Int J Clin Exp Pathol 2015;8(10):13360-13366 www.ijcep.com /ISSN:1936-2625/IJCEP0014688
Original Article Genetic association between PIK3CA gene and oral squamous cell carcinoma: a case control study conducted in Chongqing, China Xiaoxiao Wan1*, Xian Li1*, Junyan Yang2, Wei Lv2, Qiming Wang2, Ying Chen2, Yong Li1 Departments of 1Oral and Maxillofacial Surgery, 2Laboratory Medicine, Chongqing Key Laboratory of Oral Diseases and Biomedical Sciences, Stomatological Hospital of Chongqing Medical University, Chongqing 401147, China. *Equal contributors. Received August 18, 2015; Accepted September 23, 2015; Epub October 1, 2015; Published October 15, 2015 Abstract: PIK3CA has been shown to be involved in many malignant tumors. This study was designed to determine the expression level of PIK3CA in oral squamous cell carcinoma (OSCC) and the association of gene polymorphisms of PIK3CA with OSCC in Chinese population. The expression of PIK3CA was detected by real-time PCR in tumor and pericarcinomatous tissues of 10 OSCC patients. Nine single-nucleotide polymorphisms (SNPs) of PIK3CA (rs1607237, rs17849079, rs2677764, rs2699887, rs4855094, rs4975596, rs6443624, rs7651265 and rs7736074) in blood of 113 OSCC patients and 184 normal controls were genotyped using matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) assay. The gene expression of PIK3CA was significantly higher in tumor tissues of OSCC patients than that in pericarcinomatous tissues (P = 0.012). An increased frequency of the C allele of PIK3CA rs1607237 was observed in OSCC patients as compared with controls; However, the significance was lost after Bonferroni correction (P = 0.048, pc = 0.576). In further stratification analysis, although the frequencies of PIK3CA rs4975596 A allele in male patients and rs1607237 C allele in female patients were increased (P = 0.032, P = 0.020, respectively), the significance was also missing when Bonferroni correction was performed (Pc = 0.384, Pc = 0.24, respectively). The prevalence of other SNPs of PIK3CA did not differ between OSCC patients and controls. The expression of PIK3CA was increased in OSCC tumors; however, none of the nine tested SNPs of PIK3CA was associated with susceptibility to OSCC in the studied population. Keywords: Oral squamous cell carcinoma, PIK3CA, single nucleotide polymorphisms, gene expression, MALDI-TOF MS, RT-PCR
Introduction Oral cancer is a prevalent worldwide malignant tumor, the epidemiological statistics displayed that annual incidence is around 263,000 and the death number is about 128,000 in the world [1-3]. Squamous cell carcinoma is one of the most common pathological types of oral cancer, and it is especially common in China [2, 4]. In recent years, studies of tumor mechanism are gradually deepened, but according to existing results, effective measures for accurate prevention and early diagnosis of OSCC are rare. Due to high recurrence rate and propensity of lymph node metastasis in OSCC, the 5-year survival rate is less than 50%, and the poor prognosis is also hard to accept for patients and their families [5].
Smoking, alcohol drinking and chewing betel nuts are high risk factors to oral squamous cell carcinoma, and they could play a synergistic role in tumor genesis and tumor progression. Every year, the OSCC deaths with former smoking accounted for 42% of worldwide OSCC death tolls, and with former drinking accounted for 16% [6]. Malignant tumor is the result of combined action of many factors. In addition to the above mentioned risk factors, gene factors are also proven to be involved in the pathogenesis of cancers [7]. PIK3CA is located in 3q26.3, encodes 1068 amino acids and produces a 124 kD protein namely PI3K p110 catalytic subunit alpha (PI3K p110α) [8]. PIK3CA was reported to participate in tumorigenesis and development process of
Gene polymorphisms and expression of PIK3CA in oral carcinoma Stomatological Hospital of Chongqing Medical University between August 2013 and November 2014. Gene Primer sequence (5’-3’) Product length (bp) Tm (°C) The diagnosis of OSCC cases were PIK3CA F: CGTTTCTGCTTTGGGACAAC 100 60.67 strictly based on the histopathoR: CCTGATGATGGTCGTGGAG 100 60.05 logical confirmation. Allele and Tm, temperature. genotype frequencies of patients and controls were in accord with cancers as an oncogene [8, 9]. Mutations make the Hardy-Weinberg equilibrium. The study was gene duplication overactive, result in PIK3CA approved by the Local Ethics Research appearing amplification and the enhancive Committee and all the investigated subjects function of PI3K p110α. Through catalytic funcprovided informed consent before collection of tion of PI3K p110α, PIP3 increase, which is an blood and tissues. All procedures were in comimportant medium of activating PI3K/AKT sigpliance with the principles of Declaration of naling pathway. PIP3 is combined with the Helsinki. C-terminal pleckstrin homology (PH) domain of Genotyping phosphoinositide dependence protein kinase 1 (PDK1), activate PDK1. Activated PDK1 phosGenomic DNA was extracted by Tiangen DNA phorylates the 308th threonine of AKT. On this blood genome extraction kit (Tiangen, Beijing, basis, phosphoinositide dependent protein China). The gene polymorphisms were genokinase 2 (PDK2) phosphorylate the 473th sertyped by the Sangon Biotechnology Company ine of AKT. Thus, PI3K/AKT signaling pathway is (Shanghai, China) using matrix-assisted laser activated [10]. desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) assay. Previous studies have shown PI3K/AKT signaling pathway was frequently activated by gene Real-time PCR mutations to promote tumor growth [11]. Furthermore, genetic polymorphisms of PIK3CA All total RNA were extracted from soft tissues were also reported to be associated with head using Takara RNAios Plus (Takara, Dalian, neck squamous cell carcinoma [9], esophageal China), followed by reverse transcription using squamous cell carcinoma [12], non-small cell Takara PrimeScrtipit TM 1st Strand cDNA lung cancer [13], breast cancer [8], endometriSynthesis Kit (Takara, Dalian, China) with one al cancer [14], gastric cancer [15] and rectal micrograms of total RNA. Primers synthesized cancer [16]. Elevated PIK3CA levels have been by Sangon Biotechnology Company (Shanghai, reported in tumor tissues and exacerbated the China) were designed for the amplification of a clinical symptoms of patients with colorectal 100 bp fragment of PIK3CA cDNA (Table 1). cancer, esophageal squamous cell carcinoma Real-time PCR assay was performed on the [17, 18]. Whether PIK3CA is involved in the Biorad CFX ConnectTM. Relative expression levdevelopment of OSCC patients in Chinese Han els were calculated using the 2-ΔΔCt method. population is not yet known and was therefore the subject of the current study. Statistical analysis Table 1. Primer sequences and experimental conditions for the gene expression of PIK3CA analysis
Materials and methods
113 OSCC patients and 184 geographically and ethnically matched normal controls were included in this study for SNP analysis of PIK3CA. Ten pairs of tumor and pericarcinomatous tissues of OSCC patients (6 man and 4 women, with an average age of 53.6 years) were randomly selected for measurement of PIK3CA mRNA expression. Pericarcinomatous tissues were adjacent to carcinoma tissue at least 2 mm. All samples were obtained from the
Hardy-Weinberg equilibrium was evaluated using Chi-square test. The Chi-square test was also used to compare clinical characteristics, genotype and allele frequencies between groups. For genotype analysis, a single genotype vs. the others was used to compare the genotype distribution in controls and patients. In SNP analysis, the p value was corrected by Bonferroni correction and pc