Article

Generation of Salmonella ghost cells expressing fimbrial antigens of enterotoxigenic Escherichia coli and evaluation of their antigenicity in a murine model Chan Song Kim, Jin Hur, Seong Kug Eo, Sang-Youel Park, John Hwa Lee

Abstract Salmonella Typhimurium ghost cells expressing K88ab, K88ac, K99, and FasA fimbriae of enterotoxigenic Escherichia coli (ETEC) in their envelopes were constructed. The genes encoding the fimbriae were individually cloned into an expression plasmid, pMMP81, carrying the asd gene, which was subsequently electroporated into the Dasd S. Typhimurium mutant. Plasmid pJHLP99, carrying the phiX174 lysis gene E, was also subsequently electroporated into the Salmonella mutant. The presence of the individual fimbriae on the ghost cells was examined by Western blot analysis. Forty BALB/c mice were equally divided into 2 groups of 20 mice each. Group A mice were intramuscularly vaccinated with a mixture of the 4 ghost cells expressing the individual fimbriae. The group B mice were inoculated with sterile phosphate-buffered saline as a control. The antigen-specific serum IgG concentrations were significantly higher in group A than in group B from week 2 until week 6 after inoculation. In addition, the antigen-specific IgA concentrations in fecal samples were significantly higher in group A than in group B at week 2 after inoculation. A large difference between the groups in the number of antigen-specific IgA-secreting cells in the small intestine was observed by immunohistochemical study. Also, the splenic lymphocyte proliferative responses were significantly greater in group A than in the control mice. These results suggest that vaccination with our Salmonella ghost cells can induce both humoral and cell-mediated immune responses and that the increased number of antigen-specific IgA-secreting cells in the small intestine may be correlated with the elevated fecal IgA immune response.

Résumé Des cellules fantômes de Salmonella Typhimurium exprimant les fimbriae K88ab, K88ac, K99, et FasA d’Escherichia coli entérotoxigénique (ETEC) dans leurs enveloppes ont été construits. Les gènes codant pour les fimbriae ont été individuellement clonés dans un plasmide d’expression, pMMP81, transportant le gène asd, qui fut subséquemment élecroporé dans le mutant Dasd de S. Typhimurium. Le plasmide pJHLP99, transportant le gène lytique E phiX174, fut également subséquemment électroporé dans le mutant de Salmonella. La présence de fimbriae individuel sur les cellules fantômes fut examinée par immuno-buvardage. Quarante souris BALB/c ont été réparties également en deux groupes de 20 souris chacun. Les souris du groupe A ont été vaccinés par voie intramusculaire avec un mélange des quatre cellules fantômes exprimant les fimbriae individuels. Les souris du groupe B ont servi de témoin et ont été inoculées avec de la saline tamponnée stérile. Les concentrations sériques d’IgG spécifiques à l’antigène étaient significativement plus élevées dans le groupe A comparativement au groupe B à compter de la semaine 2 jusqu’à 6 semaines après l’inoculation. De plus, les concentrations d’IgA spécifiques à l’antigène dans les échantillons de fèces étaient significativement plus élevées dans le groupe A comparativement au groupe B 2 semaines après l’inoculation. Une différence marquée entre les groupes du nombre de cellules sécrétrices d’IgA spécifiques d’antigènes dans le petit intestin a été observée lors de l’examen immuno-histochimique. Également, la réponse proliférative des lymphocytes spléniques était significativement plus élevée dans le groupe A comparativement au groupe témoin. Ces résultats suggèrent que la vaccination avec nos cellules fantômes de Salmonella peut induire aussi bien une réponse humorale qu’une à médiation cellulaire et que l’augmentation du nombre de cellules sécrétant des IgA spécifiques à l’antigène dans le petit intestin peut être corrélée avec la réponse immunitaire augmentée en IgA dans les fèces. (Traduit par Docteur Serge Messier)

Department of Bioactive Material Sciences and Department of Veterinary Public Health, College of Veterinary Medicine, Chonbuk National University, Jeonju 561-756, Republic of Korea. Address all correspondence to Dr. John Hwa Lee; telephone: 182-63-850-0940; fax: 182-63-850-0910; e-mail: [email protected] Received March 4, 2015. Accepted June 26, 2015. 40

The Canadian Journal of Veterinary Research

2016;80:40–48

Table I. Bacterial strains and plasmids used in this study Strain/plasmid Description Strain   Escherichia coli    JOL416 Wild-type F4ab (K88ab)1 ETEC isolate from pig    JOL417 Wild-type F4ac (K88ac)1 ETEC isolate from pig    JOL412 Wild-type F5 (K99)1 ETEC isolate from pig    JOL415 Wild-type F6 (FasA)1 ETEC isolate from pig   x6212 80d lacZ DM15 deoR D(lacZYA-argF)U169 supE44l2gyrA96recA1relA1endA1 DasdA4 Dzhf-2::Tn10 hsdR17 (R2M1)   JOL1279 x6212 K88ab in pMMP81   JOL1280 x6212 K88ac in pMMP81   JOL1281 x6212 K99 in pMMP81   JOL1282 x6212 FasA in pMMP81

Lab stock This study This study This study This study

 Salmonella Typhimurium    JOL401   JOL1255    JOL1256    JOL1285    JOL1286    JOL1287    JOL1288

Lab stock This study This study This study This study This study This study

Wild-type isolate from chicken Dasd derivative of JOL401 JOL1255 containing pMMP81, pJHLP99 JOL1255 containing pMMP81-K88ab, pJHLP99 JOL1255 containing pMMP81-K88ac, pJHLP99 JOL1255 containing pMMP81-K99, pJHLP99 JOL1255 containing pMMP81-FasA, pJHLP99

Plasmid   pJHLP99 Derivative of T Easy-carrying ghost cassette  pMMP81 x7213 [pYA3332::ss ompA/His] ETEC — enterotoxigenic E. coli.

Introduction Enterotoxigenic Escherichia coli (ETEC) causes diarrheal disease and is the most common cause of enteric colibacillosis encountered in neonatal piglets (1–4). Because of its frequency, ETEC infection is one of the most economically important diseases in the pig industry (5,6). The pathogenicity of ETEC depends on its adherence and colonization ability in the intestinal epithelium (4,7–9), for which the presence of fimbriae is important. Once colonized in the intestinal epithelium, ETEC can produce heat-labile enterotoxin and/or heatstable enterotoxin to induce diarrhea (4,7–9). Because ETEC fimbriae are highly conserved, they are a common target for vaccination (10,11). Specifically, F4 (K88), F5 (K99), and F6 (987P or Fas) are the key ETEC fimbriae targeted during vaccination (12). However, the K88 fimbria has K88ab, K88ac, and K88ad serologic variants (13), and ETEC strains harboring K88ac are the most common cause of diarrhea in piglets (3,7,11). Therefore, high levels of fimbria-specific immunoglobulin (Ig) in the intestinal mucosa must be achieved for protection (6,14,15). For the development of safe and effective vaccines against infectious diseases, the use of bacterial ghosts as vaccine candidates has been introduced as a novel and progressive approach (16,17). Oral or parenteral vaccination of animals with bacterial ghosts has induced specific humoral and cellular immune responses (18). In addition to their success as vaccines, the ghosts also offer benefits in preparation. During their production, a chemical or physical inactivation

2000;64:0–00

Source

Lab Lab Lab Lab

stock stock stock stock

This study This study

procedure is not required, which avoids the denaturing of relevant immunogenic determinants (18). In this study, the phiX174 lysis gene E expression system was used to produce Salmonella ghost cells without denaturing the outer membrane proteins (OMPs) (19,20). In addition, a balanced lethal host-vector system based on the essential bacterial gene for aspartate b-semialdehyde dehydrogenase (asd) was used to maintain plasmids coexpressing the antigen inserted in the Salmonella strain (21–23). The objective of this study was to evaluate the immune responses against the ETEC fimbrial antigens K88ab, K88ac, K99, and FasA, which are associated with ETEC infections in neonatal piglets, by expressing the antigens on the surface of Salmonella ghost cells in a murine model.

Materials and methods Animals Forty female BALB/c mice, 6 wk old, were obtained from Samtako Bio Korea Company, Osan, Gyeonggi, South Korea. The mice were maintained in a 12-h light/dark cycle and allowed free access to a standard rodent diet (NIH#31M; Samtako Bio Korea Company) and water. The experiments with the animals were conducted with approval (CBU 2011-0017) from the Ethics Committee of Chonbuk National University, Jeonju, Republic of Korea, in accordance with the guidelines of the Korean Council on Animal Care.

The Canadian Journal of Veterinary Research

41

Table II. Polymerase chain reaction primers used and their product sizes Size (Number of Primer Product Nucleotide sequencea base pairs) F4ab K88ab CCGCGAATTCGCACATGCCTGGATGACTGG 854 CCGCAAGCTTGTAATAAGTTATTGCTACG

Enzyme site EcoRI HindIII

F4ac K88ac CCGCGAATTCGCACATGCCTGGATGACT 819 CCGCAAGCTTGTAATAAGTAATTGCTACG

EcoRI HindIII

F5 K99 CCGCGAATTCTCTGCGAATACAGGTACTA 546 CCGCAAGCTTCATATAAGTGACTAAGAA

EcoRI HindIII

F6 FasA CCGCGAATTCGCGCCCGCTGAAAACAAC 515 CCGCAAGCTTCGGTGTACCTGCTGAACG a Underlining indicates the sites of the restriction enzymes.

EcoRI HindIII

Bacterial strains, ghost plasmids, and growth conditions The bacterial strains and plasmids used in this study are described in Table I. The genes encoding the K88ab, K88ac, K99, and FasA fimbriae were amplified from template DNA prepared from the wildtype E. coli strains JOL416, JOL417, JOL412, and JOL415, respectively. For construction of the ghost cells, E. coli x6212 was used as a cloning host. The S. Typhimurium mutant strain JOL1255 was constructed by deleting asd from wild-type S. Typhimurium JOL401 as previously described (24). This strain was used as a host for the delivery of fimbrial antigens. For Western blot assay, JOL1256, S. Typhimurium Dasd (JOL1255) harboring the pMMP81 and pJHLP99 plasmids only, was used as a control. Plasmid pJHLP99 carries a ghost cassette in the pGEM-T Easy vector (25). The ghost cassette was composed of the phiX174 lysis E gene and the phage lpR37-cI857 regulatory system (25) to generate the ghost cell. The cI857 protein turns off the E gene under the control of the PR promoter at temperatures below 30°C, whereas the promoter turns on the gene at temperatures above 42°C (26,27). Plasmid pMMP81 harbors the asd gene (28) and the ompA signal sequence. The genes encoding the fimbrial antigens were cloned into plasmid pMMP81 for expression of the antigens in the JOL1255 strain. All strains were grown in Luria–Bertani (LB) broth (Becton, Dickinson and Company, Sparks, Maryland, USA) or LB agar, and all strains containing the plasmids were grown at 28°C. Diaminopimelic acid (DAP; Sigma-Aldrich, St. Louis, Missouri, USA) was added to the media (50 mg/mL) to facilitate growth of the Asd-negative bacteria, E. coli x6212 and JOL1255 (22,28). Ampicillin (Sigma-Aldrich) was added to the media (100 mg/mL) to facilitate growth of the strains containing plasmid pJHLP99.

Purification of recombinant fimbrial antigens and fimbria-specific antiserum The recombinant K88ab, K88ac, K99, and FasA fimbrial proteins were purified from 4 strains constructed in a previous study (28,29). Briefly, the recombinant proteins were prepared by means of an affinity purification process with nickel-nitrilotriacetic acid agarose (Qiagen, Valencia, California, USA). The identities of the purified antigens were confirmed via electrophoresis on sodium dodecyl

42

The Canadian Journal of Veterinary Research

sulfate-polyacrylamide gel (SDS-PAGE). All purified antigens were stored at −70°C until used. In addition, specific antibodies against the individual fimbrial antigens were prepared according to previously described methods (28). Briefly, New Zealand white rabbits were subcutaneously injected with an emulsion containing approximately 250 mg of each purified recombinant adhesin antigen in 1 mL of sterile phosphate-buffered saline (PBS) and 1 mL of complete Freund adjuvant (Sigma-Aldrich). Two boosters with the same quantity of antigen in incomplete Freund adjuvant (Sigma-Aldrich) were administered 14 and 28 d after primary vaccination. Blood was collected for the preparation of antiserum 14 d after the final injection. Each antigenspecific antibody was stored at −70°C until used.

Cloning of genes encoding the fimbrial antigens The genes encoding the recombinant K88ab, K88ac, K99, and FasA fimbrial antigens were individually cloned into plasmid pMMP81 and then transformed into the E. coli x6212 as previously described, with minor modification (28), and were designated as JOL1279 for K88ab, JOL1280 for K88ac, JOL1281 for K99, and JOL1282 for FasA. The identities of the cloned colonies were confirmed by polymerase chain reaction (PCR) with use of the primers and digestion by the restriction enzymes listed in Table II. For the construction of Salmonella expressing the recombinant fimbrial antigens, the plasmids extracted from JOL1279, JOL1280, JOL1281, and JOL1282 were transformed into the JOL1255 strain as previously described, with minor modification (28). The colonies containing these individual plasmids were selected on LB agar without DAP. Subsequently, the pJHLP99 plasmids were electroporated into the S. Typhimurium Dasd mutant as previously described, with minor modification (22), and were designated as JOL1285 for K88ab, JOL1286 for K88ac, JOL1287 for K99, and JOL1288 for FasA.

Preparation of ghost cells The S. Typhimurium strains used for producing ghost cells were inoculated into 200 mL of LB broth containing 100 mg/mL of ampicillin and the cultures incubated at 28°C with slow agitation to reach an optical density (OD) of 0.3 to 0.4 at 600 nm. Subsequently the temperature was increased to 42°C to induce E-mediated lysis, which

2000;64:0–00

Figure 1. Results of Western blot analysis to identify recombinant K88ab, K88ac, K99, and FasA fimbrial antigens of enterotoxigenic Escherichia coli (ETEC) produced by JOL1285, JOL1286, JOL1287, and JOL1288, respectively, and expressed in the cell envelopes of Salmonella Typhimurium ghost bacteria. Lane c — control for each antigen.

was confirmed by spreading 100 mL of the culture onto LB agar containing 100 mg/mL of ampicillin. If no viable cells were observed after incubation at 28°C for 48 h, lysis was confirmed. Bacterial ghost cells were then harvested by centrifugation at 4000 3 g for 10 min, washed 3 times with sterile PBS, resuspended in PBS, and stored at −20°C (22).

Figure 2. Results of enzyme-linked immunosorbent assay of the reaction between heat-inactivated isolates of K88ab 1, K88ac1, K99, or Fas1 ETEC and serum collected before and after vaccination of rabbits to produce antibodies specific to the recombinant fimbrial antigens. Data are expressed as mean optical density 6 standard deviation (SD) from 3 experiments done in duplicate. Asterisks indicate a significant difference (P , 0.05) between the values before and after vaccination.

Western blot analysis Western blot analysis was done to examine expression of the individual recombinant fimbrial antigens from the JOL1285, JOL1286, JOL1287, and JOL1288 strains, as previously described, with minor modification (28). After lysis of the individual strain-carrying expression vector, the fimbrial antigens were separated by 15% SDS-PAGE and transferred onto polyvinylidene fluoride membranes (Millipore, Billerica, Massachusetts, USA). After overnight blocking with 5% skim milk in PBS containing 0.1% Tween 20 at 4°C, the individual recombinant antigens were incubated with anti-His antibody (Invitrogen, Carlsbad, California, USA) and antiserum from rabbits hyperimmunized with mouse IgG conjugated with horseradish peroxidase (HRP) (Southern Biotech, Birmingham, Alabama, USA). Immunoreactive bands were detected with use of the West-One Western Blot Detection System (iNtRON, Seongnam, South Korea) and the multiwavelength KODAK Image Station 4000MM illumination system (Kodak, New Haven, Connecticut, USA).

Assay of ETEC binding with fimbria-specific antiserum Affinity of the recombinant ETEC fimbrial proteins to the original wild-type E. coli strains was assessed by enzyme-linked immuno­ sorbent assay (ELISA) according to a modification of a method previously described (30). Briefly, plates were coated with approximately 2.5 3 106 cells of heat-inactivated K88ab1, K88ac1, K991, or Fas1 ETEC in PBS and blocked with 200 mL of bovine serum albumin in PBS for 30 min at 37°C. The rabbit antiserum to be used for primary vaccination was added at a concentration of 1:200 to the washed wells, and the plates were incubated at 37°C for 90 min. After 3 washes the plates were treated with HRP-conjugated antiserum from goats hyperimmunized with rabbit IgG (Novus Biologicals, Littleton, Colorado, USA). Enzymatic reactions were produced through the addition of substrate containing o-phenylenediamine (Sigma-Aldrich) and were measured with an automated ELISA

2000;64:0–00

spectrophotometer (Multiskan GO; Thermo Scientific, Waltham, Massachusetts, USA) at 492 nm.

Vaccination of mice and sample collection The 40 BALB/c mice were equally divided into 2 groups and vaccinated at 6 wk of age. The group A mice were intramuscularly inoculated with approximately 1.2 3 108 cells in 100 mL of a mixture of the 4 ghost strains. The group B mice were intramuscularly inoculated with 100 mL of sterile PBS as the control. Blood and fecal samples from 10 mice per group were collected immediately after inoculation and 2, 4, and 6 wk later for determination of serum IgG and fecal IgA concentrations. The fecal samples were weighed and suspended at a concentration of 100 mg/mL in PBS containing 0.1% sodium azide (28). All samples were stored at −70°C until used.

Measurement of humoral immune response A standard ELISA was done on the mouse serum and fecal samples according to the methods previously described (28) to evaluate the humoral immune response against the K88ab, K88ac, K99, and FasA fimbrial antigens. Briefly, Greiner ELISA plates (Microlon, 96W, flat-bottom; Greiner Bio-One, Frickenhausen, Germany) were coated with each purified antigen (500 ng/well) and kept overnight at 4°C. Serum was diluted 1:200 in PBS, and feces were diluted 1:3. The plates were treated with HRP-conjugated antiserum from goats hyperimmunized with mouse IgG or IgA (Southern Biotech). Enzymatic reactions were produced through the addition of substrate containing o-phenylenediamine (Sigma-Aldrich) and were measured by means of an automated ELISA spectrophotometer (TECAN, Salzburg, Austria) at 492 nm. A standard curve was generated to represent the relationship between the concentrations of the standards and their absorbances, and the concentration of antibodies in each sample was determined with the use of this curve. Results of the ELISA were expressed as mean 6 standard deviation (SD).

The Canadian Journal of Veterinary Research

43

Titer (mg/mL)

(mg/mL)

Week after inoculation Figure 3. Antibody responses against the fimbrial antigens: A — serum IgG titers; B — fecal IgA titers. Group A mice (grey bars) were vaccinated with a mixture of the S. Typhimurium ghost cells. Group B mice (white bars) were inoculated with sterile phosphate-buffered saline as a control. Data are expressed as mean titer 6 SD for all mice in each group. Asterisks indicate a significant difference (P , 0.05) between the values for the 2 groups.

Measurement of cell-mediated immune response The splenocyte proliferation assay was done to determine lymphocyte activation and cell-mediated immune responses (31). Spleens from 5 mice per group were collected on day 4 after primary inoculation as previously described (32). The assay was done with the specific antigen as previously described (32,33) but with a slight modification. Briefly, 100 mL of the cell suspension, 5 3 106 cells/mL in complete medium, was incubated in 96-well tissue culture plates with 50 mL of medium alone or medium containing 4 mg/mL of each antigen at 37°C in a humidified 5% CO2 atmosphere for 48 h. The blastogenic response was expressed as the mean stimulation index (SI), which was calculated by dividing the mean OD of the culture stimulated with the antigen by the mean OD of the nonstimulated culture.

Immunohistochemical study For the preparation of tissue, 5 mice in each group were sacrificed on day 2 after primary inoculation. Immunohistochemical study was carried out as previously described (34), with minor modification. Briefly, the small intestine was frozen in Frozen Section Compound (Surgipath FSC22; Leica Microsystem, Wetzlar, Germany). Sections 5 mm thick were cut with a Microm Cryostat HM520 (Thermo Scientific) and stored at −20°C until used. The sections were incubated with 50 mg/mL of K88ab or K88ac antigen, then with polyclonal rabbit IgG against K88ab or K88ac, and finally with 5 mg/mL of antiserum from goats hyperimmunized with rabbit IgG tagged with biotin (BA-1000; Vector Laboratories, Burlingame, California, USA). Next the sections were reacted with 1:200 diluted streptavidin with peroxidase (SA-5004; Vector Laboratories) and washed with PBS. Bound antibody was detected with peroxidase substrate (AEC substrate; Vector Laboratories). The sections were counterstained with hematoxylin and observed for K88ab-specific or K88ac-specific IgA-secreting cells under a light microscope (BX51; Olympus, Tokyo, Japan). With a digital camera (DP72; Olympus) and image software (analysis TS; Olympus), images of immuno­histochemically stained antigen-specific IgA-secreting cells

44

The Canadian Journal of Veterinary Research

Figure 4. Splenocyte proliferative responses against the fimbrial antigens 4 wk after inoculation in the same 2 groups of mice. Data are expressed as mean stimulation index for all mice in each group. Asterisks indicate a significant difference (P , 0.05) between the values for the 2 groups.

in the small intestine were randomly captured, and the number of stained cells (brown cells) was determined by averaging the counts in 10 sections randomly taken from the same section level of each group.

Statistical analysis All data were expressed as the mean 6 SD. The Mann–Whitney U test (SPSS 16.0; SPSS, Chicago, Illinois, USA) was used to determine the significance of differences in immune response between groups of vaccinated and nonvaccinated mice. A P-value # 0.05 was considered statistically significant.

Results From the cell-envelope pellets of the individual ghost constructs, we measured the expected sizes: 29 kDa for K88ab, 27 kDa for K88ac,

2000;64:0–00

20 mm

20 mm

20 mm

20 mm

Figure 5. Representative specimens of small intestine after immunohistochemical testing for K88abspecific (A) or K88ac-specific (B) IgA-secreting cells in the vaccinated (1) and control (2) mice. Arrows indicate cells with positive staining. Scale bar — 20 mm.

Table III. Numbers of antigen-specific IgA-secreting cells in the intestine, as detected by immunohistochemical study, in 2 groups of mice Antigen; mean no. of cells/mm2 6 standard deviation Groupa K88ab K88ac A 2.13 6 1.19b 3.02 6 1.65b B 0.24 6 0.20 0.26 6 0.23 a Group A mice were vaccinated with a mixture of S. Typhimurium ghost cells. Group B mice were inoculated with sterile phosphatebuffered saline as a control. b Significantly different at a P-value # 0.05. 18.2 kDa for K99, and 15 kDa for FasA (Figure 1). The antibodies specific to recombinant K88ab, K88ac, K99, and FasA reacted significantly with the K88ab1, K88ac1, K991, and Fas1 ETEC strains, respectively, in the ELISA (Figure 2). The serum concentrations of IgG against each antigen were significantly higher (P # 0.05) in the group A mice than in the group B mice from week 2 after primary inoculation until the end of the study (Figure 3A). The fecal concentrations of IgA against the individual antigens were also significantly greater (P # 0.05) in the group A mice than in the group B mice, but only in week 2 (Figure 3B). The splenocyte proliferation assay, carried out in week 4 after primary inoculation to evaluate cell-mediated immune responses,

2000;64:0–00

revealed significantly greater (P , 0.05) SIs against K88ab, K88ac, K99, and FasA in the vaccinated group (1.30 6 0.27, 1.30 6 0.21, 1.33 6 0.20, and 1.24 6 0.12, respectively) compared with the control group (0.95 6 0.04, 0.95 6 0.04, 0.92 6 0.05, and 0.94 6 0.04, respectively) (Figure 4). Representative images of the small intestine after immunohistochemical staining for cells secreting IgA against K88ab and K88ac are shown in Figure 5. Tissue sections from the vaccinated group showed many such cells, whereas no cells secreting IgA against any fimbrial antigen were observed in the nonvaccinated group. Table III presents the mean numbers of immunoreactive cells.

Discussion Several formulations of live, killed, and subunit vaccines have been used to attempt to control ETEC infection in piglets (8,28). Inactivated formulations are the most commonly available commercially; however, the current strategies for producing these vaccines can affect the physicochemical and structural properties of the surface antigens, thereby negatively affecting the development of protective immunity (25). In addition, parenteral vaccination with killed bacteria and subunit-based proteins elicits a good serum IgG response but is unable to induce a strong mucosal IgA response (28). Live, attenuated mutants can produce both serum IgG and mucosal IgA immune responses, but major drawbacks include potential reversion to virulence and environmental contamination via fecal

The Canadian Journal of Veterinary Research

45

shedding (35). Thus, new vaccine candidates to protect piglets against ETEC infection are necessary to overcome the drawbacks of the current live and killed bacterial vaccines. In an effort to offer an improved vaccine, we developed Salmonella ghost cells without cytoplasmic components and with ETEC K88ab, K88ac, K99, and FasA fimbrial antigens expressed on the cell envelopes. Notably, this genetic inactivation of the bacteria does not cause any physical or chemical denaturation of the bacterial antigenic structures (36). The intact bacterial surface of the ghost cells represents functional antigenic envelope structures, mimicking the living counterparts in their native state (36). Thus, an advantage of using a bacterial ghost cell is preservation of surface antigens in their native conformations (37). In addition, the proteins expressed in the cell wall of bacteria are highly immunogenic and more readily interact with antigen-presenting cells because of their subcellular location. The translocation of such highly immunogenic antigens into the cell envelope should increase the strength of the immune response (38,39). Several previous studies found that recombinant antigens, such as ETEC fimbriae expressed on the cell surface of attenuated Salmonella vectors, were delivered and successfully elicited immune responses against the antigens (38,39). In the current study, we developed ghost cells using the plasmids pMMP81 and pJHLP99 and S. Typhimurium Dasd as a delivery host. Plasmid pMMP81, an expression vector, was designed to enable an aminoterminal fusion between the first 35 amino acids as a signal sequence of gene ompA and individual fimbrial antigens. Thus, the fimbrial antigens inserted into plasmid pMMP81 can be expressed on Salmonella during incubation at 28°C. In addition, the pJHLP99 ghost vector contains a fusion between the cI857 PR promoter of bacteriophage l and gene E of phiX174 (25). The cI857 protein turns off gene E expression under the control of the PR promoter at temperatures less than 30°C, whereas the promoter turns on the gene at temperatures above 42°C (26,27). Lysis of the Salmonella ghost cells in this study was confirmed by culture on LB agar after incubation at 42°C for 48 h, and expression of the individual fimbrial antigens on the ghost cells was examined by Western blot analysis. Our results indicate that the genes for K88ab, K88ac, K99, and FasA were stably maintained and the fimbrial antigens effectively expressed in the plasmid constructs and that the expressed antigens may be effectively presented to the host animals. Solvent accessibility and flexibility are crucial elements of antigenicity (30). All accessible regions of a protein can potentially be bound by antibodies, and any change in accessibility, surface exposure, and flexibility of residues of an epitope can influence the antigen–antibody interactions (30). In the current study the levels of antibodies specific to the K88ab, K88ac, K99, and FasA fimbrial subunit antigens increased in rabbits after vaccination with the recombinant antigens and the antibodies strongly reacted with the ETEC bacteria carrying K88ab, K88ac, K99, and Fas fimbriae, respectively, in the ELISA, which indicated the potency of the used epitopes. This finding suggests that antiserum against the K88ab, K88ac, K99, or Fas fimbrial subunit can effectively recognize the intact ETEC fimbriae. Our results also showed that the serum concentrations of IgG against K88ab, K88ac, K99, and FasA, as well as the fecal concentrations of IgA, were significantly greater in the mice vaccinated with

46

The Canadian Journal of Veterinary Research

the ghost cells than in the control mice. These data suggest that the fimbrial antigens delivered by the ghost cells are immunogenic, effectively inducing both systemic and mucosal immune responses. The antigen-specific cell-mediated immune response is also an important factor in the prevention of bacterial infection (40) and can be numerically expressed by a measurement of antigen-specific lymphocyte proliferation (32). In this study the antigen-specific lymphocyte populations in splenocytes were examined to gain more insight into the immunologic effect of intramuscular vaccination with the ghost cells. The significant cell-mediated immune response in the vaccinated mice compared with the control mice suggested that our ghost cells are capable of inducing cell-mediated immune responses in addition to the humoral effect. Because ETEC primarily targets the intestinal tract, mucosal immunity is more likely to be involved as a first-line defence than is humoral immunity (40). The mammal mucosal immune response is characterized by an IgA-dominated antibody profile. In particular, the involvement of mucosal IgA in protection against ETEC infection has been well-reported (6,14,15). In the present study we observed by immunohistochemical study a large increase in the number of antigen-specific IgA-secreting cells in the small intestine of the vaccinated mice. This result strongly suggests that the elevated mucosal immune response induced by vaccination with the ghost cells was directly associated with the effective production of IgA in the small intestine. In conclusion, our results indicate that the constructed pJHLP99 lysis plasmid induced gene E-mediated lysis in S. Typhimurium to produce ghost cells and that the ghost cells effectively expressed K88ab, K88ac, FasA, and K99 fimbrial antigens. In addition, the mice vaccinated with the ghost cells showed both humoral and cell-mediated immune responses. Furthermore, the concentration of fecal IgA was significantly increased in the vaccinated mice, and we observed in the same mice a large increase in the number of antigen-specific IgA-secreting cells in the small intestine, which may be associated with an elevated mucosal IgA immune response.

Acknowledgments This study was supported by National Research Foundation of Korea grant 2015R1A2A1A14001011, funded by the Korean government.

References   1. Osek K. Detection of the enteroaggregative Escherichia coli heatstable enterotoxin 1 (EAST1) gene and its relationship with fimbrial and enterotoxin markers in E. coli isolates from pigs with diarrhoea. Vet Microbiol 2003;91:65–72.   2. Liao CW, Lin SH, Lin PY, Chiou HY, Chang WF, Weng CN. Orally administrable enterotoxigenic Escherichia coli vaccine encapsulated by ethylcellulose powder dispersion. Appl Microbiol Biotechnol 2004;65:295–300.   3. Harmsen MM, van Solt CB, Hoogendoorn A, van Zijderveld FG, Niewold TA, van der Meulen J. Escherichia coli F4 fimbriae specific llama single-domain antibody fragments effectively inhibit

2000;64:0–00

bacterial adhesion in vitro but poorly protect against diarrhoea. Vet Microbiol 2005;111:89–98.   4. Vu-Khac H, Holoda E, Pilipcinec E, et al. Serotypes, virulence genes, intimin types and PFGE profiles of Escherichia coli isolated from piglets with diarrhoea in Slovakia. Vet J 2007;174: 176–187.   5. Chen X, Gao S, Jiao X, Liu XF. Prevalence of serogroups and virulence factors of Escherichia coli strains isolated from pigs with postweaning diarrhoea in eastern China. Vet Microbiol 2004; 103:13–20.   6. Remer KA, Barttrow M, Roeger B, Moll H, Sonnenborn U, Oelschlaeger TA. Split immune response after oral vaccination of mice with recombinant Escherichia coli Nissle 1917 expressing fimbrial adhesin K88. Int J Med Microbiol 2009;299:467–478.   7. Nagy B, Fekete PZ. Enterotoxigenic Escherichia coli (ETEC) in farm animals. Vet Res 1999;30:259–284.   8. Haesebrouck F, Pasmans F, Chiers K, Maes D, Ducatelle R, Decostere A. Efficacy of vaccines against bacterial diseases in swine: What can we expect? Vet Microbiol 2004;100:255–268.   9. Puiprom O, Chantaroj S, Gangnonngiw W, et al. Identification of colonization factors of enterotoxigenic Escherichia coli with PCR-based technique. Epidemiol Infect 2010;138:519–524. 10. Morgan RL, Isaacson RE, Moon HW, Brinton CC, To CC. Immu­ nization of suckling pigs against enterotoxigenic E. coli-induced diarrhoeal disease by vaccinating dams with purified 987 or K99 pili: Protection correlates with pilus homology of vaccine and challenge. Infect Immun 1978;22:771–777. 11. Osek J. Prevalence of virulence factors of Escherichia coli strains isolated from diarrheic and healthy piglets after weaning. Vet Microbiol 1999;68:209–217. 12. Kim YJ, Kim JH, Hur J, Lee JH. Isolation of Escherichia coli from piglets in South Korea with diarrhea and characteristics of the virulence genes. Can J Vet Res 2010;74:59–64. 13. Guinee PA, Jansen WH. Behavior of Escherichia coli K antigens K88ab, K88ac, and K88ad in immunoelectrophoresis, double diffusion, and hemagglutination. Infect Immun 1979;23:700–705. 14. Snoeck V, Huyghebaert N, Cox E, et al. Enteric-coated pellets of F4 fimbriae for oral vaccination of suckling piglets against enterotoxigenic Escherichia coli infections. Vet Immunol Immunopathol 2003;96:219–227. 15. Verdonck F, Snoeck V, Goddeeris BM, Cox E. Cholera toxin improves the F4(K88)-specific immune response following oral immunization of pigs with recombinant FaeG. Vet Immunol Immunopathol 2005;103:21–29. 16. Szostak MP, Hensel A, Eko FO, et al. Bacterial ghosts: Non-living candidate vaccines. J Biotechnol 1996;44:161–170. 17. Lubitz W, Witte A, Eko FO, et al. Extended recombinant bacterial ghost system. J Biotechnol 1999;73:261–273. 18. Eko FO, Witte A, Huter V, et al. New strategies for combination vaccines based on the extended recombinant bacterial ghost system. Vaccine 1999;17:13–14. 19. Szostak MP, Lubitz W. Recombinant bacterial ghosts as multi­ vaccine vehicles. In: Channock RM, Ginsberg HS, Brown F, Lerner RA, eds. Vaccines 91: Modern Approaches to New Vaccines Including Prevention of AIDS. New York, New York: Cold Spring Harbor Laboratory Press, 1991:409–414.

2000;64:0–00

20. Chaudhari AA, Jawale CV, Kim SW, Lee JH. Construction of a Salmonella Gallinarum ghost as a novel inactivated vaccine candidate and its protective efficacy against fowl typhoid in chickens. Vet Res 2012;43:44. 21. Galan JE, Nakayama K, Curtiss R, 3rd. Cloning and characterization of the asd gene of Salmonella typhimurium: Use in stable maintenance of recombinant plasmids in Salmonella vaccine strains. Gene 1990;94:29–35. 22. Kang HY, Srinivasan J, Curtiss R, 3rd. Immune responses to recombinant pneumococcal PspA antigen delivered by live attenuated Salmonella enterica serovar Typhimurium vaccine. Infect Immun 2002;70:1739–1749. 23. Branger CG, Torres-Escobar A, Sun W, et al. Oral vaccination with LcrV from Yersinia pestis KIM delivered by live attenuated Salmonella enterica serovar Typhimurium elicits a protective immune response against challenge with Yersinia pseudotuberculosis and Yersinia enterocolitica. Vaccine 2009;27:5363–5370. 24. Hur J, Lee JH. Immunization of pregnant sows with a novel virulence gene deleted live Salmonella vaccine and protection of their suckling piglets against salmonellosis. Vet Microbiol 2010;143:270–276. 25. Jawale CV, Chaudhari AA, Jeon BW, Nandre RM, Lee JH. Characterization of a novel inactivated Salmonella enterica serovar Enteritidis vaccine candidate generated using a modified cI857/ lPR/gene E expression system. Infect Immun 2012;80:1502–1509. Epub 2012 Jan 30. 26. Mayr UB, Walcher P, Azimpour C, Riedmann E, Haller C, Lubitz W. Bacterial ghosts as antigen delivery vehicles. Adv Drug Deliv Rev 2005;57:1381–1391. 27. Walcher P, Cui X, Arrow JA, et al. Bacterial ghosts as a delivery system for zona pellucida-2 fertility control vaccines for brushtail possums (Trichosurus vulpecula). Vaccine 2008;26:6828–6832. 28. Hur J, Lee JH. Immune responses to new vaccine candidates constructed by a live attenuated Salmonella Typhimurium delivery system expressing Escherichia coli F4, F5, F6, F41 and intimin adhesin antigens in a murine model. J Vet Med Sci 2011;73: 1265–1273. Epub 2011 May 30. 29. Hur J, Stein BD, Lee JH. A vaccine candidate for post-weaning diarrhea in swine constructed with a live attenuated Salmonella delivering Escherichia coli K88ab, K88ac, FedA, and FedF fimbrial antigens and its immune responses in a murine model. Can J Vet Res 2012;76:186–194. 30. Savar NS, Dashti A, Darzi Eslam E, Jahanian-Najafabadi A, Jafari A. Antigenicity and immunogenicity of fused B-subunit of heat labile toxin of Escherichia coli and colonization factor antigen I polyepitopes. J Microbiol Methods 2014;106:40–46. 31. Chin’ombe N, Bourn WR, Williamson AL, Shephard EG. An oral recombinant Salmonella enterica serovar Typhimurium mutant elicits systemic antigen-specific CD81 T cell cytokine responses in mice. Gut Pathog 2009;1:9. Epub 2009 Apr 29. 32. Rana N, Kulshreshtha RC. Cell-mediated and humoral immune responses to a virulent plasmid-cured mutant strain of Salmonella enterica serotype Gallinarum in broiler chickens. Vet Microbiol 2006;115:156–162. 33. Matsuda K, Chaudhari AA, Kim SW, Lee KM, Lee JH. Physiology, pathogenicity and immunogenicity of lon and/or

The Canadian Journal of Veterinary Research

47

cpxR deleted mutants of Salmonella Gallinarum as vaccine candidates for fowl typhoid. Vet Res 2010;41:59. Epub 2010 May 21. 34. Shin SJ, Bae JL, Cho YW, et al. Induction of antigen-specific immune responses by oral vaccination with Saccharomyces cerevisiae expressing Actinobacillus pleuropneumoniae ApxIIA. FEMS Immunol Med Microbiol 2005;43:155–164. 35. Kwon HJ, Cho SH. Pathogenicity of SG 9R, a rough vaccine strain against fowl typhoid. Vaccine 2011;29:1311–1318. 36. Jalava K, Hensel A, Szostak M, Resch S, Lubitz W. Bacterial ghosts as vaccine candidates for veterinary applications. J Control Release 2002;85:17–25. 37. Witte A, Wanner G, Sulzner M, Lubitz W. Dynamics of PhiX174 protein E-mediated lysis of Escherichia coli. Arch Microbiol 1992;157:381–388.

48

The Canadian Journal of Veterinary Research

38. Ascón M, Hone DH, Walters N, Pascual DW. Oral immunization with a Salmonella typhimurium vaccine vector expressing recombinant enterotoxigenic Escherichia coli K99 fimbriae elicits elevated antibody titers for protective immunity. Infect Immun 1998;66:5470–5476. 39. Chen H, Schifferli DM. Mucosal and systemic immune responses to chimeric fimbriae expressed by Salmonella enterica serovar Typhimurium vaccine strains. Infect Immun 2000;68:3129–3139. 40. Moyle PM, McGeary RP, Blanchfield JT, Toth I. Mucosal immunisation: Adjuvants and delivery systems. Curr Drug Deliv 2004;1: 385–396.

2000;64:0–00

Generation of Salmonella ghost cells expressing fimbrial antigens of enterotoxigenic Escherichia coli and evaluation of their antigenicity in a murine model.

Des cellules fantômes de Salmonella Typhimurium exprimant les fimbriae K88ab, K88ac, K99, et FasA d’Escherichia coli entérotoxigénique (ETEC) dans leu...
NAN Sizes 0 Downloads 8 Views