Genotypes and oxacillin resistance of Staphylococcus aureus from chicken and chicken meat in Poland P. Krupa,* J. Bystroń,*1 J. Bania,* M. Podkowik,* J. Empel,† and A. Mroczkowska† *Department of Food Hygiene and Consumer Health Protection, Wrocław University of Environmental and Life Sciences, 50-375 Wroclaw, Poland; and †Department of Epidemiology and Clinical Microbiology, National Medicines Institute, 30/34 Chełmska 00-725 Warsaw, Poland methicillin-resistant S. aureus (MRSA) with oxacillin minimum inhibitory concentrations from 16 to 64 μg/ mL. All MRSA were assigned to spa types belonging to ST398, and included 4 animal spa t011 SCCmecV isolates and 1 meat-derived spa t899, SCCmecIV isolate. Borderline oxacillin-resistant S. aureus (BORSA) isolates, shown to grow on plates containing 2 to 3 μg/ mL of oxacillin, were found within S. aureus isolates from chicken (3 isolates) and from meat (19 isolates). The spa t091 and t084 dominated among BORSA from chicken meat, whereas t548 and t002 were found within animal BORSA. We report for the first time the presence of MRSA in chicken in Poland. We demonstrate that MRSA CC398 could be found in chicken meat indicating potential of introduction of animal-associated genotypes into the food chain. We also report for the first time the possibility of transmission of BORSA isolates from chicken to meat.
Key words: methicillin-resistant Staphyloccus aureus, borderline oxacillin-resistant Staphylococcus aureus, spa types, chicken, poultry meat 2014 Poultry Science 93:3179–3186 http://dx.doi.org/10.3382/ps.2014-04321
INTRODUCTION Some specific Staphylococcus aureus types are regarded as serious pathogens of humans and important bird pathogens (Lowy, 1998; Fitzgerald, 2012). The ability of this microorganism to survive in the presence of β-lactam antibiotics remains the main problem in the therapy (Pinho, 2008). Due to various mechanisms of acquired β-lactam resistance, several resistance phenotypes have been described so far in S. aureus (Chambers, 1997). These include β-lactamase acquisition, modification of penicillin-binding proteins, or acquisition of low-drug-affinity penicillin-binding proteins. ©2014 Poultry Science Association Inc. Received July 10, 2014. Accepted September 26, 2014. 1 Corresponding author: [email protected]
Methicillin-resistant S. aureus (MRSA), which can harbor mecA, or recently discovered mecC gene, are resistant to both cefoxitin and oxacillin (Chambers, 1997; Shore and Coleman, 2013). Borderline oxacillinresistant S. aureus (BORSA) is another, relatively frequent phenotype among S. aureus. Borderline oxacillin-resistant S. aureus are cefoxitin susceptible, do not carry the mecA or mecC genes, but have oxacillin minimum inhibitory concentrations (MIC) between 1 and 8 μg/mL (Chambers, 1997; Shore and Coleman, 2013). Hyperproduction of β-lactamase has been postulated to explain this phenomenon (McDougal and Thornsberry, 1986; Tomasz et al., 1989). Studies on poultry-associated S. aureus carried out around the world revealed limited genetic diversity of this population (Lowder et al., 2009; Mulders et al., 2010). This picture is likely due to the globalization of poultry industry (Manning and Baines, 2004). Most
3179
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
ABSTRACT The genotypes and oxacillin resistance of 263 Staphylococcus aureus isolates cultured from chicken cloacae (n = 138) and chicken meat (n = 125) was analyzed. Fifteen spa types were determined in the studied S. aureus population. Among 5 staphylococcal protein A gene (spa) types detected in S. aureus from chicken, t002, t3478, and t13620 were the most frequent. Staphylococcus aureus isolates from meat were assigned to 14 spa types. Among them, the genotypes t002, t056, t091, t3478, and t13620 were dominant. Except for 4 chicken S. aureus isolates belonging to CC398, the remaining 134 isolates were clustered into multilocus sequence clonal complex (CC) 5. Most of meat-derived isolates were assigned to CC5, CC7, and CC15, and to the newly described spa-CC12954 complex belonging to CC1. Except for t011 (CC398), all other spa types found among chicken isolates were also present in isolates from meat. Four S. aureus isolated from chicken and one from meat were identified as
3180
Krupa et al.
MATERIALS AND METHODS Isolation and Identification of S. aureus Three hundred fifty-eight cloacae swabs were taken in 2013 from chickens in a slaughterhouse located in southwest Poland. The swabs were taken 4 times, approximately 100 swabs per sampling, except one sampling, when 50 swabs were taken and analyzed. The samples were collected from cloacae of hanged chickens before electric stunning. Slaughtered birds originated from 4 local poultry farms, and all samples taken during one sampling session originated from a single farm. Average slaughter capacity was 40,000 chickens per day. One hundred eighty-three chicken meat samples (legs and wings) from the aforementioned slaughterhouse were also examined. The samples (approximately 50) were taken 4 times. Meat was sampled after carcass chilling at the same day when cloacae swabs were taken. The meat samples were packaged in sterile plastic bags and transported up to 2 h to the laboratory. Whole cloacae cotton swabs, and samples from upper arm and thigh muscles cut out in small portions (1 g in total) were cultured in a final volume of 10 mL of Giolitti-Cantoni enrichment broth, and subcultured on Baird-Parker agar. The isolates were identified as S. aureus based on their ability to coagulate rabbit plasma and clumping factor production using commercial tests (Biomed, Cracow, Poland). The assays were performed according to manufacturer instructions. All 263 isolates were screened by PCR using S. aureus-specific primers
for nuc gene, encoding thermonuclease (Martin et al., 2003; Table 1). Reference S. aureus strain ATCC 29213 served as a positive control for thermonuclease, while reference S. epidermidis strain ATCC 35984 served as a negative control. One S. aureus isolate per sample/ swab was taken for further characterization.
Preparation of Bacterial DNA Two milliliters of bacterial cell suspension from an overnight culture grown in brain-heart infusion broth were centrifuged for 5 min at 12,000 × g at room temperature and suspended in 100 μL of 100 mM Tris-HCl buffer, pH 7.4, containing 10 μg of lysostaphin (A&A Biotechnology, Gdańsk, Poland). After 30 min of incubation at 37°C, 10 μL of 10% SDS was added and the sample was incubated for another 30 min at 37°C. Two hundred microliters of 5 M guanidine hydrochloride was added, and the sample was mixed by vortexing and incubated at room temperature for 10 min. The DNA was extracted by phenol and chloroform, precipitated with ethanol, and suspended in water (Bania et al., 2006).
Detection of mecA and Determination of SCCmec Cassette Type All S. aureus isolates were tested for the presence of mecA gene using the primers described by Milheirico et al. (2007; Table 1). Each PCR run contained mecApositive (S. aureus ATCC 43300) and negative (S. aureus ATCC 29213) strains as controls. The SCCmec cassette type was determined according to Milheirico et al. (2007; Table 1). The PCR products were electrophoretically resolved in 1.5% agarose containing 0.5 μg/ mL of ethidium bromide and photographed with the GelDocXR System (Bio-Rad, Hercules, CA).
Antibiotic Resistance and Oxacillin MIC Determination in mecA-Positive S. aureus Susceptibility of mecA-positive S. aureus isolates to penicillin G (10 units/disc), cefoxitin (30 μg/disc), tetracycline (30 μg/disc), clindamycin (2 μg/disc), gentamicin (10 μg/disc), erythromycin (15 μg/disc), ciprofloxacin (5 μg/disc), norfloxacin (10 μg/disc), and vancomycin (30 μg/disc; all substances from Oxoid Ltd., Basingstoke, United Kingdom) was tested by the disc diffusion method and interpreted according to CLSI document M100-S22 (CLSI, 2012). The MIC for oxacillin was determined with the E-test and interpreted according to the manufacturer’s instructions (bio-Mérieux Inc., Marcy l’Etoile, France). Reference S. aureus strains ATCC 25923 (used for the disc diffusion method), ATCC 43300, and ATCC 29213 (used for MIC testing) served as controls.
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
reports on poultry S. aureus were concentrated on genotypes of MRSA. It was shown that the majority of MRSA belonged to 2 clonal complexes (CC), CC398 and CC5 (Lowder et al., 2009; Mulders et al., 2010; Geenen et al., 2013; Vandendriessche et al., 2014). Knowledge on population structure of methicillin-susceptible S. aureus (MSSA) from poultry is scarce. Evidence for multiple, independent acquisition of methicillin resistance by MSSA associated with animal breeding enforces the research on revealing the structure of this population (Fitzgerald, 2012). Research on genetic diversity of poultry MSSA may allow for identification of new clones potentially contributing to emergence of community-acquired staphylococcal infections (Fitzgerald, 2012). Genotyping of staphylococcal protein A gene (spa), first introduced by Harmsen et al. (2003), was shown to be strongly associated with the results of multilocus sequence typing, allowing for reliable genotypic characterization of S. aureus populations (Strommenger et al., 2006). The aim of this work was to determine the population structure of S. aureus isolates derived from chicken and chicken meat, based on spa typing, with emphasis on detection of oxacillin-resistant isolates (i.e., BORSA and MRSA).
3181
STAPHYLOCOCCUS AUREUS FROM CHICKEN IN POLAND Table 1. Primers used in this study Target1
Primer sequence
Reference
mecA
mecAP4 5′ TCCAGATTACAACTTCACCAGG 3′ mecAP7 5′ CCACTTCATATCTTGTAACG 3′ mecA_LGA251rev 5′ CCTGAATCWGCTAATAATATTTC 3′ mecA_LGA251for 5′ TCACCAGGTTCAACYCAAAA 3′ nuc-for 5′ GAAGATCCAACAGTATATAGTGC 3′ nuc-rev 5′ ATTGACCTGAATCAGCGTTGTCTT 3′ CIF2 F2 5′ TTCGAGTTGCTGATGAAGAAGG 3′ CIF2 R2 5′ ATTTACCACAAGGACTACCAGC 3′ ccrC F2 5′ GTACTCGTTACAATGTTTGG 3′ ccrC R2 5′ ATAATGGCTTCATGCTTACC 3′ RIF5 F10 5′ TTCTTAAGTACACGCTGAATCG 3′ RIF5 R13 5′ATGGAGATGAATTACAAGGG 3′ SCCmec V J1 F 5′ TTCTCCATTCTTGTTCATCC 3′ SCCmec V J1 R 5′ AGAGACTACTGACTTAAGTGG 3′ dcs F2 5′ CATCCTATGATAGCTTGGTC 3′ dcs R1 5′ CTAAATCATAGCCATGACCG 3′ ccrB2 F2 5′ AGTTTCTCAGAATTCGAACG 3′ ccrB2 R2 5′ CCGATATAGAAWGGGTTAGC 3′ kdp F1 5′ AATCATCTGCCATTGGTGATGC 3′ kdp R1 5′ CGAATGAAGTGAAAGAAAGTGG 3′ SCCmec III J1 F 5′ CATTTGTGAAACACAGTACG 3′ SCCmec III J1 R 5′ GTTATTGAGACTCCTAAAGC 3′ mecI P2 5′ ATCAAGACTTGCATTCAGGC 3′ mecI P3 5′ GCGGTTTCAATTCACTTGTC 3′ arc up 5′ TTGATTCACCAGCGCGTATTGTC 3′ arc dn 5′ AGGTATCTGCTTCAATCAGCG 3′ aro up 5′ ATCGGAAATCCTATTTCACATTC 3′ aro dn 5′ GGTGTTGTATTAATAACGATATC 3′ glp up 5′ CTAGGAACTGCAATCTTAATCC 3′ glp dn 5′ TGGTAAAATCGCATGTCCAATTC 3′ gmk up 5′ ATCGTTTTATCGGGACCATC 3′ gmk dn 5′ TCATTAACTACAACGTAATCGTA 3′ pta up 5′ GTTAAAATCGTATTACCTGAAGG 3′ pta dn 5′ GACCCTTTTGTTGAAAAGCTTAA 3′ tpi up 5′ TCGTTCATTCTGAACGTCGTGAA 3′ tpi dn 5′ TTTGCACCTTCTAACAATTGTAC 3′ yqi up 5′ CAGCATACAGGACACCTATTGGC 3′ yqi dn 5′ CGTTGAGGAATCGATACTGGAAC 3′ blaZ- 1 5′ACTTCAACACCTGCTGCTTTC 3′ blaZ- 2 5′ TGACCACTTTTATCAGCAACC 3′ 1095F 5′ AGACGATCCTTCGGTGAGC 3′ 1517R 5′ GCTTTTGCAATGTCATTTACTG 3′
Milheirico et al., 2007
mecC nuc SCCmec type
blaZ spa
Martin et al., 2003 Milheirico et al., 2007
http://www.mlst.net/
Rizzotti et al., 2005 Harmsen et al., 2003
1mecA = penicillin-binding protein 2a encoding gene; mecC = mecA homologue; nuc = thermonuclease encoding gene; SCCmec type = staphylococcal cassette chromosome mec type; ST = sequence type; blaZ = beta-lactamase encoding gene; spa = staphylococcal protein A gene.
Detection of Borderline Oxacillin Resistant S. aureus (BORSA)
for hyperproduction of β-lactamase using Cefinase test (bio-Mérieux Inc.).
All mecA-negative S. aureus isolates were plated on oxacillin resistance screening agar (ORSA, Oxoid Ltd.) plates containing 2, 3, and 4 μg/mL of oxacillin, respectively. The results were recorded after 24 and 48 h of incubation at 35°C and interpreted according to the manufacturer’s instructions. For isolates able to grow in medium containing 3 and 4 μg/mL of oxacillin, MIC for oxacillin was determined using the E-test (bio-Mérieux Inc.). Reference MRSA (ATCC 43300) and MSSA (ATCC 29213) strains served as controls. All phenotypically oxacillin-resistant isolates were analyzed for susceptibility to amoxicillin with clavulanic acid (20/10 μg/disc) by the disk-diffusion method and interpreted according to CLSI document M100-S22 (CLSI, 2012). Reference Escherichia coli ATCC 35218 strain served as the control. All BORSA isolates were screened for blaZ gene according to Rizzotti et al. (2005; Table 1) and
Detection of mecC Because low oxacillin resistance of some S. aureus strains can also be explained by possession of the mecC gene, all mecA-negative S. aureus isolates able to grow on ORSA plates containing 2 μg/mL of oxacillin were tested for mecC using the primers described by Cuny et al. (2011; Table 1). The DNA from mecC-positive S. aureus strain 1140/12, from the National Medicines Institute, Warsaw, Poland, served as a control.
Determination of spa Type and ST The spa types of all S. aureus isolates were determined according to Harmsen et al. (2003; Table 1). The nucleotide sequencing of the repeat-containing region
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
ST
Cuny et al., 2011
3182
Krupa et al.
Table 2. Staphylococcal protein A gene (spa) types of Staphylococcus aureus isolates from chicken cloacae swabs and chicken meat Cloacae swabs Number of samples
Number of isolates (% of samples)
Sampling I
107
12 (11)
Sampling II
101
4 (4)
Sampling III Sampling IV
100 50
93 (93) 29 (58)
Total
358
138 (38)
Sampling
spa types (n and % of total isolates)
Chicken meat Number of samples
Number of isolates (% of samples)
t3478 (8), t011 (4)
51
34 (67)
t3478 (4)
54
28 (52)
t002 (93) t13620 (25), t548 (4)
48 30
35 (73) 28 (93)
183
125 (68)
t002 (93; 67%), t13620 (25; 18%), t3478 (12; 9%), t011 (4; 3%), t011 (4; 3%)
Detection of Staphylococcal Protein A Staphylococcal protein A (SpA) was detected in culture supernatants from 9 BORSA isolates assigned to CC5 [i.e., t548 (4 isolates), t002 (3 isolates), and t3478 (2 isolates)]. For this 2 mL of bacterial overnight culture in brain-heart infusion broth was centrifuged for 5 min at 12,000 × g at room temperature. Twenty-microliter portions of culture medium were resolved on SDSPAGE. Western immunoblots were probed with polyclonal antibody against SpA (Sigma-Aldrich, Poznań, Poland). Anti-rabbit-HRP (Sigma-Aldrich) was used as a secondary antibody. The blots were developed using the ECL Lumi-LightPLUS substrate (Roche, Warsaw, Poland), according to the manufacturer’s instructions. Two human S. aureus strains belonging to CC5 [i.e., 2,249/05 (t041) and 1,034/05 (t002) from National
t3478 (17), t056 (9), t091 (3), t084 (2), t002 (1), t4386 (1), t267 (1) t056 (11), t091 (6), t084 (4), t3478 (2), t012 (2), t899 (1), t7287 (1), t267 (1) t002 (32), t888 (2), t1187 (1) t13620 (17), t548 (7), t3478 (3), t056 (1) t002 (33; 26%), t3478 (22; 18%), t056 (21; 17%), t13620 (17; 14%), t091 (9; 7%), t548 (7; 6%), t084 (6; 5%), t012 (2; 2%), t888 (2; 2%), t267 (2; 2%), t4386 (1; 1%), t899 (1; 1%), t7287 (1; 1%), t1187 (1; 1%)
Medicines Institute, Warsaw, Poland] served as positive controls.
RESULTS Frequency of S. aureus Isolates In total, 263 S. aureus isolates were obtained, including isolates from cloacae swabs and meat samples. The prevalence of S. aureus was different in chickens and meat samples. The bacterium was found in 138 (38%) from a total of 358 cloacae swabs and in 125 (68%) from 183 meat samples. The incidence of S. aureus ranged from 4 to 93% in animals and from 52 to 93% in meat samples (Table 2).
Genotypes of S. aureus Isolates Fifteen different spa types were determined in the studied S. aureus population. Staphylococcus aureus isolates obtained from animals were classified into 5 spa types. Most of isolates were assigned to t002 (67%), t13620 (18%), and t3478 (9%; Table 2). Staphylococcus aureus isolates from chicken meat were assigned to 14 spa types. Among them isolates belonging to t002 (26%), t3478 (18%), t056 (17%), t13620 (14%), and t091 (7%) were dominant (Table 2). Except 4 animal isolates belonging to spa t011, all other genotypes found within isolates from chicken i.e., t002, t548, t3478, and t13620, were also present in food (Tables 2 and 3). The spa types t002, t3478, and t13620 were frequently isolated both from animals and meat. In contrast, genotype t548 occurred sporadically in chickens (2.9%) and meat (5.6%). Among 14 spa types found in meat, 10 were not detected in animals (Tables 2 and 3). Genotypes of 134 isolates from chicken were clustered into spa-CC002 complex, belonging to ST-CC5 (Table 3). The remaining 4 animal isolates represented
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
of the spa gene was performed from both DNA strands of the PCR product by Genomed (Warsaw, Poland), using a BigDye Terminator Ready Reaction Cycle Sequencing kit. The analysis of repeats and the assignment of spa types were performed with the resources of the Ridom SpaServer (http://spa.ridom.de). Grouping of spa types was done using BURP, Ridom Staphtype Software. The spa-types were clustered if cost between members of the group was less than or equal to 4. The spa types shorter than 5 repeats (1 isolate) were excluded from analysis (Mellmann et al., 2007). Sequence types (ST) of selected S. aureus isolates (4 isolates from cloacae swabs, representing spa types t002, t548, t3478, and t13620, as well as 7 isolates from meat, representing t002, t012, t548, t899, t3478, t7287, and t13620) were determined according to Enright et al. (2000; Table 1). The sequences obtained from both strands of the PCR product were analyzed using BioEdit software (http://www.mbio.ncsu.edu/bioedit/), and further assignment of the ST was performed using the mlst.net platform.
spa types (n and % of total isolates)
STAPHYLOCOCCUS AUREUS FROM CHICKEN IN POLAND
3183
Table 3. Clonal staphylococcal protein A gene (spa) complexes of Staphylococcus aureus isolates from chicken cloacae swabs and chicken meat Cluster
spa
spa-CC
1 1 1 1 Singleton Singleton Singleton Singleton Singleton Singleton Singleton Singleton Singleton Singleton Excluded Total spa
t002 t13620 t3478 t548 t056 t091 t084 t011 t888 t012 t267 t1187 t899 t7287 t4386 15
spa-CC spa-CC spa-CC spa-CC
MLST-CC 002 002 002 002
CC51 CC51 CC51 CC51 CC101 CC7 CC15 CC398 CC12 CC301 CC97 CC8 CC3981 CC71 CC121 Total isolates
n 126 42 34 11 21 9 6 4 2 2 2 1 1 1 1 263
Origin Cloacae swab (n Cloacae swab (n Cloacae swab (n Cloacae swab (n Chicken meat Chicken meat Chicken meat Cloacae swab Chicken meat Chicken meat Chicken meat Chicken meat Chicken meat Chicken meat Chicken meat
= = = =
93) and chicken meat (n = 33) 25) and chicken meat (n = 17) 12) and chicken meat (n = 22) 4) and chicken meat (n = 7)
t011 genotype within ST-CC398. Similarly, most of the meat-derived S. aureus isolates (63%) were clustered into spa-CC002. The other isolates representing 10 different spa types did not group into complexes (Table 3). Among them t056 (ST101), t084 (ST15), and t091 (ST7) genotypes were the most numerous (Table 3).
Characterization of MRSA Isolates Four (2.9%) S. aureus isolates from animals and one (0.8%) isolate from meat were classified as MRSA. All of them were assigned to ST398. All chicken-derived MRSA were isolated during one sampling session, whereas MRSA from meat was isolated during another sampling session. During this sampling, MRSA were not found in animals. All MRSA were mecA-positive, mecC-negative, and resistant to cefoxitin in the disc diffusion method. The isolates were resistant to oxacillin with MIC ranging from 16 to 64 μg/mL. All of the MRSA isolates were resistant at least to 6 out of 9 antibiotics tested (Table 4).
Characterization of BORSA Isolates Three (2.2%) S. aureus isolates from chicken and 19 (15.2%) from meat exhibited borderline resistance to oxacillin (Table 5). All of them were mecA and mecC negative, susceptible to cefoxitin and amoxicillin with clavulanic acid and able to grow on ORSA plates containing 2 μg/mL of oxacillin. Two isolates grew on 3 μg/mL of ORSA medium. None of the BORSA isolates were able to be grown on 4 μg/mL of ORSA plates. Oxacillin MIC was 3 μg/mL for isolates able to grow on 3 μg/mL of oxacillin. Thirteen BORSA isolates were positive in the Cefinase test and harbored the blaZ gene. The spa t091 and t084 were found to dominate among BORSA isolates (Table 5). Staphylococcus aureus belonging to poultry CC5 lineage, recently diverging from CC5 human lineage, was shown to contain mutations
resulting in loss of function of some proteins, including SpA. To determinate whether our isolates belong to poultry or human ST5 lineage, all 9 BORSA isolates assigned to ST5 were probed for protein A (SpA) production. Immunoblotting with anti-SpA antibody revealed that in poultry ST5 culture supernatants, no SpA could be detected, in contrast to 2 human S. aureus CC5 strains in which a strong 50-kDa band was present (Figure 1).
DISCUSSION Diversity of animal breeding models is thought to have an effect on the structure of the S. aureus population (Fitzgerald, 2012). The majority of poultry production is concentrated in a limited number of holdings. Accordingly, the observed diversity of S. aureus population was shown to be limited in poultry (Fitzgerald, 2012). Our data indicate 38% mean incidence of S. aureus in chicken and 68% in chicken meat. However, it should be stressed that depending on sampling it varied from 4 to 93% in chickens and from 66 to 93% in meat indicating significant variation in S. aureus occurrence among farms. To date, most research on incidence of S. aureus in poultry has focused on MRSA (Nemati et al., 2008; Mulders et al., 2010; Wendlandt et al., 2013). We detected MRSA in 4 animals and in 1 meat sample only. As in our previous works, low frequency of MRSA isolates in food of animal origin was confirmed (Bystroń et al., 2010a,b). The presence of MRSA in chicken is for the first time reported in Poland. Studies on poultry MRSA carried out around the world have shown that majority of their isolates belong to 2 clonal complexes, CC398 and CC5 (Lowder et al., 2009; Mulders et al., 2010; Geenen et al., 2013). The MRSA detected by us in animals and in chicken meat assigned to spa t011 and t899, respectively, are known
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
1Multilocus sequence-clonal complexes (MLST-CC) marked with footnote 1 were determined in this study as described by Enright et al. (2000). For the remaining MLST-CC, associations with the particular spa types were assessed through the Ridom SpaServer (http://spa.ridom.de), or from the relevant literature.
3184
Krupa et al.
Table 4. Characterization of chicken-derived methicillin-resistant Staphylococcus aureus isolates with the resistance percentage for antibiotics Source/number of isolates
spa type
ST1
SCCmec type
Cloacae swab/4 Chicken meat/1
t011 t899
ST398 ST398
V IV
Antibiotic resistance3 (%)
MIC2 for oxacillin (μg/mL)
P
CE
T
CL
G
E
CI
N
V
16–24 64
100 100
100 100
100 100
100 100
100 100
100 100
100 0
100 0
0 0
1ST
= sequence type. = minimum inhibitory concentration. 3Disc diffusion method, P = penicillin G (10 units/disc), CE = cefoxitin (30 μg/disc), T = tetracycline (30 μg/disc), CL = clindamycin (2 μg/ disc), G = gentamicin (10 μg/disc), E = erythromycin (15 μg/disc), CI = ciprofloxacin (5 μg/disc), N = norfloxacin (10 μg/disc), V = vancomycin (30 μg/disc). 2MIC
associated lineages distributed worldwide (Fitzgerald, 2012). Studies on genotypic structure of poultry-associated MSSA are scarce (Vandendriessche et al., 2014). In our earlier study, we showed that majority of MSSA isolates from diseased turkeys belonged to CC398, and from diseased chickens to CC5 (Bystroń et al., 2010b). In the present work, most of the MSSA isolates (81%), from the chickens and chicken meat were assigned to CC5 complex, with the t002 being the predominant genotype. All chicken-derived isolates representing CC5 were also detected in meat. The CC5 MSSA dominated among healthy poultry in Belgium (Vandendriessche et al., 2014), and in chicken-derived MSSA in China (Ho et al., 2012). Also, previous observations by Lowder et al. (2009) indicate that the majority of S. aureus isolates from diseased and healthy poultry from Belgium, Denmark, Japan, the United Kingdom, and the United States belonged to a single clonal complex CC5 or its single locus variants ST1342, ST1346, and ST1350. The t091 and t084 MSSA representing genotypes belonging to CC7, and CC15, respectively, consequently occurred in meat samples studied here. To date these genotypes have been isolated only from humans (Rolo et al., 2012), but recently were found also in broilers (Vandendriessche et al., 2014). Isolates belonging to CC8, CC12, CC30, CC97, and CC121 were exclusively detected in meat. Whereas CC30 was already noted
Table 5. Characteristics of borderline oxacillin-resistant Staphylococcus aureus isolates from chicken cloacae swabs and chicken meat Cloacae swab
Chicken meat Number of isolates
Item
spa type
blaZ gene
Cefinase test
Oxacillin concentration permitting bacterial growth, μg/mL 3
0
t548 t002
— —
— —
2 1
2
Total
3
spa type
blaZ gene
Cefinase test
t012 t084 t091 t091 t084 t002 t3478 t548 t548 t012
+ + + − + − − + − +
+ + + − + − − + − +
Number of isolates
1 1 5 1 4 2 2 1 1 1 19
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
to belong to livestock-associated CC398 (Feßler et al., 2011; Argudin et al., 2013). The CC398 isolates, represented mainly by spa t011 and t034, were the most common MRSA isolated from the chicken and turkey products in Germany (Feßler et al., 2011). Our results demonstrate that MRSA CC398 isolates could be found in chicken meat, indicating risk of introduction of animal-associated genotypes into the food chain. A survey on MRSA from broilers in Belgium showed that they belonged primarily to the spa types t011 and t1456 within CC398 (Nemati et al., 2008; Persoons et al., 2009). The ST398 was found to predominate among MRSA isolated from broilers in the Netherlands, although 28% of isolates belonged to ST9 (Mulders et al., 2010). Investigation of broiler throat samples and dust samples in Dutch farms revealed MRSA isolates belonging to CC398, with the t011 and t034 being the predominant genotypes (Geenen et al., 2013; Wendlandt et al., 2013). In Germany, most of the MRSA isolated from diseased turkeys and chickens were classified to CC398. These genotypes dominated also within MSSA from turkey, whereas CC5 was commonly found in chicken (Monecke et al., 2013). Similarly, MRSA and MSSA derived from diseased turkeys in France were represented mainly by CC398 (Argudin et al., 2013), and CC5 was the most common complex among MSSA from poultry infections in Denmark (Hasman et al., 2010). The CC5 is one of the most successful human-
STAPHYLOCOCCUS AUREUS FROM CHICKEN IN POLAND
Figure 1. Expression of staphylococcal protein A (SpA) in clonal complex 5 (CC5) borderline oxacillin-resistant Staphylococcus aureus (BORSA) isolates. On lines 1 to 9, culture supernatants from BORSA isolates from chicken cloacae and chicken meat were resolved. On lines 10 and 11, culture supernatants from 2 human S. aureus strains belonging to CC5 were resolved. The immunoblots were probed with polyclonal antibody against SpA.
of function of some proteins, which does not promote the pathogen’s fitness in poultry (Lowder et al., 2009). In all the 9 ST5 BORSA isolates from chicken and meat, SpA could not be detected, meaning they likely represent poultry-associated ST5 clade. This, in turn, can illustrate the possibility of transmission of animalassociated, oxacillin-resistant S. aureus isolates to food. Taking together, we report for the first time the presence of MRSA in chicken in Poland. We demonstrate that MRSA CC398 could be found in chicken meat, indicating potential of introduction of animal-associated genotypes into food chain. We also report for the first time the possibility of transmission of BORSA isolates from chicken to meat.
ACKNOWLEDGMENTS This work was financially supported by the National Science Centre, Poland, decision number 2581/B/ P01/2011/40.
REFERENCES Argudin, M. A., N. Cariou, O. Salandre, J. Le Guennec, S. Nemeghaire, and P. Butaye. 2013. Genotyping and antimicrobial resistance of Staphylococcus aureus isolates from diseased turkeys. Avian Pathol. 42:572–580. Balslev, U., A. Bremmelgaard, E. Svejgaard, J. Havstreym, and H. Westh. 2005. An outbreak of borderline oxacillin-resistant Staphylococcus aureus (BORSA) in a dermatological unit. Microb. Drug Resist. 11:78–81. Bania, J., A. Dabrowska, J. Bystron, K. Korzekwa, J. Chrzanowska, and J. Molenda. 2006. Distribution of newly described enterotoxin-like genes in Staphylococcus aureus from food. Int. J. Food Microbiol. 108:36–41. Bystroń, J., M. Podkowik, K. Korzekwa, E. Lis, J. Molenda, and J. Bania. 2010a. Characterization of borderline oxacillin-resistant Staphylococcus aureus isolated from food of animal origin. J. Food Prot. 73:1325–1327. Bystroń, J., M. Podkowik, T. Piasecki, A. Wieliczko, J. Molenda, and J. Bania. 2010b. Genotypes and enterotoxin gene content of S. aureus isolates from poultry. Vet. Microbiol. 144:498–501. Chambers, H. F. 1997. Methicillin resistance in staphylococci: Molecular and biochemical basis and clinical implications. Clin. Microbiol. Rev. 10:781–791. CLSI. 2012. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-second Informational Supplement. Clinical and Laboratory Standards Institute, Wayne, PA, USA. Document M100–S22. Cuny, C., F. Layer, B. Strommenger, and W. Witte. 2011. Rare occurrence of methicillin-resistant Staphylococcus aureus CC130 with a novel mecA homologue in humans in Germany. PLoS ONE 6:e24360. Enright, M. C., N. P. J. Day, C. E. Davies, S. J. Peacock, and B. G. Spratt. 2000. Multilocus sequence typing for the characterization of methicillin-resistant (MRSA) and methicillin-susceptible (MSSA) clones of Staphylococcus aureus. J. Clin. Microbiol. 38:1008–1015. Feßler, A. T., K. Kadlec, M. Hassel, T. Hauschild, C. Eidam, R. Ehricht, S. Monecke, and S. Schwarz. 2011. Characterization of methicillin-resistant Staphylococcus aureus isolates from food and food products of poultry origin in Germany. Appl. Environ. Microbiol. 77:7151–7157. Fitzgerald, J. 2012. Livestock-associated Staphylococcus aureus: Origin, evolution and public health threat. Trends Microbiol. 20:192–198. Geenen, P. L., E. A. Graat, A. Haenen, P. D. Hengeveld, A. H. Van Hoek, X. W. Huijsdens, C. C. Kappert, G. A. Lammers, E.
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
in animals (Hasman et al., 2010), isolation of other clones have been reported mainly in humans (Rolo et al., 2012). These isolates occurred only in meat, not in chicken investigated here, suggesting additional, most likely human source of meat contamination. Borderline oxacillin-resistant S. aureus (McDougal and Thornsberry, 1986) is mecA-negative but exhibits low-level resistance to penicillinase-resistant penicillins. The BORSA occur among human clinical isolates with about 5% frequency. They have been involved in several community-acquired and hospital infections (Kernodle et al., 1998; Suggs et al., 1999; Balslev et al., 2005). Borderline oxacillin-resistant S. aureus has already been detected in ruminant milk (Bystroń et al., 2010a; Perillo et al., 2012). Cows seem to be the only animal species in which incidence of BORSA was reported (Kaszanyitzky et al., 2004). Genotypic structure of human BORSA population is largely unknown, and there are no data on animal BORSA genotypes. In the current study, 3 and 19 BORSA isolates from chicken and meat were identified, respectively. The isolates had oxacillin resistance typical for BORSA, with MIC value of 3 μg/mL. Thirteen isolates (60%) were susceptible to amoxicillin with clavulanic acid, positive in Cefinase test, and harbored blaZ gene, showing that their BORSA phenotype was due to the β-lactamase hyperproduction. Remaining 9 isolates were blaZ-negative, unable to grow in the presence of clavulanic acid, and to inactivate cephalosporin in Cefinase test, suggesting production of another kind of β-lactamase, likely a methicillinase (Perillo et al., 2012). All animal BORSA isolates and 32% of meat isolates were assigned to CC5. Remaining meat-derived BORSA isolates were classified to CC7 (32%), CC15 (26%), and CC30 (10%) complexes. It was shown that the poultry CC5 lineage has recently diverged from CC5 human lineage being the result of a single, human-to-poultry host jump. During this event, poultry ST5 acquired novel genetic elements not identified earlier among human S. aureus isolates. It also accumulated mutations, resulting in loss
3185
3186
Krupa et al. broiler flocks and risk factors for slaughterhouse personnel in The Netherlands. Epidemiol. Infect. 138:743–755. Nemati, M., K. Hermans, U. Lipinska, O. Denis, A. Deplano, M. Struelens, L. A. Devriese, F. Pasmans, and F. Haesebrouck. 2008. Antimicrobial resistance of old and recent Staphylococcus aureus isolates from poultry: First detection of livestock-associated methicillin-resistant strain ST398. Antimicrob. Agents Chemother. 52:3817–3819. Perillo, J., D. Ceccarelli, M. Spagnoletti, S. Lollai, P. Cappuccinelli, and M. M. Colombo. 2012. Molecular characterization of enterotoxigenic and borderline oxacillin resistant Staphylococcus aureus from ovine milk. Food Microbiol. 32:265–273. Persoons, D., S. Van Hoorebeke, K. Hermans, P. Butaye, A. de Kruif, F. Haesebrouck, and J. Dewulf. 2009. Methicillin-resistant Staphylococcus aureus in poultry. Emerg. Infect. Dis. 15:452–453. Pinho, M. G. 2008. Mechanisms of β-lactam and glycopeptide resistance in Staphylococcus aureus. Pages 207–227 in Staphylococcus Molecular Genetics. Caister Academic Press, Norfolk, UK. Rizzotti, L., D. Simeoni, P. Cocconcelli, S. Gazzola, F. Dellaglio, and S. Torriani. 2005. Contribution of enterococci to the spread of antibiotic resistance in the production chain of swine meat commodities. J. Food Prot. 68:955–965. Rolo, J., M. Miragaia, A. Turlej-Rogacka, J. Empel, O. Bouchami, N. A. Faria, A. Tavares, W. Hryniewicz, A. C. Fluit, H. de Lencastre, and CONCORD Working Group. 2012. High genetic diversity among community-associated Staphylococcus aureus in Europe: Results from a multicenter study. PLoS ONE 7:e34768. Shore, A. C., and D. C. Coleman. 2013. Staphylococcal cassette chromosome mec: Recent advances and new insights. Int. J. Med. Microbiol. 303:350–359. Strommenger, B., C. Kettlitz, T. Weniger, D. Harmsen, A. W. Friedrich, and W. Witte. 2006. Assignment of Staphylococcus isolates to groups by spa typing, SmaI macrorestriction analysis, and multilocus sequence typing. J. Clin. Microbiol. 44:2533–2540. Suggs, A. H., M. C. Maranan, S. Boyle-Vavra, and R. S. Daum. 1999. Methicillin-resistant and borderline methicillin-resistant asymptomatic Staphylococcus aureus colonization in children without identifiable risk factors. Pediatr. Infect. Dis. J. 18:410–414. Tomasz, A., H. B. Drugeon, H. M. Lencastre, D. Jabes, L. McDougal, and J. Bille. 1989. New mechanism for methicillin resistance in Staphylococcus aureus: Clinical isolates that lack the PBP2a gene and contain normal penicillin-binding proteins with modified penicillin binding capacity. Antimicrob. Agents Chemother. 33:1869–1874. Vandendriessche, S., W. Vanderhaeghen, J. Larsen, R. Mendonca, M. Hallin, P. Butaye, K. Hermans, F. Haesebrouck, and O. Denis. 2014. High genetic diversity of methicillin-susceptible Staphylococcus aureus (MSSA) from humans and animals on livestock farms and presence of SCCmec remnant DNA in MSSA CC398. J. Antimicrob. Chemother. http://dx.doi.org/10.1093/jac/ dkt366. Wendlandt, S., K. Kadlec, A. T. Feßler, S. Monecke, R. Ehricht, A. W. van de Giessen, P. D. Hengeveld, X. Huijsdens, S. Schwarz, and E. van Duijkeren. 2013. Resistance phenotypes and genotypes of methicillin-resistant Staphylococcus aureus isolates from broiler chickens at slaughter and abattoir workers. J. Antimicrob. Chemother. 68:2458–2463.
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
Van Duijkeren, and A. W. Van De Giessen. 2013. Prevalence of livestock-associated MRSA on Dutch broiler farms and in people living and/or working on these farms. Epidemiol. Infect. 141:1099–1108. Harmsen, D., H. Claus, W. Witte, J. Rothgänger, H. Claus, D. Turnwald, and U. Vogel. 2003. Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting using a novel software for spa-repeat determination and database management. J. Clin. Microbiol. 41:5442–5448. Hasman, H., A. Moodley, L. Guardabassi, M. Stegger, R. L. Skov, and F. M. Aarestrup. 2010. spa type distribution in Staphylococcus aureus originating from pigs, cattle and poultry. Vet. Microbiol. 141:326–331. Ho, J., M. O’Donoghue, L. Guardabassi, A. Moodley, and M. Boost. 2012. Characterization of methicillin-resistant Staphylococcus aureus isolates from pig carcasses in Hong Kong. Zoonoses Public Health 59:416–423. Kaszanyitzky, E. J., Z. Egyed, Sz. Jánosi, J. Keserű, Z. Gál, I. Szabó, Z. Veres, and P. Somogyi. 2004. Staphylococci isolated from animals and food with phenotypically reduced susceptibility to β-lactamase-resistant β-lactam antibiotics. Acta Vet. Hung. 52:7–17. Kernodle, D. S., D. C. Classen, C. W. Stratton, and A. B. Kaiser. 1998. Association of borderline oxacillin-susceptible strains of Staphylococcus aureus with surgical wound infections. J. Clin. Microbiol. 36:219–222. Lowder, B. V., C. M. Guinane, N. L. Ben Zakour, L. A. Weinert, A. Conway-Morris, R. A. Cartwright, A. J. Simpson, A. Rambaut, U. Nübel, and J. R. Fitzgerald. 2009. Recent human-to-poultry host jump, adaptation, and pandemic spread of Staphylococcus aureus. Proc. Natl. Acad. Sci. USA 106:19545–19550. Lowy, F. D. 1998. Staphylococcus aureus infections. N. Engl. J. Med. 339:520–532. Manning, L., and R. N. Baines. 2004. Globalisation: A study of the poultry-meat supply chain. Br. Food J. 106:819–836. Martin, M. C., M. A. Gonzales-Hevia, and M. C. Mendoza. 2003. Usefulness of a two-step PCR procedure for detection and identification of enterotoxigenic staphylococci of bacterial isolates and food samples. Food Microbiol. 20:605–610. McDougal, L. K., and C. Thornsberry. 1986. The role of beta-lactamase in staphylococcal resistance to penicillinase-resistant penicillins and cephalosporins. J. Clin. Microbiol. 23:832–839. Mellmann, A., T. Weniger, C. Berssenbrugge, J. Rothganger, M. Sammeth, J. Stoye, and D. Harmsen. 2007. Based upon repeat pattern (BURP): Algorithm to characterize the long-term evolution of Staphylococcus aureus populations based on spa polymorphisms. BMC Microbiol. 7:98. Milheirico, C., D. C. Oliveira, and H. de Lencastre. 2007. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob. Agents Chemother. 51:3374–3377. Monecke, S., A. Ruppelt, S. Wendlandt, S. Schwarz, P. Slickers, R. Ehricht, and S. C. Jäckel. 2013. Genotyping of Staphylococcus aureus isolates from diseased poultry. Vet. Microbiol. 162:806–812. Mulders, M. N., A. P. Haenen, P. L. Geenen, P. C. Vesseur, E. S. Poldervaart, T. Bosch, X. W. Huijsdens, P. D. Hengeveld, W. D. Dam-Deisz, E. A. Graat, D. Mevius, A. Voss, and A. W. Van De Giessen. 2010. Prevalence of livestock-associated MRSA in
Key words: methicillin-resistant Staphyloccus aureus, borderline oxacillin-resistant Staphylococcus aureus, spa types, chicken, poultry meat 2014 Poultry Science 93:3179–3186 http://dx.doi.org/10.3382/ps.2014-04321
INTRODUCTION Some specific Staphylococcus aureus types are regarded as serious pathogens of humans and important bird pathogens (Lowy, 1998; Fitzgerald, 2012). The ability of this microorganism to survive in the presence of β-lactam antibiotics remains the main problem in the therapy (Pinho, 2008). Due to various mechanisms of acquired β-lactam resistance, several resistance phenotypes have been described so far in S. aureus (Chambers, 1997). These include β-lactamase acquisition, modification of penicillin-binding proteins, or acquisition of low-drug-affinity penicillin-binding proteins. ©2014 Poultry Science Association Inc. Received July 10, 2014. Accepted September 26, 2014. 1 Corresponding author: [email protected]
Methicillin-resistant S. aureus (MRSA), which can harbor mecA, or recently discovered mecC gene, are resistant to both cefoxitin and oxacillin (Chambers, 1997; Shore and Coleman, 2013). Borderline oxacillinresistant S. aureus (BORSA) is another, relatively frequent phenotype among S. aureus. Borderline oxacillin-resistant S. aureus are cefoxitin susceptible, do not carry the mecA or mecC genes, but have oxacillin minimum inhibitory concentrations (MIC) between 1 and 8 μg/mL (Chambers, 1997; Shore and Coleman, 2013). Hyperproduction of β-lactamase has been postulated to explain this phenomenon (McDougal and Thornsberry, 1986; Tomasz et al., 1989). Studies on poultry-associated S. aureus carried out around the world revealed limited genetic diversity of this population (Lowder et al., 2009; Mulders et al., 2010). This picture is likely due to the globalization of poultry industry (Manning and Baines, 2004). Most
3179
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
ABSTRACT The genotypes and oxacillin resistance of 263 Staphylococcus aureus isolates cultured from chicken cloacae (n = 138) and chicken meat (n = 125) was analyzed. Fifteen spa types were determined in the studied S. aureus population. Among 5 staphylococcal protein A gene (spa) types detected in S. aureus from chicken, t002, t3478, and t13620 were the most frequent. Staphylococcus aureus isolates from meat were assigned to 14 spa types. Among them, the genotypes t002, t056, t091, t3478, and t13620 were dominant. Except for 4 chicken S. aureus isolates belonging to CC398, the remaining 134 isolates were clustered into multilocus sequence clonal complex (CC) 5. Most of meat-derived isolates were assigned to CC5, CC7, and CC15, and to the newly described spa-CC12954 complex belonging to CC1. Except for t011 (CC398), all other spa types found among chicken isolates were also present in isolates from meat. Four S. aureus isolated from chicken and one from meat were identified as
3180
Krupa et al.
MATERIALS AND METHODS Isolation and Identification of S. aureus Three hundred fifty-eight cloacae swabs were taken in 2013 from chickens in a slaughterhouse located in southwest Poland. The swabs were taken 4 times, approximately 100 swabs per sampling, except one sampling, when 50 swabs were taken and analyzed. The samples were collected from cloacae of hanged chickens before electric stunning. Slaughtered birds originated from 4 local poultry farms, and all samples taken during one sampling session originated from a single farm. Average slaughter capacity was 40,000 chickens per day. One hundred eighty-three chicken meat samples (legs and wings) from the aforementioned slaughterhouse were also examined. The samples (approximately 50) were taken 4 times. Meat was sampled after carcass chilling at the same day when cloacae swabs were taken. The meat samples were packaged in sterile plastic bags and transported up to 2 h to the laboratory. Whole cloacae cotton swabs, and samples from upper arm and thigh muscles cut out in small portions (1 g in total) were cultured in a final volume of 10 mL of Giolitti-Cantoni enrichment broth, and subcultured on Baird-Parker agar. The isolates were identified as S. aureus based on their ability to coagulate rabbit plasma and clumping factor production using commercial tests (Biomed, Cracow, Poland). The assays were performed according to manufacturer instructions. All 263 isolates were screened by PCR using S. aureus-specific primers
for nuc gene, encoding thermonuclease (Martin et al., 2003; Table 1). Reference S. aureus strain ATCC 29213 served as a positive control for thermonuclease, while reference S. epidermidis strain ATCC 35984 served as a negative control. One S. aureus isolate per sample/ swab was taken for further characterization.
Preparation of Bacterial DNA Two milliliters of bacterial cell suspension from an overnight culture grown in brain-heart infusion broth were centrifuged for 5 min at 12,000 × g at room temperature and suspended in 100 μL of 100 mM Tris-HCl buffer, pH 7.4, containing 10 μg of lysostaphin (A&A Biotechnology, Gdańsk, Poland). After 30 min of incubation at 37°C, 10 μL of 10% SDS was added and the sample was incubated for another 30 min at 37°C. Two hundred microliters of 5 M guanidine hydrochloride was added, and the sample was mixed by vortexing and incubated at room temperature for 10 min. The DNA was extracted by phenol and chloroform, precipitated with ethanol, and suspended in water (Bania et al., 2006).
Detection of mecA and Determination of SCCmec Cassette Type All S. aureus isolates were tested for the presence of mecA gene using the primers described by Milheirico et al. (2007; Table 1). Each PCR run contained mecApositive (S. aureus ATCC 43300) and negative (S. aureus ATCC 29213) strains as controls. The SCCmec cassette type was determined according to Milheirico et al. (2007; Table 1). The PCR products were electrophoretically resolved in 1.5% agarose containing 0.5 μg/ mL of ethidium bromide and photographed with the GelDocXR System (Bio-Rad, Hercules, CA).
Antibiotic Resistance and Oxacillin MIC Determination in mecA-Positive S. aureus Susceptibility of mecA-positive S. aureus isolates to penicillin G (10 units/disc), cefoxitin (30 μg/disc), tetracycline (30 μg/disc), clindamycin (2 μg/disc), gentamicin (10 μg/disc), erythromycin (15 μg/disc), ciprofloxacin (5 μg/disc), norfloxacin (10 μg/disc), and vancomycin (30 μg/disc; all substances from Oxoid Ltd., Basingstoke, United Kingdom) was tested by the disc diffusion method and interpreted according to CLSI document M100-S22 (CLSI, 2012). The MIC for oxacillin was determined with the E-test and interpreted according to the manufacturer’s instructions (bio-Mérieux Inc., Marcy l’Etoile, France). Reference S. aureus strains ATCC 25923 (used for the disc diffusion method), ATCC 43300, and ATCC 29213 (used for MIC testing) served as controls.
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
reports on poultry S. aureus were concentrated on genotypes of MRSA. It was shown that the majority of MRSA belonged to 2 clonal complexes (CC), CC398 and CC5 (Lowder et al., 2009; Mulders et al., 2010; Geenen et al., 2013; Vandendriessche et al., 2014). Knowledge on population structure of methicillin-susceptible S. aureus (MSSA) from poultry is scarce. Evidence for multiple, independent acquisition of methicillin resistance by MSSA associated with animal breeding enforces the research on revealing the structure of this population (Fitzgerald, 2012). Research on genetic diversity of poultry MSSA may allow for identification of new clones potentially contributing to emergence of community-acquired staphylococcal infections (Fitzgerald, 2012). Genotyping of staphylococcal protein A gene (spa), first introduced by Harmsen et al. (2003), was shown to be strongly associated with the results of multilocus sequence typing, allowing for reliable genotypic characterization of S. aureus populations (Strommenger et al., 2006). The aim of this work was to determine the population structure of S. aureus isolates derived from chicken and chicken meat, based on spa typing, with emphasis on detection of oxacillin-resistant isolates (i.e., BORSA and MRSA).
3181
STAPHYLOCOCCUS AUREUS FROM CHICKEN IN POLAND Table 1. Primers used in this study Target1
Primer sequence
Reference
mecA
mecAP4 5′ TCCAGATTACAACTTCACCAGG 3′ mecAP7 5′ CCACTTCATATCTTGTAACG 3′ mecA_LGA251rev 5′ CCTGAATCWGCTAATAATATTTC 3′ mecA_LGA251for 5′ TCACCAGGTTCAACYCAAAA 3′ nuc-for 5′ GAAGATCCAACAGTATATAGTGC 3′ nuc-rev 5′ ATTGACCTGAATCAGCGTTGTCTT 3′ CIF2 F2 5′ TTCGAGTTGCTGATGAAGAAGG 3′ CIF2 R2 5′ ATTTACCACAAGGACTACCAGC 3′ ccrC F2 5′ GTACTCGTTACAATGTTTGG 3′ ccrC R2 5′ ATAATGGCTTCATGCTTACC 3′ RIF5 F10 5′ TTCTTAAGTACACGCTGAATCG 3′ RIF5 R13 5′ATGGAGATGAATTACAAGGG 3′ SCCmec V J1 F 5′ TTCTCCATTCTTGTTCATCC 3′ SCCmec V J1 R 5′ AGAGACTACTGACTTAAGTGG 3′ dcs F2 5′ CATCCTATGATAGCTTGGTC 3′ dcs R1 5′ CTAAATCATAGCCATGACCG 3′ ccrB2 F2 5′ AGTTTCTCAGAATTCGAACG 3′ ccrB2 R2 5′ CCGATATAGAAWGGGTTAGC 3′ kdp F1 5′ AATCATCTGCCATTGGTGATGC 3′ kdp R1 5′ CGAATGAAGTGAAAGAAAGTGG 3′ SCCmec III J1 F 5′ CATTTGTGAAACACAGTACG 3′ SCCmec III J1 R 5′ GTTATTGAGACTCCTAAAGC 3′ mecI P2 5′ ATCAAGACTTGCATTCAGGC 3′ mecI P3 5′ GCGGTTTCAATTCACTTGTC 3′ arc up 5′ TTGATTCACCAGCGCGTATTGTC 3′ arc dn 5′ AGGTATCTGCTTCAATCAGCG 3′ aro up 5′ ATCGGAAATCCTATTTCACATTC 3′ aro dn 5′ GGTGTTGTATTAATAACGATATC 3′ glp up 5′ CTAGGAACTGCAATCTTAATCC 3′ glp dn 5′ TGGTAAAATCGCATGTCCAATTC 3′ gmk up 5′ ATCGTTTTATCGGGACCATC 3′ gmk dn 5′ TCATTAACTACAACGTAATCGTA 3′ pta up 5′ GTTAAAATCGTATTACCTGAAGG 3′ pta dn 5′ GACCCTTTTGTTGAAAAGCTTAA 3′ tpi up 5′ TCGTTCATTCTGAACGTCGTGAA 3′ tpi dn 5′ TTTGCACCTTCTAACAATTGTAC 3′ yqi up 5′ CAGCATACAGGACACCTATTGGC 3′ yqi dn 5′ CGTTGAGGAATCGATACTGGAAC 3′ blaZ- 1 5′ACTTCAACACCTGCTGCTTTC 3′ blaZ- 2 5′ TGACCACTTTTATCAGCAACC 3′ 1095F 5′ AGACGATCCTTCGGTGAGC 3′ 1517R 5′ GCTTTTGCAATGTCATTTACTG 3′
Milheirico et al., 2007
mecC nuc SCCmec type
blaZ spa
Martin et al., 2003 Milheirico et al., 2007
http://www.mlst.net/
Rizzotti et al., 2005 Harmsen et al., 2003
1mecA = penicillin-binding protein 2a encoding gene; mecC = mecA homologue; nuc = thermonuclease encoding gene; SCCmec type = staphylococcal cassette chromosome mec type; ST = sequence type; blaZ = beta-lactamase encoding gene; spa = staphylococcal protein A gene.
Detection of Borderline Oxacillin Resistant S. aureus (BORSA)
for hyperproduction of β-lactamase using Cefinase test (bio-Mérieux Inc.).
All mecA-negative S. aureus isolates were plated on oxacillin resistance screening agar (ORSA, Oxoid Ltd.) plates containing 2, 3, and 4 μg/mL of oxacillin, respectively. The results were recorded after 24 and 48 h of incubation at 35°C and interpreted according to the manufacturer’s instructions. For isolates able to grow in medium containing 3 and 4 μg/mL of oxacillin, MIC for oxacillin was determined using the E-test (bio-Mérieux Inc.). Reference MRSA (ATCC 43300) and MSSA (ATCC 29213) strains served as controls. All phenotypically oxacillin-resistant isolates were analyzed for susceptibility to amoxicillin with clavulanic acid (20/10 μg/disc) by the disk-diffusion method and interpreted according to CLSI document M100-S22 (CLSI, 2012). Reference Escherichia coli ATCC 35218 strain served as the control. All BORSA isolates were screened for blaZ gene according to Rizzotti et al. (2005; Table 1) and
Detection of mecC Because low oxacillin resistance of some S. aureus strains can also be explained by possession of the mecC gene, all mecA-negative S. aureus isolates able to grow on ORSA plates containing 2 μg/mL of oxacillin were tested for mecC using the primers described by Cuny et al. (2011; Table 1). The DNA from mecC-positive S. aureus strain 1140/12, from the National Medicines Institute, Warsaw, Poland, served as a control.
Determination of spa Type and ST The spa types of all S. aureus isolates were determined according to Harmsen et al. (2003; Table 1). The nucleotide sequencing of the repeat-containing region
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
ST
Cuny et al., 2011
3182
Krupa et al.
Table 2. Staphylococcal protein A gene (spa) types of Staphylococcus aureus isolates from chicken cloacae swabs and chicken meat Cloacae swabs Number of samples
Number of isolates (% of samples)
Sampling I
107
12 (11)
Sampling II
101
4 (4)
Sampling III Sampling IV
100 50
93 (93) 29 (58)
Total
358
138 (38)
Sampling
spa types (n and % of total isolates)
Chicken meat Number of samples
Number of isolates (% of samples)
t3478 (8), t011 (4)
51
34 (67)
t3478 (4)
54
28 (52)
t002 (93) t13620 (25), t548 (4)
48 30
35 (73) 28 (93)
183
125 (68)
t002 (93; 67%), t13620 (25; 18%), t3478 (12; 9%), t011 (4; 3%), t011 (4; 3%)
Detection of Staphylococcal Protein A Staphylococcal protein A (SpA) was detected in culture supernatants from 9 BORSA isolates assigned to CC5 [i.e., t548 (4 isolates), t002 (3 isolates), and t3478 (2 isolates)]. For this 2 mL of bacterial overnight culture in brain-heart infusion broth was centrifuged for 5 min at 12,000 × g at room temperature. Twenty-microliter portions of culture medium were resolved on SDSPAGE. Western immunoblots were probed with polyclonal antibody against SpA (Sigma-Aldrich, Poznań, Poland). Anti-rabbit-HRP (Sigma-Aldrich) was used as a secondary antibody. The blots were developed using the ECL Lumi-LightPLUS substrate (Roche, Warsaw, Poland), according to the manufacturer’s instructions. Two human S. aureus strains belonging to CC5 [i.e., 2,249/05 (t041) and 1,034/05 (t002) from National
t3478 (17), t056 (9), t091 (3), t084 (2), t002 (1), t4386 (1), t267 (1) t056 (11), t091 (6), t084 (4), t3478 (2), t012 (2), t899 (1), t7287 (1), t267 (1) t002 (32), t888 (2), t1187 (1) t13620 (17), t548 (7), t3478 (3), t056 (1) t002 (33; 26%), t3478 (22; 18%), t056 (21; 17%), t13620 (17; 14%), t091 (9; 7%), t548 (7; 6%), t084 (6; 5%), t012 (2; 2%), t888 (2; 2%), t267 (2; 2%), t4386 (1; 1%), t899 (1; 1%), t7287 (1; 1%), t1187 (1; 1%)
Medicines Institute, Warsaw, Poland] served as positive controls.
RESULTS Frequency of S. aureus Isolates In total, 263 S. aureus isolates were obtained, including isolates from cloacae swabs and meat samples. The prevalence of S. aureus was different in chickens and meat samples. The bacterium was found in 138 (38%) from a total of 358 cloacae swabs and in 125 (68%) from 183 meat samples. The incidence of S. aureus ranged from 4 to 93% in animals and from 52 to 93% in meat samples (Table 2).
Genotypes of S. aureus Isolates Fifteen different spa types were determined in the studied S. aureus population. Staphylococcus aureus isolates obtained from animals were classified into 5 spa types. Most of isolates were assigned to t002 (67%), t13620 (18%), and t3478 (9%; Table 2). Staphylococcus aureus isolates from chicken meat were assigned to 14 spa types. Among them isolates belonging to t002 (26%), t3478 (18%), t056 (17%), t13620 (14%), and t091 (7%) were dominant (Table 2). Except 4 animal isolates belonging to spa t011, all other genotypes found within isolates from chicken i.e., t002, t548, t3478, and t13620, were also present in food (Tables 2 and 3). The spa types t002, t3478, and t13620 were frequently isolated both from animals and meat. In contrast, genotype t548 occurred sporadically in chickens (2.9%) and meat (5.6%). Among 14 spa types found in meat, 10 were not detected in animals (Tables 2 and 3). Genotypes of 134 isolates from chicken were clustered into spa-CC002 complex, belonging to ST-CC5 (Table 3). The remaining 4 animal isolates represented
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
of the spa gene was performed from both DNA strands of the PCR product by Genomed (Warsaw, Poland), using a BigDye Terminator Ready Reaction Cycle Sequencing kit. The analysis of repeats and the assignment of spa types were performed with the resources of the Ridom SpaServer (http://spa.ridom.de). Grouping of spa types was done using BURP, Ridom Staphtype Software. The spa-types were clustered if cost between members of the group was less than or equal to 4. The spa types shorter than 5 repeats (1 isolate) were excluded from analysis (Mellmann et al., 2007). Sequence types (ST) of selected S. aureus isolates (4 isolates from cloacae swabs, representing spa types t002, t548, t3478, and t13620, as well as 7 isolates from meat, representing t002, t012, t548, t899, t3478, t7287, and t13620) were determined according to Enright et al. (2000; Table 1). The sequences obtained from both strands of the PCR product were analyzed using BioEdit software (http://www.mbio.ncsu.edu/bioedit/), and further assignment of the ST was performed using the mlst.net platform.
spa types (n and % of total isolates)
STAPHYLOCOCCUS AUREUS FROM CHICKEN IN POLAND
3183
Table 3. Clonal staphylococcal protein A gene (spa) complexes of Staphylococcus aureus isolates from chicken cloacae swabs and chicken meat Cluster
spa
spa-CC
1 1 1 1 Singleton Singleton Singleton Singleton Singleton Singleton Singleton Singleton Singleton Singleton Excluded Total spa
t002 t13620 t3478 t548 t056 t091 t084 t011 t888 t012 t267 t1187 t899 t7287 t4386 15
spa-CC spa-CC spa-CC spa-CC
MLST-CC 002 002 002 002
CC51 CC51 CC51 CC51 CC101 CC7 CC15 CC398 CC12 CC301 CC97 CC8 CC3981 CC71 CC121 Total isolates
n 126 42 34 11 21 9 6 4 2 2 2 1 1 1 1 263
Origin Cloacae swab (n Cloacae swab (n Cloacae swab (n Cloacae swab (n Chicken meat Chicken meat Chicken meat Cloacae swab Chicken meat Chicken meat Chicken meat Chicken meat Chicken meat Chicken meat Chicken meat
= = = =
93) and chicken meat (n = 33) 25) and chicken meat (n = 17) 12) and chicken meat (n = 22) 4) and chicken meat (n = 7)
t011 genotype within ST-CC398. Similarly, most of the meat-derived S. aureus isolates (63%) were clustered into spa-CC002. The other isolates representing 10 different spa types did not group into complexes (Table 3). Among them t056 (ST101), t084 (ST15), and t091 (ST7) genotypes were the most numerous (Table 3).
Characterization of MRSA Isolates Four (2.9%) S. aureus isolates from animals and one (0.8%) isolate from meat were classified as MRSA. All of them were assigned to ST398. All chicken-derived MRSA were isolated during one sampling session, whereas MRSA from meat was isolated during another sampling session. During this sampling, MRSA were not found in animals. All MRSA were mecA-positive, mecC-negative, and resistant to cefoxitin in the disc diffusion method. The isolates were resistant to oxacillin with MIC ranging from 16 to 64 μg/mL. All of the MRSA isolates were resistant at least to 6 out of 9 antibiotics tested (Table 4).
Characterization of BORSA Isolates Three (2.2%) S. aureus isolates from chicken and 19 (15.2%) from meat exhibited borderline resistance to oxacillin (Table 5). All of them were mecA and mecC negative, susceptible to cefoxitin and amoxicillin with clavulanic acid and able to grow on ORSA plates containing 2 μg/mL of oxacillin. Two isolates grew on 3 μg/mL of ORSA medium. None of the BORSA isolates were able to be grown on 4 μg/mL of ORSA plates. Oxacillin MIC was 3 μg/mL for isolates able to grow on 3 μg/mL of oxacillin. Thirteen BORSA isolates were positive in the Cefinase test and harbored the blaZ gene. The spa t091 and t084 were found to dominate among BORSA isolates (Table 5). Staphylococcus aureus belonging to poultry CC5 lineage, recently diverging from CC5 human lineage, was shown to contain mutations
resulting in loss of function of some proteins, including SpA. To determinate whether our isolates belong to poultry or human ST5 lineage, all 9 BORSA isolates assigned to ST5 were probed for protein A (SpA) production. Immunoblotting with anti-SpA antibody revealed that in poultry ST5 culture supernatants, no SpA could be detected, in contrast to 2 human S. aureus CC5 strains in which a strong 50-kDa band was present (Figure 1).
DISCUSSION Diversity of animal breeding models is thought to have an effect on the structure of the S. aureus population (Fitzgerald, 2012). The majority of poultry production is concentrated in a limited number of holdings. Accordingly, the observed diversity of S. aureus population was shown to be limited in poultry (Fitzgerald, 2012). Our data indicate 38% mean incidence of S. aureus in chicken and 68% in chicken meat. However, it should be stressed that depending on sampling it varied from 4 to 93% in chickens and from 66 to 93% in meat indicating significant variation in S. aureus occurrence among farms. To date, most research on incidence of S. aureus in poultry has focused on MRSA (Nemati et al., 2008; Mulders et al., 2010; Wendlandt et al., 2013). We detected MRSA in 4 animals and in 1 meat sample only. As in our previous works, low frequency of MRSA isolates in food of animal origin was confirmed (Bystroń et al., 2010a,b). The presence of MRSA in chicken is for the first time reported in Poland. Studies on poultry MRSA carried out around the world have shown that majority of their isolates belong to 2 clonal complexes, CC398 and CC5 (Lowder et al., 2009; Mulders et al., 2010; Geenen et al., 2013). The MRSA detected by us in animals and in chicken meat assigned to spa t011 and t899, respectively, are known
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
1Multilocus sequence-clonal complexes (MLST-CC) marked with footnote 1 were determined in this study as described by Enright et al. (2000). For the remaining MLST-CC, associations with the particular spa types were assessed through the Ridom SpaServer (http://spa.ridom.de), or from the relevant literature.
3184
Krupa et al.
Table 4. Characterization of chicken-derived methicillin-resistant Staphylococcus aureus isolates with the resistance percentage for antibiotics Source/number of isolates
spa type
ST1
SCCmec type
Cloacae swab/4 Chicken meat/1
t011 t899
ST398 ST398
V IV
Antibiotic resistance3 (%)
MIC2 for oxacillin (μg/mL)
P
CE
T
CL
G
E
CI
N
V
16–24 64
100 100
100 100
100 100
100 100
100 100
100 100
100 0
100 0
0 0
1ST
= sequence type. = minimum inhibitory concentration. 3Disc diffusion method, P = penicillin G (10 units/disc), CE = cefoxitin (30 μg/disc), T = tetracycline (30 μg/disc), CL = clindamycin (2 μg/ disc), G = gentamicin (10 μg/disc), E = erythromycin (15 μg/disc), CI = ciprofloxacin (5 μg/disc), N = norfloxacin (10 μg/disc), V = vancomycin (30 μg/disc). 2MIC
associated lineages distributed worldwide (Fitzgerald, 2012). Studies on genotypic structure of poultry-associated MSSA are scarce (Vandendriessche et al., 2014). In our earlier study, we showed that majority of MSSA isolates from diseased turkeys belonged to CC398, and from diseased chickens to CC5 (Bystroń et al., 2010b). In the present work, most of the MSSA isolates (81%), from the chickens and chicken meat were assigned to CC5 complex, with the t002 being the predominant genotype. All chicken-derived isolates representing CC5 were also detected in meat. The CC5 MSSA dominated among healthy poultry in Belgium (Vandendriessche et al., 2014), and in chicken-derived MSSA in China (Ho et al., 2012). Also, previous observations by Lowder et al. (2009) indicate that the majority of S. aureus isolates from diseased and healthy poultry from Belgium, Denmark, Japan, the United Kingdom, and the United States belonged to a single clonal complex CC5 or its single locus variants ST1342, ST1346, and ST1350. The t091 and t084 MSSA representing genotypes belonging to CC7, and CC15, respectively, consequently occurred in meat samples studied here. To date these genotypes have been isolated only from humans (Rolo et al., 2012), but recently were found also in broilers (Vandendriessche et al., 2014). Isolates belonging to CC8, CC12, CC30, CC97, and CC121 were exclusively detected in meat. Whereas CC30 was already noted
Table 5. Characteristics of borderline oxacillin-resistant Staphylococcus aureus isolates from chicken cloacae swabs and chicken meat Cloacae swab
Chicken meat Number of isolates
Item
spa type
blaZ gene
Cefinase test
Oxacillin concentration permitting bacterial growth, μg/mL 3
0
t548 t002
— —
— —
2 1
2
Total
3
spa type
blaZ gene
Cefinase test
t012 t084 t091 t091 t084 t002 t3478 t548 t548 t012
+ + + − + − − + − +
+ + + − + − − + − +
Number of isolates
1 1 5 1 4 2 2 1 1 1 19
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
to belong to livestock-associated CC398 (Feßler et al., 2011; Argudin et al., 2013). The CC398 isolates, represented mainly by spa t011 and t034, were the most common MRSA isolated from the chicken and turkey products in Germany (Feßler et al., 2011). Our results demonstrate that MRSA CC398 isolates could be found in chicken meat, indicating risk of introduction of animal-associated genotypes into the food chain. A survey on MRSA from broilers in Belgium showed that they belonged primarily to the spa types t011 and t1456 within CC398 (Nemati et al., 2008; Persoons et al., 2009). The ST398 was found to predominate among MRSA isolated from broilers in the Netherlands, although 28% of isolates belonged to ST9 (Mulders et al., 2010). Investigation of broiler throat samples and dust samples in Dutch farms revealed MRSA isolates belonging to CC398, with the t011 and t034 being the predominant genotypes (Geenen et al., 2013; Wendlandt et al., 2013). In Germany, most of the MRSA isolated from diseased turkeys and chickens were classified to CC398. These genotypes dominated also within MSSA from turkey, whereas CC5 was commonly found in chicken (Monecke et al., 2013). Similarly, MRSA and MSSA derived from diseased turkeys in France were represented mainly by CC398 (Argudin et al., 2013), and CC5 was the most common complex among MSSA from poultry infections in Denmark (Hasman et al., 2010). The CC5 is one of the most successful human-
STAPHYLOCOCCUS AUREUS FROM CHICKEN IN POLAND
Figure 1. Expression of staphylococcal protein A (SpA) in clonal complex 5 (CC5) borderline oxacillin-resistant Staphylococcus aureus (BORSA) isolates. On lines 1 to 9, culture supernatants from BORSA isolates from chicken cloacae and chicken meat were resolved. On lines 10 and 11, culture supernatants from 2 human S. aureus strains belonging to CC5 were resolved. The immunoblots were probed with polyclonal antibody against SpA.
of function of some proteins, which does not promote the pathogen’s fitness in poultry (Lowder et al., 2009). In all the 9 ST5 BORSA isolates from chicken and meat, SpA could not be detected, meaning they likely represent poultry-associated ST5 clade. This, in turn, can illustrate the possibility of transmission of animalassociated, oxacillin-resistant S. aureus isolates to food. Taking together, we report for the first time the presence of MRSA in chicken in Poland. We demonstrate that MRSA CC398 could be found in chicken meat, indicating potential of introduction of animal-associated genotypes into food chain. We also report for the first time the possibility of transmission of BORSA isolates from chicken to meat.
ACKNOWLEDGMENTS This work was financially supported by the National Science Centre, Poland, decision number 2581/B/ P01/2011/40.
REFERENCES Argudin, M. A., N. Cariou, O. Salandre, J. Le Guennec, S. Nemeghaire, and P. Butaye. 2013. Genotyping and antimicrobial resistance of Staphylococcus aureus isolates from diseased turkeys. Avian Pathol. 42:572–580. Balslev, U., A. Bremmelgaard, E. Svejgaard, J. Havstreym, and H. Westh. 2005. An outbreak of borderline oxacillin-resistant Staphylococcus aureus (BORSA) in a dermatological unit. Microb. Drug Resist. 11:78–81. Bania, J., A. Dabrowska, J. Bystron, K. Korzekwa, J. Chrzanowska, and J. Molenda. 2006. Distribution of newly described enterotoxin-like genes in Staphylococcus aureus from food. Int. J. Food Microbiol. 108:36–41. Bystroń, J., M. Podkowik, K. Korzekwa, E. Lis, J. Molenda, and J. Bania. 2010a. Characterization of borderline oxacillin-resistant Staphylococcus aureus isolated from food of animal origin. J. Food Prot. 73:1325–1327. Bystroń, J., M. Podkowik, T. Piasecki, A. Wieliczko, J. Molenda, and J. Bania. 2010b. Genotypes and enterotoxin gene content of S. aureus isolates from poultry. Vet. Microbiol. 144:498–501. Chambers, H. F. 1997. Methicillin resistance in staphylococci: Molecular and biochemical basis and clinical implications. Clin. Microbiol. Rev. 10:781–791. CLSI. 2012. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-second Informational Supplement. Clinical and Laboratory Standards Institute, Wayne, PA, USA. Document M100–S22. Cuny, C., F. Layer, B. Strommenger, and W. Witte. 2011. Rare occurrence of methicillin-resistant Staphylococcus aureus CC130 with a novel mecA homologue in humans in Germany. PLoS ONE 6:e24360. Enright, M. C., N. P. J. Day, C. E. Davies, S. J. Peacock, and B. G. Spratt. 2000. Multilocus sequence typing for the characterization of methicillin-resistant (MRSA) and methicillin-susceptible (MSSA) clones of Staphylococcus aureus. J. Clin. Microbiol. 38:1008–1015. Feßler, A. T., K. Kadlec, M. Hassel, T. Hauschild, C. Eidam, R. Ehricht, S. Monecke, and S. Schwarz. 2011. Characterization of methicillin-resistant Staphylococcus aureus isolates from food and food products of poultry origin in Germany. Appl. Environ. Microbiol. 77:7151–7157. Fitzgerald, J. 2012. Livestock-associated Staphylococcus aureus: Origin, evolution and public health threat. Trends Microbiol. 20:192–198. Geenen, P. L., E. A. Graat, A. Haenen, P. D. Hengeveld, A. H. Van Hoek, X. W. Huijsdens, C. C. Kappert, G. A. Lammers, E.
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
in animals (Hasman et al., 2010), isolation of other clones have been reported mainly in humans (Rolo et al., 2012). These isolates occurred only in meat, not in chicken investigated here, suggesting additional, most likely human source of meat contamination. Borderline oxacillin-resistant S. aureus (McDougal and Thornsberry, 1986) is mecA-negative but exhibits low-level resistance to penicillinase-resistant penicillins. The BORSA occur among human clinical isolates with about 5% frequency. They have been involved in several community-acquired and hospital infections (Kernodle et al., 1998; Suggs et al., 1999; Balslev et al., 2005). Borderline oxacillin-resistant S. aureus has already been detected in ruminant milk (Bystroń et al., 2010a; Perillo et al., 2012). Cows seem to be the only animal species in which incidence of BORSA was reported (Kaszanyitzky et al., 2004). Genotypic structure of human BORSA population is largely unknown, and there are no data on animal BORSA genotypes. In the current study, 3 and 19 BORSA isolates from chicken and meat were identified, respectively. The isolates had oxacillin resistance typical for BORSA, with MIC value of 3 μg/mL. Thirteen isolates (60%) were susceptible to amoxicillin with clavulanic acid, positive in Cefinase test, and harbored blaZ gene, showing that their BORSA phenotype was due to the β-lactamase hyperproduction. Remaining 9 isolates were blaZ-negative, unable to grow in the presence of clavulanic acid, and to inactivate cephalosporin in Cefinase test, suggesting production of another kind of β-lactamase, likely a methicillinase (Perillo et al., 2012). All animal BORSA isolates and 32% of meat isolates were assigned to CC5. Remaining meat-derived BORSA isolates were classified to CC7 (32%), CC15 (26%), and CC30 (10%) complexes. It was shown that the poultry CC5 lineage has recently diverged from CC5 human lineage being the result of a single, human-to-poultry host jump. During this event, poultry ST5 acquired novel genetic elements not identified earlier among human S. aureus isolates. It also accumulated mutations, resulting in loss
3185
3186
Krupa et al. broiler flocks and risk factors for slaughterhouse personnel in The Netherlands. Epidemiol. Infect. 138:743–755. Nemati, M., K. Hermans, U. Lipinska, O. Denis, A. Deplano, M. Struelens, L. A. Devriese, F. Pasmans, and F. Haesebrouck. 2008. Antimicrobial resistance of old and recent Staphylococcus aureus isolates from poultry: First detection of livestock-associated methicillin-resistant strain ST398. Antimicrob. Agents Chemother. 52:3817–3819. Perillo, J., D. Ceccarelli, M. Spagnoletti, S. Lollai, P. Cappuccinelli, and M. M. Colombo. 2012. Molecular characterization of enterotoxigenic and borderline oxacillin resistant Staphylococcus aureus from ovine milk. Food Microbiol. 32:265–273. Persoons, D., S. Van Hoorebeke, K. Hermans, P. Butaye, A. de Kruif, F. Haesebrouck, and J. Dewulf. 2009. Methicillin-resistant Staphylococcus aureus in poultry. Emerg. Infect. Dis. 15:452–453. Pinho, M. G. 2008. Mechanisms of β-lactam and glycopeptide resistance in Staphylococcus aureus. Pages 207–227 in Staphylococcus Molecular Genetics. Caister Academic Press, Norfolk, UK. Rizzotti, L., D. Simeoni, P. Cocconcelli, S. Gazzola, F. Dellaglio, and S. Torriani. 2005. Contribution of enterococci to the spread of antibiotic resistance in the production chain of swine meat commodities. J. Food Prot. 68:955–965. Rolo, J., M. Miragaia, A. Turlej-Rogacka, J. Empel, O. Bouchami, N. A. Faria, A. Tavares, W. Hryniewicz, A. C. Fluit, H. de Lencastre, and CONCORD Working Group. 2012. High genetic diversity among community-associated Staphylococcus aureus in Europe: Results from a multicenter study. PLoS ONE 7:e34768. Shore, A. C., and D. C. Coleman. 2013. Staphylococcal cassette chromosome mec: Recent advances and new insights. Int. J. Med. Microbiol. 303:350–359. Strommenger, B., C. Kettlitz, T. Weniger, D. Harmsen, A. W. Friedrich, and W. Witte. 2006. Assignment of Staphylococcus isolates to groups by spa typing, SmaI macrorestriction analysis, and multilocus sequence typing. J. Clin. Microbiol. 44:2533–2540. Suggs, A. H., M. C. Maranan, S. Boyle-Vavra, and R. S. Daum. 1999. Methicillin-resistant and borderline methicillin-resistant asymptomatic Staphylococcus aureus colonization in children without identifiable risk factors. Pediatr. Infect. Dis. J. 18:410–414. Tomasz, A., H. B. Drugeon, H. M. Lencastre, D. Jabes, L. McDougal, and J. Bille. 1989. New mechanism for methicillin resistance in Staphylococcus aureus: Clinical isolates that lack the PBP2a gene and contain normal penicillin-binding proteins with modified penicillin binding capacity. Antimicrob. Agents Chemother. 33:1869–1874. Vandendriessche, S., W. Vanderhaeghen, J. Larsen, R. Mendonca, M. Hallin, P. Butaye, K. Hermans, F. Haesebrouck, and O. Denis. 2014. High genetic diversity of methicillin-susceptible Staphylococcus aureus (MSSA) from humans and animals on livestock farms and presence of SCCmec remnant DNA in MSSA CC398. J. Antimicrob. Chemother. http://dx.doi.org/10.1093/jac/ dkt366. Wendlandt, S., K. Kadlec, A. T. Feßler, S. Monecke, R. Ehricht, A. W. van de Giessen, P. D. Hengeveld, X. Huijsdens, S. Schwarz, and E. van Duijkeren. 2013. Resistance phenotypes and genotypes of methicillin-resistant Staphylococcus aureus isolates from broiler chickens at slaughter and abattoir workers. J. Antimicrob. Chemother. 68:2458–2463.
Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on December 2, 2014
Van Duijkeren, and A. W. Van De Giessen. 2013. Prevalence of livestock-associated MRSA on Dutch broiler farms and in people living and/or working on these farms. Epidemiol. Infect. 141:1099–1108. Harmsen, D., H. Claus, W. Witte, J. Rothgänger, H. Claus, D. Turnwald, and U. Vogel. 2003. Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting using a novel software for spa-repeat determination and database management. J. Clin. Microbiol. 41:5442–5448. Hasman, H., A. Moodley, L. Guardabassi, M. Stegger, R. L. Skov, and F. M. Aarestrup. 2010. spa type distribution in Staphylococcus aureus originating from pigs, cattle and poultry. Vet. Microbiol. 141:326–331. Ho, J., M. O’Donoghue, L. Guardabassi, A. Moodley, and M. Boost. 2012. Characterization of methicillin-resistant Staphylococcus aureus isolates from pig carcasses in Hong Kong. Zoonoses Public Health 59:416–423. Kaszanyitzky, E. J., Z. Egyed, Sz. Jánosi, J. Keserű, Z. Gál, I. Szabó, Z. Veres, and P. Somogyi. 2004. Staphylococci isolated from animals and food with phenotypically reduced susceptibility to β-lactamase-resistant β-lactam antibiotics. Acta Vet. Hung. 52:7–17. Kernodle, D. S., D. C. Classen, C. W. Stratton, and A. B. Kaiser. 1998. Association of borderline oxacillin-susceptible strains of Staphylococcus aureus with surgical wound infections. J. Clin. Microbiol. 36:219–222. Lowder, B. V., C. M. Guinane, N. L. Ben Zakour, L. A. Weinert, A. Conway-Morris, R. A. Cartwright, A. J. Simpson, A. Rambaut, U. Nübel, and J. R. Fitzgerald. 2009. Recent human-to-poultry host jump, adaptation, and pandemic spread of Staphylococcus aureus. Proc. Natl. Acad. Sci. USA 106:19545–19550. Lowy, F. D. 1998. Staphylococcus aureus infections. N. Engl. J. Med. 339:520–532. Manning, L., and R. N. Baines. 2004. Globalisation: A study of the poultry-meat supply chain. Br. Food J. 106:819–836. Martin, M. C., M. A. Gonzales-Hevia, and M. C. Mendoza. 2003. Usefulness of a two-step PCR procedure for detection and identification of enterotoxigenic staphylococci of bacterial isolates and food samples. Food Microbiol. 20:605–610. McDougal, L. K., and C. Thornsberry. 1986. The role of beta-lactamase in staphylococcal resistance to penicillinase-resistant penicillins and cephalosporins. J. Clin. Microbiol. 23:832–839. Mellmann, A., T. Weniger, C. Berssenbrugge, J. Rothganger, M. Sammeth, J. Stoye, and D. Harmsen. 2007. Based upon repeat pattern (BURP): Algorithm to characterize the long-term evolution of Staphylococcus aureus populations based on spa polymorphisms. BMC Microbiol. 7:98. Milheirico, C., D. C. Oliveira, and H. de Lencastre. 2007. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob. Agents Chemother. 51:3374–3377. Monecke, S., A. Ruppelt, S. Wendlandt, S. Schwarz, P. Slickers, R. Ehricht, and S. C. Jäckel. 2013. Genotyping of Staphylococcus aureus isolates from diseased poultry. Vet. Microbiol. 162:806–812. Mulders, M. N., A. P. Haenen, P. L. Geenen, P. C. Vesseur, E. S. Poldervaart, T. Bosch, X. W. Huijsdens, P. D. Hengeveld, W. D. Dam-Deisz, E. A. Graat, D. Mevius, A. Voss, and A. W. Van De Giessen. 2010. Prevalence of livestock-associated MRSA in
