-binding glycoprotein of the transferrin family, was first described in bovine milk in 1939 and later was isolated from human milk in 1960 (Groves 1960; Johannson 1960). This protein is mainly found in the gateways of exocrine glands such as the digestive, respiratory and reproductive systems, which indicates its primary role involved in defending against invading pathogens in a non-specific manner (Lonnerdal 2003). LF is responsible for a multitude of physiological functions (Sanchez et al. 1992; Brock 1995; Lonnerdal and Iyer 1995; Levay and Viljoen 1995; Steijns and van Hooijdonk 2000; Brock 2012), such as regulation of iron homeostasis (Tang et al. 2010), bacteriostatic or bactericidal effects, as well as other functions relevant to immune modulation (Shau et al. 1992; Zimecki et al. 1995; Brock 2002; Ward et al. 2002; Spadaro et al. 2008). Lysozyme (LZ) is a hydrolytic enzyme discovered by Fleming in 1921. It has antimicrobial function by cleaving the b-(1,4)glycosidic bond between N-acetylmuramic acid and N-acetylglucosamine in peptidoglycan and subse-
123
quently causing bacterial cell wall lyse (Salton 1957; Mir 1977; Callewaert and Michiels 2010). Therefore, gram-positive bacteria containing N-acetylmuramic acid and N-acetylglucosamine in its cell wall are much more susceptible to LZ than gram-negative bacteria. The antimicrobial activity of lysozyme has been extensively studied in vitro and in vivo including milk, blood serum, saliva and lungs (Carroll 1980; Lee-Huang et al. 1999; Sexton et al. 1996). In addition, accumulating evidence reveals that human lysozyme (hLZ) expressed in transgenic mice and pigs has antimicrobial activity (Maga et al. 1998; Brundige et al. 2008; Cooper et al. 2011, 2013). Previous studies show that both of the defense factors interact with each other (Soukka et al. 1991) and enhance the antimicrobial effect. Richard et al. demonstrated that LF could enhance the killing effect of LZ on gram-negative bacteria (Ellison et al. 1991). LF and LZ also have synergic properties for a type of gram-positive bacteria known as S. epidermidis isolates (Leitch and Willcox 1998). In addition, Soukka and Samaranayake demonstrated that LZ and apo-LF exhibit an enhanced bacteria activity against Streptococcus mutants (serotype c) and Candida isolates (Soukka et al. 1991; Samaranayake et al. 2001). Thus, these lead us to speculate that with a high level expression of human lactoferrin (hLF) and hLZ should be an alternative strategy to improve disease resistance. hLF expressed in transgenic mice with high expression level up to 8 g/L have been obtained in our previous work (Liu et al. 2004) and later hLF transgenic cow have been cloned by SCNT (3.4 g/L) (Yang et al. 2008). Another work by Liu et al. (2012) in our group used a modified hLZ vector to generate transgenic mice that could efficiently express hLZ in its milk. These previous results shed light on the production hLF and hLZ bi-transgenic pigs with enhanced ability of disease resistance. Here we report the generation of the hLF and hLZ bi-transgenic pigs. The expression of hLF was up to 6.5 g/L, while the expression of hLZ was relatively low at 1.1 mg/L in milk of transgenic pig. Intriguingly, the hLF and hLZ in the milk of transgenic pigs had the co-operative bacteriostatic activity to M. lysodeikticus even with such a relative low level of hLZ. Our results suggest a potential alternative strategy for the improvement of disease resistance in the pig industry.
Transgenic Res
Materials and methods Construction of the hLF BAC and pBAC-hLFhLZ-Neo BAC containing the entire hLF genomic sequence was purified by a large-construct kit (Qiagen, Germany). pBAC-hLF-hLZ-Neo constructed by Liu (Liu et al. 2012) was purified in the same way.
finally held at 72 °C for 7 min. The amplified products were 1,961 bp, 1,581 bp and 533 bp respectively. The primers for hLZ were: hLZ-F: TGCTGG GTGCCTGAGATTCA and hLZ-R: AGTTCA AAATGG GAAATAACTGG. PCR was performed under followed conditions: 94 °C for 5 min, 30 cycles at 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s, and 72 °C for 7 min. The product was 120 bp. Southern blotting
Generation of transgenic pig Approximately 1 9 106 fetal fibroblasts were transfected with 4–5 lg of each hLF BAC and pBAC-hLFhLZ-Neo vectors. After 24 h, the cells were transferred to six 10-cm plates with selective medium containing G418 (500 lg/mL, Promega). The selection process lasted nearly 10 days. Resistant clones were collected using of cloning cylinder (Sigma, USA) and transferred to 24-well plates. After 48 h, sub-confluent cells were harvested. Half of the cells were subjected to genotyping, and the rest were cryopreserved in liquid nitrogen. After identifying the positive clone, somatic cell nuclear transfer (SCNT) was conducted as described using the cells cryopreserved (Zhang et al. 2006; Wei et al. 2009). Each of the surrogate sows received 300 embryos. Pregnancy was determined by abdominal ultrasound examination 1 month after the SCNT. Approximately 110 days later, piglets were delivered by natural birth. All procedures were guaranteed by animal welfare following instructions approved by the China Council on Animal Care and Protocols. Genotyping of transgenic pig Genomic DNA was prepared from ear tissues using the phenol method. Three pairs of hLF BAC specific primers and one pair of hLZ gene specific primers were used to identify the transgenic pigs. The primers for hLF are as follows: hLF-50 -F: TGCTTTGTT TGTATTGAGGGTC and hLF-50 -R: CCAGGAAC AAACTTACGGAG; hLF-30 -F: TTCCTTCCACCAC TGTTGAG and hLF-30 -R: CAAATACCTCT GCCGCTGTT; hLF-CDS-F: AGGACACAGACAG CAGACAC and hLF-CDS-R: CAGCCCTCTTCT TCCTCTTC. PCR reactions were: 94 °C for 5 min, 30 cycles at 94 °C for 30 s, 60.6 °C for 30 s, then 72 °C for 2 min, 1 min 40 s, 45 s, respectively, and
Genomic DNA was extracted from ear tissues using phenol method. Ten micrograms of DNA for each pig were digested with EcoR I overnight to detect hLF BAC gene. Then the digested products were separated on a 0.8 % agarose gel and transferred to Hybond TMN? membrane (Amersham, Piscataway, NJ) and hybridized with a 710 bp hLF BAC specific probe that was produced by PCR using hLF BAC as a template and a PCR reaction mixture containing DIGdUTP. Similarly, 10 lg of DNA for each pig were digested by EcoR I overnight to detect hLZ gene according to a protocol in previous research (Liu et al. 2012). Quantitative real-time PCR (qRT-PCR) and copy number calculation Ear tissues were used for DNA isolation as described in southern blot. Primers for qRT-PCR were designed using Primer Express software (ABI). The primers for hLF were hLF-F: GGAAGTCTACGGGACCGAA AGA and hLF-R: CACAGCCACGGCATAATAGT GAG. The primers for hLZ were: hLZ-F: TGC TGGGTGCCTGAGATTCA and hLZ-R: AGTTCAA AATGG GAAATAACTGG. Myostatin (MSTN) was used as internal control and was amplified using MSTN-F: TCTGAGACCCGTCAAGACTCCTA and MSTN-R: TGTCAAGTTTCAGAGATCGGATTC. Each sample was performed in triplicate on LightCycler 480 I (Roche). Copy numbers were calculated as described (Liu et al. 2012). Western blotting Milk from transgenic pigs and wild type pigs were harvested at 3, 6, 9, 12, 15, 18, 21, 24 h, 2, 3, 5, 7 days of lactation. Milk was defatted by centrifugation at 4 °C for 10 min at 4,500 rpm. Milk obtained was
123
Transgenic Res
mixed with loading buffer and then separated on 10 % polyacrylamide tris–glycine gels. Separated proteins were electrophoretically transferred to nitrocellulose membranes (Amersham Pharmacia, UK), blocked with 3 % BSA in TBST at 4 °C for 1 h, and then detected with hLF and hLZ specific primary antibodies (1:100,000 dilution for hLF and 1:5,000 dilution for hLZ; Biological Inc, USA) as described in our previous research (Liu et al. 2004, 2012). Then they were incubated with goat anti-rabbit secondary antibodies (1:10,000 dilution; ZSGB-Bio, China) for 1 h at room temperature, followed by three times wash in TBST. The membranes were subjected to luminolbased chemiluminescence with commercial substrate (Millipore,USA) and Kodak film. Purified hLF from hLF transgenic cow was used as the positive control. In terms of hLZ we chose natural hLZ standard as a positive control.
Enzyme-linked immunosorbent assay (ELISA) Milk from transgenic pigs and its littermate control was subjected to ELISA by the use of quantification kits for hLF (Calbiochem, USA) and hLZ proteins (Biomedical Technologies Inc, USA) according to the manufacturer’s instructions. In order to determine the hLF and hLZ proteins in the milk,we did a dilution of milk in 1:400,000 and 1:100, respectively. Briefly, 100 lL of diluted samples were added to the precoated wells. After the incubation for 1 h and extensively washing, plates were incubated with 100 lL of detection antibody for 1 h, following by washing as above and then 100 lL HRP solution was added, and subsequently colorimetric reaction was developed with the substrate TMB. The absorbance value was measured at 450 nm.
Assessment of the antibacterial activity of transgenic pig milk LB agar-plates containing M. lysodeikticus were used to examine the antibacterial activity of the milk. Sixmm filter papers were plated on to the surface of the plates and 10 lL milk (in tenfolds dilution) were pipetted to it. After 24 h, bacteriostatic activity was assessed from the size of the area of growth inhibition noted around the discs.
123
Assessment of the growth prompting effect of transgenic pig milk The F1 piglets were divided into three groups: bitransgenic positive piglets fed bi-transgenic milk; wild type piglets fed bi-transgenic milk or wild type milk. We weighed each three piglets in each group every 7 days. Statistical analysis The experimental data were analyzed by one-way ANOVA using SPSS 14 software. P value \ 0.05 was considered significant.
Results and discussion Transgenic pigs were produced by somatic cell nuclear transfer (SCNT). Duroc fibroblasts were cotransfected with vectors of hLF BAC and pBAC-hLFhLZ-Neo (Fig. 1a) and then were selected with G418. Among 16 G418-resistant colonies obtained, three (4#, 13#, 16#) of them integrated both of the vectors. Colonies of 13# and 16# that had better quality and viability were chosen to perform SCNT. A total of 2,680 reconstructed embryos were transferred into eight surrogate pig recipients, of which only four surrogate pigs became pregnant. Five piglets were born by the surrogate pig receiving embryos from 13# (No. 1–5) colony and 12 piglets (No. 341–351, 317) were born from 16# colony. Of the 17 piglets produced, three females (No. 1, 3, 5) were found to harbor both the hLF and hLZ transgenes, as evidenced by PCR (Fig. 1b), and were designated as the transgenic founders. Southern blotting was conducted to confirm the presence of the transgenes. With the specific probes for hLF and hLZ, we detected the 2.2 and 3.3 kb bands, respectively (Fig. 1c). These results showed that both transgenes were integrated into the genome of all three transgenic founders. The hLF transgenic inserts were 3.4 ± 0.3 and with regard to hLZ were 2.4 ± 0.8 in each of the transgenic positive pigs using qRT-PCR. No. 1 and No. 3 died at different time points and No. 5 survived until now. No. 5 female founder was mated with a wild type boar. Among the seven offspring that were produced, three of them (one was female and two were male) integrated both transgenes as determined by PCR (data not shown).
Transgenic Res Fig. 1 Generation of hLF and hLZ bi-transgenic pigs. a Schematic presentation of the hLF and hLZ constructs used for microinjection. hLZ BAC sequence replaced the hLF genomic region by homologous recombination in the pBAC-hLF-hLZ-Neo vector. Double-arrow lines stand for the primers for PCR verification or southern blot probes. b PCR detection of transgenic founders. M1, 1 kb DNA ladder; M2, 100 bp DNA ladder; P positive plasmid control, N negative control; The amplified products for hLF 50 , cds, 30 are 1,961 bp, 1,581 bp, 528 bp respectively. The product for hLZ is 120 bp. c Southern blot analysis of transgenic founders. DNA of ear tissues shows the 2.2 kb positive band for hLF and 3.3 kb band for hLZ. 1c, 5c, 10c, plasmid control of different copies of hLF or hLZ; N, a sex and age matched wild-type control
In addition to the identification of transgenic piglets, we also evaluated the expression of the two proteins using western blot and ELISA. Milk was collected from the bi-transgenic pig (No. 5) and its littermate control. We observed a strong band for hLF and a weak band for hLZ according to SDS-PAGE (Fig. 2a). Furthermore, western blot displayed the expected molecular weights (MW) with 80 kDa for hLF and 14.7 kDa for hLZ (Fig. 2b). To determine the expression of both proteins in the bi-transgenic pig, milk collected at different time points was skimmed
and subjected to ELISA. Our results exhibited that the highest expression level for hLF in the pig’s milk reaching to 9.4 g/L on the third day, with an average of 6.5 g/L in the founder line. The expression of hLF is three to four times higher than that found in human milk (1–2 g/L) (Masson and Heremans 1971; Sanchez et al. 1992; Levay and Viljoen 1995). Besides, hLF expressed in the bi-transgenic pig is six to eight times higher compared with that found in pig colostrum (1.1–1.3 g/L). This high expression level of hLF could be attributed to the use of hLF BAC construct that
123
Transgenic Res Fig. 2 Expression of hLF and hLZ in bi-transgenic pig. a SDS-PAGE of 5# transgenic founder at 12 h, 1, 2, 3, 5, 7 days after parturition. b Western blot was performed and samples were detected with specific antibodies for hLF and hLZ at 3 h, 12 h, 1, 2, 3, 5, 7 days after parturition. N milk of non-transgenic pig, hLF purified from transgenic cattle expressing hLF; hLZ natural hLZ standard
contained multiple regulatory elements and specific sequences such as locus control regions (LCR) and matrix-attachment regions (MAR), which probably obviated ‘‘position effect’’ and guaranteed a better performance of an exogenous gene expression (Giraldo and Montoliu 2001). On the contrary to hLF, the expression level of hLZ was relatively low, with an average of 1.1 mg/L. This expression was much lower than that detected in human milk (0.2–0.4 g/L) (Mathur et al. 1990; Hennart et al. 1991; Montagne et al. 1998, 2001). However, hLZ was 17 times higher than the endogenous expression of pig lysozyme in milk (0.065 mg/L). While the relative low level expression of hLZ was likely caused by the low copy number of exogenous gene, but it was still three times higher than our previously established hLZ transgenic pig using pBC1 vectors (Tong et al. 2011). No cross reactions with porcine LF were observed in terms of the western blot and ELISA performed for hLF (data not shown). We performed antibacterial experiments to determine the function of the hLF and hLZ in the milk of bitransgenic pig. Filter papers were placed on the agar plates containing M. lysodeikticus and the anti-
123
bacteria activity was estimated by the transparent zones around them after 24 h incubation at 32 °C. Bitransgenic milk had a small transparent zone and no transparent zone was found with the milk from a nontransgenic pig (Fig. 3a). This indicated that the milk from hLF and hLZ bi-transgenic pig had bacteriostatic effects when compared with control milk. Previous investigators described a similar finding with respect to the antimicrobial effect by the combination of LF and LZ (Ellison et al. 1991; Leitch and Willcox 1998, 1999; Soukka et al. 1991; Samaranayake et al. 2001). There are mainly two mechanisms that could be responsible for their synergetical antimicrobial effect. On the one hand, LF is a highly cationic protein and it has been shown that LF is able to bind the LPS layer of gram-negative bacteria or release lipoteichoic acid from gram-positive bacteria, then neutralizes the negative charge of the cell wall and finally increases the permeability of peptidoglycan to lysozyme, allows to lyse of it (Morse 1965). On the other hand, LF could promote lysozyme to lyse peptidoglycan through removing cations by its metal chelating capacity (Ellison et al. 1988). These might explain why with such a relative low level of hLZ and high level of hLF
Transgenic Res
Fig. 3 Functional analysis of milk obtained from the bitransgenic pig. a Lysoplate assay for lytic activity of the bitransgenic milk against M. lysodeikticus. Small white circles are 6-mm quantitative filter papers spotted with 10 lL milk sample (in tenfolds dilution) and transparent zones around the quantitative filter papers indicate the ability of bacterial lyse. PChLF 8 lg, 8 micrograms hLF purified protein; PChLZ 1 lg, 1
micrograms hLZ natural standard; Control, milk from nontransgenic pig; NC, water. b Weight change (Data were presented as mean ± SD) of piglets before weaning (n = 3 each). One-way ANOVA were used for statistical analysis (spss 14). Neg, wild type control piglets fed wild type milk; TR, bitransgenic piglets fed bi-transgenic milk; TRneg, bi-transgenic negative piglets fed bi-transgenic milk
still had bacteriostatic effect against M. lysodeikticus. Our results also showed that with only high level of LF protein could not exhibit the antimicrobial effect, which was consistent with Humphrey et al. (2002) who reported the combination of 5 % LF and 10 % LZ was more effective to improve intestinal health, while 5 % LF alone would not exert this effect. Similarly, Suzuki et al. (1989) demonstrated that the combination of LZ (80 mg/L) and apo-LF (500 mg/L) could significantly enhance the growth-inhibitory effect against E. coli 0111 and the combination was much more effective than LZ, apo-LF or sat LF alone. The F1 piglets were divided into three groups as described in the materials and methods, and then three piglets were weighed in each group every 7 days to determine the weight change before weaning. The average weight of bi-transgenic milk fed piglets was slight heavier than those fed wild type milk during this period. To assess the physical condition of those pigs, we also measured a variety of markers in routine blood and blood chemistry tests. There were no significant differences found in each group (data not shown). In summary, we reported the production of hLF and hLZ bi-transgenic pig with efficient BAC vectors. The milk of the transgenic pigs had antimicrobial effect in vitro. Our results suggest an alternative approach for antibiotics use in the pig industry. Further studies are needed to improve the expression level of hLZ using
more efficient vectors. In addition, challenging the piglets with bacteria causing disease such as diarrhea would provide more solid evidence for the anti-disease function of the bi-transgenic pig milk. Last but not least, further studies also need to improve the expression of porcine endogenous LF and LZ so as to eliminate the safety concerns of foreign genes’ transgenesis. However, efficient vectors are needed due to the relatively low expression level of porcine LZ (0.065 mg/L) and LF (1.1–1.3 g/L). Acknowledgments We thanked Dr. Jin He, Sergio Ardanza, Amanda Wiinamaki, Priya Rao, and Ashok Rao for critical discussions and reading of the manuscript. This work was supported by National Program of Transgenical Breeding Project of China (Project No. 2013ZX08006).
References Addison JB (1984) Antibiotics in sediments and run-off waters from feedlots. Residue rev 92:1–28 Barton MD (2000) Antibiotic use in animal feed and its impact on human healt. Nutr Res Rev 13(2):279–299. doi:10. 1079/095442200108729106 Britigan BE, Serody JS, Cohen MS (1994) The role of lactoferrin as an anti-inflammatory molecule. Adv Exp Med Biol 357:143–156 Brock J (1995) Lactoferrin: a multifunctional immunoregulatory protein? Immunol Today 16(9):417–419 Brock JH (2002) The physiology of lactoferrin. Biochem Cell Biol 80(1):1–6
123
Transgenic Res Brock JH (2012) Lactoferrin–50 years on. Biochem Cell Biol 90(3):245–251. doi:10.1139/o2012-018 Brundige DR, Maga EA, Klasing KC, Murray JD (2008) Lysozyme transgenic goats’ milk influences gastrointestinal morphology in young pigs. J nutr 138(5):921–926 Callewaert L, Michiels CW (2010) Lysozymes in the animal kingdom. J Biosci 35(1):127–160 Carroll MA (1980) The right to treatment and involuntary commitment. J Med Philos 5(4):278–291 Coker RJ, Hunter BM, Rudge JW, Liverani M, Hanvoravongchai P (2011) Emerging infectious diseases in southeast Asia: regional challenges to control. Lancet 377(9765):599–609. doi:10.1016/S0140-6736(10)62004-1 Cooper CA, Brundige DR, Reh WA, Maga EA, Murray JD (2011) Lysozyme transgenic goats’ milk positively impacts intestinal cytokine expression and morphology. Transgenic Res 20(6):1235–1243. doi:10.1007/s11248-011-9489-7 Cooper CA, Nelson KM, Maga EA, Murray JD (2013) Consumption of transgenic cows’ milk containing human lactoferrin results in beneficial changes in the gastrointestinal tract and systemic health of young pigs. Transgenic Res 22(3):571–578. doi:10.1007/s11248-012-9662-7 Ellison RT 3rd, Giehl TJ (1991) Killing of gram-negative bacteria by lactoferrin and lysozyme. J Clin Invest 88(4):1080–1091. doi:10.1172/JCI115407 Ellison RT 3rd, Giehl TJ, LaForce FM (1988) Damage of the outer membrane of enteric gram-negative bacteria by lactoferrin and transferrin. Infect Immun 56(11):2774–2781 Fairbrother JM, Nadeau E, Gyles CL (2005) Escherichia coli in postweaning diarrhea in pigs: an update on bacterial types, pathogenesis, and prevention strategies. Anim health res rev 6(1):17–39 Giraldo P, Montoliu L (2001) Size matters: use of YACs, BACs and PACs in transgenic animals. Transgenic Res 10(2):83–103 Groves ML (1960) The isolation of a red protein from milk. J Am Chem Soc 82(13):3345–3350 Hennart PF, Brasseur DJ, Delogne-Desnoeck JB, Dramaix MM, Robyn CE (1991) Lysozyme, lactoferrin, and secretory immunoglobulin A content in breast milk: influence of duration of lactation, nutrition status, prolactin status, and parity of mother. Am J Clin Nutr 53(1):32–39 Humphrey BD, Huang N, Klasing KC (2002) Rice expressing lactoferrin and lysozyme has antibiotic-like properties when fed to chicks. J nutr 132(6):1214–1218 Johanson B (1960) Isolation of an iron-containing red protein from human milk. Acta Chem Scand 14(2):510–512 Lee-Huang S, Huang PL, Sun Y, Huang PL, Kung HF, Blithe DL, Chen HC (1999) Lysozyme and RNases as anti-HIV components in beta-core preparations of human chorionic gonadotropin. Proc Natl Acad Sci USA 96(6):2678–2681 Leitch EC, Willcox MD (1998) Synergic antistaphylococcal properties of lactoferrin and lysozyme. J Med Microbiol 47(9):837–842 Leitch EC, Willcox MD (1999) Elucidation of the antistaphylococcal action of lactoferrin and lysozyme. J Med Microbiol 48(9):867–871 Levay PF, Viljoen M (1995) Lactoferrin: a general review. Haematologica 80(3):252–267 Liu Z, Zhao C, Fan B, Dai Y, Zhao Z, Wang L, Zheng M, Feng J, Chen Y, Duan Y, Li N (2004) Variable expression of
123
human lactoferrin gene in mice milk driven by its 90 KB upstream flanking sequences. Anim biotechnol 15(1):21–31. doi:10.1081/ABIO-120029810 Liu S, Li X, Lu D, Shang S, Wang M, Zheng M, Zhang R, Tang B, Li Q, Dai Y, Li N (2012) High-level expression of bioactive recombinant human lysozyme in the milk of transgenic mice using a modified human lactoferrin BAC. Transgenic Res 21(2):407–414. doi:10.1007/s11248-0119536-4 Lonnerdal B (2003) Nutritional and physiologic significance of human milk proteins. Am J Clin Nutr 77(6):1537S–1543S Lonnerdal B, Iyer S (1995) Lactoferrin: molecular structure and biological function. Annu Rev Nutr 15:93–110. doi:10. 1146/annurev.nu.15.070195.000521 Maga EA, Anderson GB, Cullor JS, Smith W, Murray JD (1998) Antimicrobial properties of human lysozyme transgenic mouse milk. J Food Prot 61(1):52–56 Masson PL, Heremans JF (1971) Lactoferrin in milk from different species. Comp Biochem Physiol B Comp Biochem 39(1):119–129 Mathur NB, Dwarkadas AM, Sharma VK, Saha K, Jain N (1990) Anti-infective factors in preterm human colostrum. Acta Paediatr Scand 79(11):1039–1044 Matsuda Y, Saoo K, Hosokawa K, Yamakawa K, Yokohira M, Zeng Y, Takeuchi H, Imaida K (2007) Post-initiation chemopreventive effects of dietary bovine lactoferrin on 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone-induced lung tumorigenesis in female A/J mice. Cancer Lett 246(1–2):41–46. doi:10.1016/j.canlet.2006.01.034 McEwen SA, Fedorka-Cray PJ (2002) Antimicrobial use and resistance in animals. Clin infect dis 34(Suppl 3):S93– S106. doi:10.1086/340246 Mir MA (1977) Lysozyme: a brief review. Postgrad Med J 53(619):257–259 Montagne P, Cuilliere ML, Mole C, Bene MC, Faure G (1998) Microparticle-enhanced nephelometric immunoassay of lysozyme in milk and other human body fluids. Clin Chem 44(8 Pt 1):1610–1615 Montagne P, Cuilliere ML, Mole C, Bene MC, Faure G (2001) Changes in lactoferrin and lysozyme levels in human milk during the first twelve weeks of lactation. Adv Exp Med Biol 501:241–247 Morse SI (1965) Biological attributes of staphylococcal cell walls. Ann N Y Acad Sci 128(1):191–213 Muller M, Brenig B, Winnacker EL, Brem G (1992) Transgenic pigs carrying cDNA copies encoding the murine Mx1 protein which confers resistance to influenza virus infection. Gene 121(2):263–270 Pluske JR, Pethick DW, Hopwood DE, Hampson DJ (2002) Nutritional influences on some major enteric bacterial diseases of pig. Nutr Res Rev 15(2):333–371. doi:10.1079/ NRR200242 Salton MR (1957) The properties of lysozyme and its action on microorganisms. Bacteriol Rev 21(2):82–100 Samaranayake YH, Samaranayake LP, Pow EH, Beena VT, Yeung KW (2001) Antifungal effects of lysozyme and lactoferrin against genetically similar, sequential Candida albicans isolates from a human immunodeficiency virus-infected southern Chinese cohort. J Clin Microbiol 39(9):3296–3302 Sanchez L, Calvo M, Brock JH (1992) Biological role of lactoferrin. Arch Dis Child 67(5):657–661
Transgenic Res Sexton C, Buss D, Powell B, O’Connor M, Rainer R, Woodruff R, Cruz J, Pettenati M, Rao PN, Case LD (1996) Usefulness and limitations of serum and urine lysozyme levels in the classification of acute myeloid leukemia: an analysis of 208 cases. Leuk Res 20(6):467–472 Shau H, Kim A, Golub SH (1992) Modulation of natural killer and lymphokine-activated killer cell cytotoxicity by lactoferrin. J Leukoc Biol 51(4):343–349 Soukka T, Lumikari M, Tenovuo J (1991) Combined inhibitory effect of lactoferrin and lactoperoxidase system on the viability of Streptococcus mutans, serotype c. Scand J Dent Res 99(5):390–396 Spadaro M, Caorsi C, Ceruti P, Varadhachary A, Forni G, Pericle F, Giovarelli M (2008) Lactoferrin, a major defense protein of innate immunity, is a novel maturation factor for human dendritic cells. FASEB J 22(8):2747–2757. doi:10. 1096/fj.07-098038 Steijns JM, van Hooijdonk AC (2000) Occurrence, structure, biochemical properties and technological characteristics of lactoferrin. Br J Nutr 84(Suppl 1):S11–S17 Suzuki T, Yamauchi K, Kawase K, Tomita M, Kiyosawa I, Okonogi S (1989) Collaborative bacteriostatic activity of bovine lactoferrin with lysozyme against Escherichia coli 0111. Agric Biol Chem 53(6):1705–1706 Tang L, Wu JJ, Ma Q, Cui T, Andreopoulos FM, Gil J, Valdes J, Davis SC, Li J (2010) Human lactoferrin stimulates skin keratinocyte function and wound re-epithelialization. Br J Dermatol 163(1):38–47. doi:10.1111/j.1365-2133.2010. 09748.x
Tong J, Wei H, Liu X, Hu W, Bi M, Wang Y, Li Q, Li N (2011) Production of recombinant human lysozyme in the milk of transgenic pigs. Transgenic Res 20(2):417–419. doi:10. 1007/s11248-010-9409-2 Ward PP, Uribe-Luna S, Conneely OM (2002) Lactoferrin and host defense. Biochem cell biol 80(1):95–102 Wei HX, Zhang K, Ma YF, Li Y, Li QY, Dai YP, Li N (2009) Stage-dependent effect of leptin on development of porcine embryos derived from parthenogenetic activation and transgenic somatic cell nuclear transfer. J Reprod Dev 55(2):99–104 Weidle UH, Lenz H, Brem G (1991) Genes encoding a mouse monoclonal antibody are expressed in transgenic mice, rabbits and pigs. Gene 98(2):185–191 Yang P, Wang J, Gong G, Sun X, Zhang R, Du Z, Liu Y, Li R, Ding F, Tang B, Dai Y, Li N (2008) Cattle mammary bioreactor generated by a novel procedure of transgenic cloning for large-scale production of functional human lactoferrin. PLoS One 3(10):e3453. doi:10.1371/journal. pone.0003453 Zhang Y, Pan D, Sun X, Sun G, Wang X, Liu X, Li Y, Dai Y, Li N (2006) Production of porcine cloned transgenic embryos expressing green fluorescent protein by somatic cell nuclear transfer. Sci China Ser C 49(2):164–171 Zimecki M, Mazurier J, Spik G, Kapp JA (1995) Human lactoferrin induces phenotypic and functional changes in murine splenic B cells. Immunology 86(1):122–127
123
