Appl Biochem Biotechnol DOI 10.1007/s12010-013-0688-y
Engineering of a Pichia pastoris Expression System for High-Level Secretion of HSA/GH Fusion Protein Min Wu & Wenhui Liu & Guanghui Yang & Dengke Yu & Dianhai Lin & Hongying Sun & Shuqing Chen
Received: 13 August 2013 / Accepted: 18 December 2013 # Springer Science+Business Media New York 2014
Abstract Human serum albumin (HSA) and human growth hormone (hGH) fusion protein [HSA/GH] is a promising long-acting form of GH to treat GH deficiency. This study attempted to engineer a P. pastoris strain for high-level production of HSA/GH to be used in basic research and clinical application. Strains contained two, three, and seven copies of HSA/GH gene were screened by selecting against Zeocin resistance. The results revealed that introducing two to three copies of HSA/GH gene was sufficient to give a significant increase in secretion level, compared with one copy of HSA/GH gene. No significant differences were observed between two to three copies and seven copies. Co-expression with either one copy of exogenous ERO1 or PDI in a strain carrying multicopies of HSA/GH gene led to varying degrees of increase in HSA/GH secretion. The effect of introducing multicopies of PDI was similar to that of one copy of PDI, but introducing excess copies of ERO1 reduced HSA/GH secretion. Simultaneous co-expression with PDI and ERO1 was less effect than either PDI coexpression or ERO1 co-expression. A strain showing higher secretion level was successfully applied to large-scale fermentation with the productivity of 3–4 g/l. Keywords P. pastoris . HSA and GH fusion protein . High expression . Gene dosage . Chaperone co-expression . Fermentation Abbreviations HSA Human serum albumin hGH Human growth hormone ER Endoplasmic reticulum PDI Protein disulfide isomerase ERO1 ER Oxidoreductase 1 ELISA Enzyme-linked immunosorbent assay
M. Wu : W. Liu : H. Sun : S. Chen (*) Institute of Pharmacology and Toxicology and Biochemical Pharmaceutics, College of Pharmaceutical Sciences, Zhejiang University, 866 Yuhangtang Road, Hangzhou 310058, People’s Republic of China e-mail: [email protected] G. Yang : D. Yu : D. Lin Zhejiang Uniongen Biopharm, Huzhou 313300, People’s Republic of China
Appl Biochem Biotechnol
Introduction Human growth hormone (hGH), composed of 191 amino acids, is a non-glycosylated multifunctional pituitary protein. It has been clinically approved for the treatment of adult and pediatric GH deficiency, Turner's syndrome, chronic renal failure, and adult acquired immune deficiency syndrome (AIDS)-associated wasting [6]. However, most of the current available GH preparations require daily administration due to its rapid clearance and short circulating half-life, which obviously makes compliance a problem especially in adolescents. Thus, it is necessary to develop long-acting GH forms. One strategy is to modify the formulation to acquire slowly sustained release form of GH, e.g., Nutropin Depot, which is GH encapsulated in poly (lactide-coglycolide) microspheres. It has been approved for the use in children GH deficiency and twice monthly administration is recommended [17]. An alternative strategy is to modify the GH molecule to make GH clearance from circulation slower, e.g., Albutropin, which is a GH fusion protein, derived from albumin fusion technology. It has showed a prolonged half-life and comparable biological activity in animal experiment [16]. Plus, a series of albumin fusion proteins have showed positive results of extended circulatory half-life [19], indicating the promising prospect for the further development of human serum albumin (HSA) and GH fusion protein (HSA/GH) as a long-acting agent. Sufficient quantities of HSA/GH are required in order to facilitate the process of this fusion protein. Given the advantages of rapid growth on inexpensive medium and the capability for complex posttranslational modification, the methylotrophic yeast Pichia pastoris has been applied to express many albumin fusion proteins [3, 7, 18, 21, 22]. The unmodified P. pastoris strain which only contained one copy of HSA/GH gene had a relatively low expression level in our previously study (25–50 mg/l in shakeflask cultivation and 400–500 mg/l in optimized fed-batch fermentation, unpublished data). Thus improvement of cell specific secretion titers is necessary by strain engineering. Several factors can affect titer of heterologous protein secretion from P. pastoris, including the properties of nucleotide sequences, gene dosage, promoter choices, secretion signals, processing and folding in the endoplasmic reticulum (ER), and secretion. Generally, protein folding has a tendency to be a major bottleneck in heterologous protein secretion [2]. Approaches attempted for secretion enhancement include co-expression with some important chaperones. Jariyachawalid et al. [9] have reported the use of bacterial chaperones GroEL-GroES to enhance functional expression of bacterial enzyme in P. pastoris. Previously, we demonstrated that increasing gene dosage increased secretion of albumin fusion proteins in P. pastoris, and the expression level was further enhanced by co-expressing with protein disulfide isomerase (PDI) but not immunoglobulin binding protein (BiP) [18], indicating that folding in the ER may be the major rate limiting step. ER oxidoreductase 1 (ERO1) is another major chaperone involved in protein folding in the ER besides PDI. Actually, ERO1 introduces oxidizing equivalents through a flavin-dependent mechanism, engaging thiol-disulfide exchange with PDI [4, 20]. Improvements of secretion of several recombinant proteins by ERO1 coexpression have been documented [5, 12]. In this study, in order to explore the potential of higher HSA/GH expression in P. pastoris, we first evaluated the effect of gene dosage on HSA/GH secretion and then examined the effect of ERO1 gene duplication (or ERO1 and PDI simultaneous duplication) in P. pastoris strain expressing multicopies of HSA/GH gene. Finally, a strain showing a higher expression level in shakeflask cultivation was tested using a robust fermentation strategy.
Appl Biochem Biotechnol
Materials and Methods Strains, Plasmids, and Reagents P. pastoris strain GS115 and plasmids pPIC9, pPICZαB, pPIC3.5K, and pAO815 were purchased from Invitrogen (Carlsbad, CA, USA). Restriction enzymes, T4 DNA ligase and Taq DNA polymerase were purchased from Takara Biotechnology (Dalian, China) or New England Biolabs (Beijing, China). Construction of Single or Multicopy HSA/GH Expression Strains For creating the HSA/GH fusion protein [Genbank accession no. JX048669], the C-terminus of HSA and the N-terminus of GH were genetically linked by a flexible linker GlyGlyGlyGlySer. The fusion gene was cloned into pPIC9 or pPICZαB for expression. The Sh ble gene contained in plasmid pPICZαB made it convenient to screen for multicopy integration of HSA/GH gene. Yeast transformations were carried out via electroporation with a Bio-Rad Micropulser Electroporater (CA, USA). Transformant colonies with plasmid pPIC9-HSA/GH (linearized with SalI) were selected on RDB His- plates (1 M sorbitol, 2 % glucose, 1.34 % YNB, 4×10-5 % biotin, 0.005 % amino acids, 2 % agar). Transformant colonies with plasmid pPICZαB-HSA/ GH (linearized with PmeI) were screened on YPDS plates (1 % yeast extract, 2 % peptone, 2 % glucose, 1 M sorbitol, 2 % agar) containing (100, 500, 1,000, 2,000 μg/ml) Zeocin. Construction of Chaperone Co-expression Strains The detailed information of all the recombinant plasmids used in this study is listed in Table 1. The chaperone gene PDI and ERO1 were amplified from P. pastoris genomic DNA based on the published sequence (EMBL accession number AJ302014 for PDI and GenBank accession number XM_002489600.1 for ERO1). The plasmid pPIC3.5K-PDI was previously constructed [18], and the plasmids pAO815-PDI, pPIC3.5K-ERO1, and pAO815-ERO1 were constructed in a similar manner. In this study, with the purpose of constructing chaperone combination, the intrinsic BglII and BamHI sites in the sequence of PDI, as well as the intrinsic EcoRI site in the sequence of ERO1 were destroyed by in vitro mutagenesis using TaKaRa MutanBEST Kit Table 1 Recombinant plasmids Recombinant plasmid
Vector
Insert
Remarks
pPIC9-HSA/GH
pPIC9
HSA/GH fusion gene, XhoI-EcoRI –
pPICZαB-HSA/GH pPICZαB HSA/GH fusion gene, XhoI-NotI
Subcloned from pPIC9-HSA/GH
pPIC3.5K-PDI
The intrinsic BglII and BamHI sites were destroyed by synonymous mutation.
pPIC3.5K PpPDI gene, EcoRI-EcoRI
pAO815-PDI
pAO815
pPIC3.5K-ERO1
pPIC3.5K PpERO1gene, EcoRI-EcoRI
pPDI gene, EcoRI-EcoRI
Subcloned from pPIC3.5K-PDI The intrinsic two EcoRI sites were destroyed by synonymous mutation. Subcloned from pPIC3.5K-ERO1
pAO815-ERO1
pAO815
PpERO1gene, EcoRI-EcoRI
pAO815PDI+ERO1
pAO815
PAOX1-PDI cassette, Bgl II-BamHI, Subcloned from pAO815-ERO1 and pAO815-PDI PAOX1-ERO1 cassette, Bgl II-BamHI
Appl Biochem Biotechnol
(Takara Bio, China). The PAOX1-PDI cassette was cut from pAO815-PDI plasmid with BglII and BamHI enzymes, and then subcloned into the BamHI site of pAO815-ERO1. All the recombinant plasmids were verified by DNA sequencing. For construction of HSA/GH expressing strain co-expressed with chaperone, chaperone plasmids pPIC3.5K-PDI, pPIC3.5K-ERO1, and pAO815-PDI-ERO1 were linearized with BspEI and introduced into a GS115 strain harboring three copies of HSA/GH gene (strain H1) by electroporation. The transformants were initially selected on RDB His- plates and multiple PDI (or ERO1) integrants were further screened on YPDS plates containing (0.5, 1, 1.75 mg/ml) Geneticin (Invitrogen). Determination of Copy Number by Real-Time PCR Assay Genomic yeast DNA from selected transformants was isolated using AxyPrep™ Multisource Genomic DNA Miniprep Kit (Axygen Biosciences, China) following the manufacturer's instruction. The DNA quality was assessed using a GeneQuant spectrophotometer (Amersham Biosciences, UK). Real-time polymerase chain reaction (PCR) was performed using the StepOne Real-Time PCR system with SYBR Premix Ex Taq II kit (Takara Bio). PCR primers used are listed in Table 2. Individual reactions were carried out in 20 μl volumes comprising of 10 μl SYBR Premix Ex Taq II, 0.4 μl ROX Reference, 0.8 μl forward and reverse primers, 2 μl diluted template DNA and 6 μl ddH2O. Following preincubation at 95 °C for 30 s, the PCR program was set to perform 40 cycles of: 5 s at 95 °C; 30 s at 55 °C; 30 s at 72 °C. The specificity of amplicons was verified by analyzing the melting curve after 40 cycles. Triplicate samples of each template were analyzed. The copy number of HSA/GH, PDI, or ERO1 gene in each strain were estimated according to the published method [15], AOX2 promoter sequence, which is present as one copy in the P. pastoris genome, was used as endogenous reference, and HSA, PDI, ERO1 sequences were used as target genes. HSA/GH Expression in Shake Flask The shake-flask cultivation of P. pastoris strain was performed as follows: single colonies were inoculated into flasks containing 20 ml BMGY (1 % yeast extract, 2 % peptone, 1.34 % YNB,
Table 2 Primers used for real-time PCR Primer
Sequence (5′–3′)
Reference
AOX2 prom fw
GACTCTGATGAGGGGCACAT
[13]
AOX2 prom rev
TTGGAAACTCCCAACTGTCC
AOX1 TT fw
TGGGCACTTACGAGAAGACC
[13]
AOX1 TT rev PDI fw
GCAAATGGCATTCTGACATC ACCACATTTTACGGAGTTGCCGGT
[16]
PDI rev
CCTCGCCAGGTCTGACAAGCA
ERO1 fw
CTCAAGGAGCACAGGGTATT
ERO1 rev
ATCTAGTCACGTTGCGGAAT
HSA fw
AACAGAGACTCAAGTGTGCC
HSA rev
AGCATTCCGTGTGGACTTTG
This study This study
Appl Biochem Biotechnol
4×10-5 % biotin, 1 % glycerol, 100 mM potassium phosphate pH 6.0) and grown at 30 °C with shaking (180 rpm) till OD600 reached 2–3. The cells were then harvested by centrifugation at 1,500 g for 10 min, resuspended in 20 ml BMMY medium and incubated at 30 °C with shaking (180 rpm). Methanol (100 %) was added to a final concentration of 1 % every 24 h to maintain induction up to 72 h. 20 μl of culture supernatant was analyzed by 8 % sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). HSA/GH Expression by Fed-Batch Fermentation The inocula was first propagated in shake flask with 50 ml YPD medium at 150 rpm and 30 °C for 24 h, and then inoculated into 500 ml BMGY for 16 h at 30 °C and 150 rpm till OD600 reached 4–6. The fermentation was carried out in a 30 l bioreactor (GUJS-10-30, Orient Bioengineering Equipment and Technology, China) with a working volume of 12 l BSM (26.7 ml/l phosphoric acid, 0.93 g/l calcium sulfate, 18.2 g/l potassium sulfate, 14.9 g/l magnesium sulfate-7H2O, 4.13 g/l potassium hydroxide, 40 g/l glycerol) supplemented with 10 g/l yeast extract and 4.35 ml/l PTM1 trace salts (6.0 g/l cupric sulfate-5H2O, 0.08 g/l sodium iodide, 3.0 g/l manganese sulfate-H2O, 0.2 g/l sodium molybdae-2H2O, 0.02 g/l boric acid, 0.5 g cobalt chloride, 20.0 g/l zinc chloride, 65.0 g/l ferrous sulfate-7H2O, 0.2 g/l biotin, 5.0 ml sulfuric acid). Initially, the temperature was controlled at 30 °C and the pH at 5.25 (controlled with ammonium hydroxide). The agitation speed was set at 500 rpm and the pressure of the vessel was maintained at 0.05 MPa. The gas flow rate was set at 4 vvm. Glycerol feeding was started at a feeding rate of 18.15 ml/l/h (containing 50 % glycerol and 12 ml/l PTM1 trace salts) when the dissolved oxygen (DO) increased sharply. The glycerol feeding was stopped when the wet cell weight (WCW) reached 200 g/l, and the temperature was adjusted to 28 °C. The methanol induction phase was initiated when the DO increased to 100 %. The methanol feeding rate was increased in three steps: 1.57 ml/l/h for 10 h, 3.2 ml/l/h for 14 h and 9.6 ml/l/h till the end of fermentation. Quantification of HSA/GH Levels of intact HSA/GH secreted to the culture medium were estimated by densitometric comparing with purified HSA/GH in stained SDS-PAGE gels (8 %) or quantified using sandwich ELISA developed in our lab. HSA/GH fusion protein was first captured by rabbit anti-HSA polyclonal antibody on the inner surface of polystyrene microtiter wells and then reacted with mouse anti-GH monoclonal antibody. HRP-labeled goat anti-mouse IgG was used as secondary detective antibody. The working curve of the assay had a linear correlation coefficient of R2 =0.9935, ranging from 2.156 to 69 ng/ml. Immunodetection of Intracellular HSA/GH The cytoplasmic fraction (soluble) of the intracellular protein of P. pastoris was extracted using Yeast Total Protein Extraction Kit (Takara Bio). The membrane-associated fraction (insoluble) was extracted from the remaining pellet according to Damasceno et al. [1], using yeast breaking buffer (50 mM sodium phosphate, pH 7.4; 1 mM PMSF; 1 mM EDTA and 5 % glycerol (v/v)) plus 2 % (w/v) SDS. The concentration of cytoplasmic and membraneassociated proteins were determined by measuring UV absorbance at 280 and 260 nm using GENE Quant Pro system (Amersham Biosciences).
Appl Biochem Biotechnol
For Western Blot analysis, 20 μg of cytoplasmic protein or membrane-associated protein were first separated by SDS-PAGE and then transferred to a PVDF membrane (Millpore, MA, USA). Non-specific binding was blocked by incubating the membrane overnight at 4 °C with 10 % skimmed milk. The blocked membrane was then incubated with rabbit anti-HSA polyclonal antibody (1: 7,000 diluted) at 37 °C for 2 h. HRP-conjugated goat anti-rabbit IgG was used as secondary detecting antibody at 37 °C for 2 h, at a dilution of 1:5,000. Immunoreaction was detected using 3,3′-diaminobenzidine (DAB).
Results Effect of HSA/GH Gene Dosage on HSA/GH Secretion A selected colony from strain GS115 transformed with plasmid pPIC9-HSA/GH was verified to contain one copy of HSA/GH gene according to Nordén's method [15], and was used as a reference (named as strain S) in this study. By screening cells which was transformed with pPICZαB-HSA/GH on YPDS plates containing 1,000 μg/ml of Zeocin, we obtained a clone with up to seven copies of HSA/GH gene. The effect of HSA/GH dosage on HSA/GH secretion level in shake-flask culture was evaluated. As shown in Fig. 1, secretion level increased when more HSA/GH genes were integrated, whereas no significant differences were observed between two to three copies and seven copies. Fig. 1 Correlation between the recombinant gene dosage and the expression levels of HSA/GH. a SDS-PAGE analysis of supernatants from strains of multicopy HSA/GH integrants screened from YPDS+Zeocin plates. Expression cultures were normalized to same cell density at 600 nm (OD600). b HSA/GH quantification by sandwich ELISA, values are shown as mean±SD from three parallel cultures. Copy number of HSA/GH was detected by real-time PCR. Lane S (column S): strain contains one copy of HSA/GH gene as a control; Lanes H1–H3 (columns H1–H3): strains contain multicopy of HSA/GH gene screened from YPDS+Zeocin plates
Appl Biochem Biotechnol
Because the seven-copy clone (strain H3) did not secret more HSA/GH, we further investigated the intracellular level of HSA/GH among clones with different copy number. The result is shown in Fig. 2. As compared to one-copy clone, more HSA/GH appeared to be trapped inside the cell in two- to three-copy and seven-copy clones. Besides, the seven-copy clone had a little higher HSA/GH production in the membrane-associated fraction than twocopy and three-copy clones. A band with a molecular weight higher than expected was also found in all multicopy clones. This was probably due to inefficient cleavage of α-mating factor by Kex2, as Inan [8] speculated. All the results indicated the bottleneck in the secretory pathway in multicopy strain. Effect of PDI or ERO1 Co-expression on HSA/GH Secretion We have demonstrated that co-expression with PDI, which catalyzes formation, isomerization, and reduction of disulfide bonds of substrate proteins, could improve secretion level of HSA/ GH, as well as another albumin fusion protein—IL1Ra/HSA [18], indicating the bottleneck for secretion of HSA/GH could be protein folding limiting in the ER. In this study, the effect of PDI dosage on HSA/GH secretion was further studied. The effect of ERO1 co-expression was evaluated as well. The chaperone co-expression was based on strain harboring three copies of HSA/GH gene (strain H1). Multicopy integrants of PDI or ERO1 was screened by selecting against G418 resistance. As shown in Fig. 3a, strain carrying two copies of PDI (strain H1[P1]) showed increased yields of HSA/GH protein in supernatant than strain carrying only endogenous PDI (strain H1). The secretion level of HSA/GH was unchanged when further increasing copy number of PDI up to 7 or 12 copies (Fig. 3a, strains H1[P2] and H1[P3]). Co-expression with one copy of exogenous ERO1 was also beneficial for HSA/GH secretion (Fig. 3b, strain H1[E1]). However, we could see a decrease in secretion level with further increased copy number of ERO1 (Fig. 3b, strains H1[E2] and H1[E3]). Effect of Simultaneous Co-expression with PDI and ERO1 on Secretion of HSA/GH Based on the above observations, we have found that co-expression with one copy of exogenous PDI or ERO1 showed equal or better effect than that with multicopy exogenous
Fig. 2 Determination of intracellular residual HSA/GH protein by Western blot against HSA antibody. 20 μg of cytoplasmic protein or membrane-associated protein were first separated by SDS-PAGE and then transferred to a PVDF membrane. Lane M: HSA/GH standard; Lane S: strain contains one copy of HSA/GH gene as a control; Lanes H1–H3: strains contain three, two, and seven copies of HSA/GH gene, respectively
Appl Biochem Biotechnol Fig. 3 Effect of PDI or ERO1 co-expression on secretion of multicopy HSA/GH strain. Supernatants from HSA/GH multicopy strain co-expressed with PDI (a) or ERO1 (b) were analyzed by SDS-PAGE. Copy numbers of PDI or ERO1 were detected by real-time PCR. Expression cultures were normalized to same cell density at 600 nm (OD600). Duplicates shown for each strain represent two individual shake-flask cultures from the same transformant
PDI or ERO1. We further tested whether combination of PDI and ERO1 could synergistically facilitate secretion level of HSA/GH. PDI and ERO1 combination plasmid was constructed in vitro. Both of them were under the control of AOX1 promoter. Transformants were grown on RDB His- plates. The selected clone contained one copy of exogenous PDI and one copy of exogenous ERO1, as determined by real-time PCR. As shown in Fig. 4, the level of the secreted HSA/GH in strain with PDI and ERO1 simultaneous duplication (strain H1[P+E]) was strongly stimulated related to parental strain (strain H1). However, the secretion level was lower than that of strain carrying either one copy of exogenous ERO1 or PDI. After 72 h induction, strain containing one copy of exogenous PDI showed the highest secretion level. Large-Scale Fermentation Initial attempts for large-scale production of HSA/GH was based on the fed-batch fermentation developed by Invitrogen with modification, using strain H1[P1] (carrying three copies of HSA/GH and one copy of exogenous PDI). Methanol feeding was set at a lower rate and then increased gradually to make cells more adapt to methanol. The culture WCW of strain H1[P1] continued to increase during methanol induction. At the end of fermentation, the WCW reached from 200 g/l to 540 g/l (data not shown). The HSA/GH expression accumulated during the first 52 h of induction and kept constant subsequently (Fig. 5b). The expression level of HSA/GH was about 3–4 g/l as determined by both densitometric scanning of stained PAGE gels and sandwich enzyme-linked immunosorbent assay (ELISA). The expression level of strain S was about 350 mg/l, which was under the same fermentation condition.
Appl Biochem Biotechnol Fig. 4 Effect of PDI and ERO1 simultaneous co-expression on secretion of multicopy HSA/GH strain. SDS-PAGE analysis of supernatants from HSA/GH multicopy strain co-expressed with all tested chaperones of 48 h induction (a) and 72 h induction (b). Expression cultures were normalized to same cell density at 600 nm (OD600). c HSA/GH quantification by sandwich ELISA after 72 h induction, values are shown as mean±SD from three parallel cultures
Appl Biochem Biotechnol
Fig. 5 HSA/GH fermentation comparison between strain S and strain H1[P1]. a Strain S. b Strain H1[P1]
Discussion The fact that P. pastoris has been considered as the most efficient and economical expression system for the production of HSA [10], indicates the potential advantages for expression of HSA fusion proteins using P. pastoris. The goal of this study was to engineer a P. pastoris strain for high-level production of HSA/GH to be used in basic research and clinical application. Gene dosage is usually the first critical parameter to be evaluated for high-level expression. A number of studies have reported that an increase of gene dosage can significantly increase productivity [13–15, 24]. In this study, increasing gene dosage resulted in an increased production of HSA/GH both extracellularly and intracellularly (Figs. 1 and 2), implying the saturation of the secretory pathway, yet the accumulation of intracellular HSA/GH among twocopy, three-copy and seven-copy clones made tiny differences. Previously, we have observed a further increase of secreted HSA fusion protein by co-expressing with PDI in a strain containing multicopies of HSA fusion gene [18]. PDI catalyzes the formation of disulfide bonds and helps the correct folding of proteins. ERO1 directly interacts with PDI. The effects of ERO1 or PDI copy numbers were further evaluated, respectively. Co-expression with either one copy of exogenous ERO1 or PDI in a strain carrying three copies of HSA/GH gene resulted in a striking increase of secreted HSA/GH. Interestingly, the secretion level of HSA/
Appl Biochem Biotechnol
GH decreased with the increase of copy of exogenous ERO1 from 1 to 9 (Fig. 3b). Since oxidizing equivalents flow directly from ERO1 to secretory proteins via PDI, PDI might be limited when multicopies of ERO1 were introduced. Simultaneous co-expression with one copy of exogenous PDI and ERO1 (Fig. 4, strain H1[P+E]) failed to secret more HSA/GH than co-expressing with either one copy of exogenous PDI (Fig. 4, strain H1[P1]) or ERO1 (Fig. 4, strain H1[E1]). Surprisingly, level of PDI transcript in strain H1[P+E] was much lower than in strain H1[P1] (data not shown), indirectly indicating the resource competition for transcription and translation between PDI and ERO1 during simultaneous co-expression in our situation. This may partially explain the less effect of simultaneous co-expression, since the PDI-ERO1 activity probably did not exert in an appropriate way. An alternative strategy for simultaneous co-expression with PDI and ERO1 was also attempted by transfecting pPIC3.5KPDI into a strain harboring three copies of HSA/GH gene (plasmid pPICZαB-HSA/GH) and one copy of exogenous ERO1 (plasmid pPIC3.5K-ERO1). Clones contain two to three copies of exogenous PDI and one copy of exogenous ERO1 were obtained, of which the expression levels were lower than strain H1[P1] but comparable to strain H1[E1] (data not shown). Although Lodi et al. [12] reported the acceleration of secretion of HSA in Kluyveromyces lactis which simultaneously co-expressed with PDI and ERO1, the secretion level was similar to coexpressing with either PDI or ERO1 when normalized to cell density. Selection of chaperone combinations to obtain synergistic effects is not a simple thing. Zhang et al. [23] have also reported that co-expression of chaperone pairs exclusively in cytoplasm or ER failed to markedly improve secretion, and secretion was lower than that mediated by single chaperone. P. pastoris-derived HSA expression has already been achieved by up to g/l by strain manipulation and fermentation optimization [11]; however, there are few reports about g/l expression level of HSA fusion proteins. In our study, the strain which has three copies of HSA/GH gene and two copies of PDI gene (strain H1[P1]), revealed a higher secretion of HSA/GH and thereby was tested in large-scale fermentation mode preferentially. Cells appeared to be more sensitive to excess methanol in the initial stage of methanol induction, thus methanol application was controlled at a lower rate at the beginning of induction in order to make cells more adapt to methanol. The secreted intact HSA/GH was accumulated progressively with the extension of cultivation time (Fig. 5b). It accounted for ~70 % of the total secreted proteins and the secretion level reached 3–4 g/l, which was much higher than the parental strain (Fig. 5a, strain S) when performed in the same fermentation condition. We believe that the production level of strain H1[P1] can be further improved through the optimization of fermentation conditions. In conclusion, the effects of co-expressing with exogenous ERO1 or PDI or both of them on HSA/GH secretion level were investigated. Introducing one copy of exogenous PDI into P. pastoris strain expressing multicopies of HSA/GH gene revealed as an optimized strain for high-level production, and this optimized strain has been successfully applied to large-scale fermentation with the productivity of 3–4 g/l. Acknowledgment This work was financially supported by a grant (No. 2010C13006) from the Science and Technology Department of Zhejiang Province, China.
References 1. Damasceno, L. M., Anderson, K. A., Ritter, G., Cregg, J. M., Old, L. J., & Batt, C. A. (2007). Applied Microbiology and Biotechnology, 74(2), 381–389.
Appl Biochem Biotechnol 2. Damasceno, L. M., Huang, C. J., & Batt, C. A. (2012). Applied Microbiology and Biotechnology, 93(1), 31–39. 3. Dou, W. F., Lei, J. Y., Zhang, L. F., Xu, Z. H., Chen, Y., & Jin, J. (2008). Protein Expression and Purification, 61(1), 45–49. 4. Frand, A. R., & Kaiser, C. A. (1999). Molecular Cell, 4(4), 469–477. 5. Gasser, B., Sauer, M., Maurer, M., Stadlmayr, G., & Mattanovich, D. (2007). Applied and Environmental Microbiology, 73(20), 6499–6507. 6. Hintz, R. L. (2004). BMJ Br Med J, 328(7445), 907–908. 7. Huang, Y. S., Chen, Z., Yang, Z. Y., Wang, T. Y., Zhou, L., & Wu, J. B. (2007). European Journal of Pharmaceutics and Biopharmaceutics, 67(2), 301–308. 8. Inan, M., Aryasomayajula, D., Sinha, J., & Meagher, M. M. (2006). Bioeng Biotechnol, 93(4), 771–778. 9. Jariyachawalid, K., Laowanapiban, P., Meevootisom, V., & Wiyakrutta, S. (2012). Microbial Cell Factories, 11, 47. 10. Kobayashi, K. (2006). Biologicals, 34(1), 55–59. 11. Kobayashi, K., Kuwae, S., Ohya, T., Ohda, T., Ohyama, M., Ohi, H., et al. (2000). Journal of Bioscience and Bioengineering, 89(1), 55–61. 12. Lodi, T., Neglia, B., & Donnini, C. (2005). Applied and Environmental Microbiology, 71(8), 4359–4363. 13. Mansur, M., Cabello, C., Hernandez, L., Pais, J., Varas, L., Valdes, J., et al. (2005). Biotechnology Letters, 27(5), 339–345. 14. Marx, H., Mecklenbrauker, A., Gasser, B., Sauer, M., & Mattanovich, D. (2009). FEMS Yeast Research, 9(8), 1260–1270. 15. Norden, K., Agemark, M., Danielson, J. A., Alexandersson, E., Kjellbom, P., & Johanson, U. (2011). BMC Biotechnology, 11, 47. 16. Osborn, B. L., Sekut, L., Corcoran, M., Poortman, C., Sturm, B., Chen, G., et al. (2002). European Journal of Pharmacology, 456(1–3), 149–158. 17. Physicians Desk Reference. (2002). Oradell, NJ. 18. Shen, Q., Wu, M., Wang, H. B., Naranmandura, H., & Chen, S. Q. (2012). Applied Microbiology and Biotechnology, 96(3), 763–772. 19. Subramanian, G. M., Fiscella, M., Lamouse-Smith, A., Zeuzem, S., & McHutchison, J. G. (2007). Nature Biotechnology, 25(12), 1411–1419. 20. Tu, B. P., & Weissman, J. S. (2002). Molecular Cell, 10(5), 983–994. 21. Wang, F., Wu, M., Liu, W., Shen, Q., Sun, H., & Chen, S. (2013). Biotechnology and Applied Biochemistry, 60, 405–411. 22. Wu, M., Shen, Q., Yang, Y., Zhang, S., Qu, W., Chen, J., et al. (2013). Journal of Industrial Microbiology and Biotechnology, 40(6), 589–599. 23. Zhang, W., Zhao, H. L., Xue, C., Xiong, X. H., Yao, X. Q., Li, X. Y., et al. (2006). Biotechnology Progress, 22(4), 1090–1095. 24. Zhu, T., Guo, M., Tang, Z., Zhang, M., Zhuang, Y., Chu, J., et al. (2009). Journal of Applied Microbiology, 107(3), 954–963.
Engineering of a Pichia pastoris Expression System for High-Level Secretion of HSA/GH Fusion Protein Min Wu & Wenhui Liu & Guanghui Yang & Dengke Yu & Dianhai Lin & Hongying Sun & Shuqing Chen
Received: 13 August 2013 / Accepted: 18 December 2013 # Springer Science+Business Media New York 2014
Abstract Human serum albumin (HSA) and human growth hormone (hGH) fusion protein [HSA/GH] is a promising long-acting form of GH to treat GH deficiency. This study attempted to engineer a P. pastoris strain for high-level production of HSA/GH to be used in basic research and clinical application. Strains contained two, three, and seven copies of HSA/GH gene were screened by selecting against Zeocin resistance. The results revealed that introducing two to three copies of HSA/GH gene was sufficient to give a significant increase in secretion level, compared with one copy of HSA/GH gene. No significant differences were observed between two to three copies and seven copies. Co-expression with either one copy of exogenous ERO1 or PDI in a strain carrying multicopies of HSA/GH gene led to varying degrees of increase in HSA/GH secretion. The effect of introducing multicopies of PDI was similar to that of one copy of PDI, but introducing excess copies of ERO1 reduced HSA/GH secretion. Simultaneous co-expression with PDI and ERO1 was less effect than either PDI coexpression or ERO1 co-expression. A strain showing higher secretion level was successfully applied to large-scale fermentation with the productivity of 3–4 g/l. Keywords P. pastoris . HSA and GH fusion protein . High expression . Gene dosage . Chaperone co-expression . Fermentation Abbreviations HSA Human serum albumin hGH Human growth hormone ER Endoplasmic reticulum PDI Protein disulfide isomerase ERO1 ER Oxidoreductase 1 ELISA Enzyme-linked immunosorbent assay
M. Wu : W. Liu : H. Sun : S. Chen (*) Institute of Pharmacology and Toxicology and Biochemical Pharmaceutics, College of Pharmaceutical Sciences, Zhejiang University, 866 Yuhangtang Road, Hangzhou 310058, People’s Republic of China e-mail: [email protected] G. Yang : D. Yu : D. Lin Zhejiang Uniongen Biopharm, Huzhou 313300, People’s Republic of China
Appl Biochem Biotechnol
Introduction Human growth hormone (hGH), composed of 191 amino acids, is a non-glycosylated multifunctional pituitary protein. It has been clinically approved for the treatment of adult and pediatric GH deficiency, Turner's syndrome, chronic renal failure, and adult acquired immune deficiency syndrome (AIDS)-associated wasting [6]. However, most of the current available GH preparations require daily administration due to its rapid clearance and short circulating half-life, which obviously makes compliance a problem especially in adolescents. Thus, it is necessary to develop long-acting GH forms. One strategy is to modify the formulation to acquire slowly sustained release form of GH, e.g., Nutropin Depot, which is GH encapsulated in poly (lactide-coglycolide) microspheres. It has been approved for the use in children GH deficiency and twice monthly administration is recommended [17]. An alternative strategy is to modify the GH molecule to make GH clearance from circulation slower, e.g., Albutropin, which is a GH fusion protein, derived from albumin fusion technology. It has showed a prolonged half-life and comparable biological activity in animal experiment [16]. Plus, a series of albumin fusion proteins have showed positive results of extended circulatory half-life [19], indicating the promising prospect for the further development of human serum albumin (HSA) and GH fusion protein (HSA/GH) as a long-acting agent. Sufficient quantities of HSA/GH are required in order to facilitate the process of this fusion protein. Given the advantages of rapid growth on inexpensive medium and the capability for complex posttranslational modification, the methylotrophic yeast Pichia pastoris has been applied to express many albumin fusion proteins [3, 7, 18, 21, 22]. The unmodified P. pastoris strain which only contained one copy of HSA/GH gene had a relatively low expression level in our previously study (25–50 mg/l in shakeflask cultivation and 400–500 mg/l in optimized fed-batch fermentation, unpublished data). Thus improvement of cell specific secretion titers is necessary by strain engineering. Several factors can affect titer of heterologous protein secretion from P. pastoris, including the properties of nucleotide sequences, gene dosage, promoter choices, secretion signals, processing and folding in the endoplasmic reticulum (ER), and secretion. Generally, protein folding has a tendency to be a major bottleneck in heterologous protein secretion [2]. Approaches attempted for secretion enhancement include co-expression with some important chaperones. Jariyachawalid et al. [9] have reported the use of bacterial chaperones GroEL-GroES to enhance functional expression of bacterial enzyme in P. pastoris. Previously, we demonstrated that increasing gene dosage increased secretion of albumin fusion proteins in P. pastoris, and the expression level was further enhanced by co-expressing with protein disulfide isomerase (PDI) but not immunoglobulin binding protein (BiP) [18], indicating that folding in the ER may be the major rate limiting step. ER oxidoreductase 1 (ERO1) is another major chaperone involved in protein folding in the ER besides PDI. Actually, ERO1 introduces oxidizing equivalents through a flavin-dependent mechanism, engaging thiol-disulfide exchange with PDI [4, 20]. Improvements of secretion of several recombinant proteins by ERO1 coexpression have been documented [5, 12]. In this study, in order to explore the potential of higher HSA/GH expression in P. pastoris, we first evaluated the effect of gene dosage on HSA/GH secretion and then examined the effect of ERO1 gene duplication (or ERO1 and PDI simultaneous duplication) in P. pastoris strain expressing multicopies of HSA/GH gene. Finally, a strain showing a higher expression level in shakeflask cultivation was tested using a robust fermentation strategy.
Appl Biochem Biotechnol
Materials and Methods Strains, Plasmids, and Reagents P. pastoris strain GS115 and plasmids pPIC9, pPICZαB, pPIC3.5K, and pAO815 were purchased from Invitrogen (Carlsbad, CA, USA). Restriction enzymes, T4 DNA ligase and Taq DNA polymerase were purchased from Takara Biotechnology (Dalian, China) or New England Biolabs (Beijing, China). Construction of Single or Multicopy HSA/GH Expression Strains For creating the HSA/GH fusion protein [Genbank accession no. JX048669], the C-terminus of HSA and the N-terminus of GH were genetically linked by a flexible linker GlyGlyGlyGlySer. The fusion gene was cloned into pPIC9 or pPICZαB for expression. The Sh ble gene contained in plasmid pPICZαB made it convenient to screen for multicopy integration of HSA/GH gene. Yeast transformations were carried out via electroporation with a Bio-Rad Micropulser Electroporater (CA, USA). Transformant colonies with plasmid pPIC9-HSA/GH (linearized with SalI) were selected on RDB His- plates (1 M sorbitol, 2 % glucose, 1.34 % YNB, 4×10-5 % biotin, 0.005 % amino acids, 2 % agar). Transformant colonies with plasmid pPICZαB-HSA/ GH (linearized with PmeI) were screened on YPDS plates (1 % yeast extract, 2 % peptone, 2 % glucose, 1 M sorbitol, 2 % agar) containing (100, 500, 1,000, 2,000 μg/ml) Zeocin. Construction of Chaperone Co-expression Strains The detailed information of all the recombinant plasmids used in this study is listed in Table 1. The chaperone gene PDI and ERO1 were amplified from P. pastoris genomic DNA based on the published sequence (EMBL accession number AJ302014 for PDI and GenBank accession number XM_002489600.1 for ERO1). The plasmid pPIC3.5K-PDI was previously constructed [18], and the plasmids pAO815-PDI, pPIC3.5K-ERO1, and pAO815-ERO1 were constructed in a similar manner. In this study, with the purpose of constructing chaperone combination, the intrinsic BglII and BamHI sites in the sequence of PDI, as well as the intrinsic EcoRI site in the sequence of ERO1 were destroyed by in vitro mutagenesis using TaKaRa MutanBEST Kit Table 1 Recombinant plasmids Recombinant plasmid
Vector
Insert
Remarks
pPIC9-HSA/GH
pPIC9
HSA/GH fusion gene, XhoI-EcoRI –
pPICZαB-HSA/GH pPICZαB HSA/GH fusion gene, XhoI-NotI
Subcloned from pPIC9-HSA/GH
pPIC3.5K-PDI
The intrinsic BglII and BamHI sites were destroyed by synonymous mutation.
pPIC3.5K PpPDI gene, EcoRI-EcoRI
pAO815-PDI
pAO815
pPIC3.5K-ERO1
pPIC3.5K PpERO1gene, EcoRI-EcoRI
pPDI gene, EcoRI-EcoRI
Subcloned from pPIC3.5K-PDI The intrinsic two EcoRI sites were destroyed by synonymous mutation. Subcloned from pPIC3.5K-ERO1
pAO815-ERO1
pAO815
PpERO1gene, EcoRI-EcoRI
pAO815PDI+ERO1
pAO815
PAOX1-PDI cassette, Bgl II-BamHI, Subcloned from pAO815-ERO1 and pAO815-PDI PAOX1-ERO1 cassette, Bgl II-BamHI
Appl Biochem Biotechnol
(Takara Bio, China). The PAOX1-PDI cassette was cut from pAO815-PDI plasmid with BglII and BamHI enzymes, and then subcloned into the BamHI site of pAO815-ERO1. All the recombinant plasmids were verified by DNA sequencing. For construction of HSA/GH expressing strain co-expressed with chaperone, chaperone plasmids pPIC3.5K-PDI, pPIC3.5K-ERO1, and pAO815-PDI-ERO1 were linearized with BspEI and introduced into a GS115 strain harboring three copies of HSA/GH gene (strain H1) by electroporation. The transformants were initially selected on RDB His- plates and multiple PDI (or ERO1) integrants were further screened on YPDS plates containing (0.5, 1, 1.75 mg/ml) Geneticin (Invitrogen). Determination of Copy Number by Real-Time PCR Assay Genomic yeast DNA from selected transformants was isolated using AxyPrep™ Multisource Genomic DNA Miniprep Kit (Axygen Biosciences, China) following the manufacturer's instruction. The DNA quality was assessed using a GeneQuant spectrophotometer (Amersham Biosciences, UK). Real-time polymerase chain reaction (PCR) was performed using the StepOne Real-Time PCR system with SYBR Premix Ex Taq II kit (Takara Bio). PCR primers used are listed in Table 2. Individual reactions were carried out in 20 μl volumes comprising of 10 μl SYBR Premix Ex Taq II, 0.4 μl ROX Reference, 0.8 μl forward and reverse primers, 2 μl diluted template DNA and 6 μl ddH2O. Following preincubation at 95 °C for 30 s, the PCR program was set to perform 40 cycles of: 5 s at 95 °C; 30 s at 55 °C; 30 s at 72 °C. The specificity of amplicons was verified by analyzing the melting curve after 40 cycles. Triplicate samples of each template were analyzed. The copy number of HSA/GH, PDI, or ERO1 gene in each strain were estimated according to the published method [15], AOX2 promoter sequence, which is present as one copy in the P. pastoris genome, was used as endogenous reference, and HSA, PDI, ERO1 sequences were used as target genes. HSA/GH Expression in Shake Flask The shake-flask cultivation of P. pastoris strain was performed as follows: single colonies were inoculated into flasks containing 20 ml BMGY (1 % yeast extract, 2 % peptone, 1.34 % YNB,
Table 2 Primers used for real-time PCR Primer
Sequence (5′–3′)
Reference
AOX2 prom fw
GACTCTGATGAGGGGCACAT
[13]
AOX2 prom rev
TTGGAAACTCCCAACTGTCC
AOX1 TT fw
TGGGCACTTACGAGAAGACC
[13]
AOX1 TT rev PDI fw
GCAAATGGCATTCTGACATC ACCACATTTTACGGAGTTGCCGGT
[16]
PDI rev
CCTCGCCAGGTCTGACAAGCA
ERO1 fw
CTCAAGGAGCACAGGGTATT
ERO1 rev
ATCTAGTCACGTTGCGGAAT
HSA fw
AACAGAGACTCAAGTGTGCC
HSA rev
AGCATTCCGTGTGGACTTTG
This study This study
Appl Biochem Biotechnol
4×10-5 % biotin, 1 % glycerol, 100 mM potassium phosphate pH 6.0) and grown at 30 °C with shaking (180 rpm) till OD600 reached 2–3. The cells were then harvested by centrifugation at 1,500 g for 10 min, resuspended in 20 ml BMMY medium and incubated at 30 °C with shaking (180 rpm). Methanol (100 %) was added to a final concentration of 1 % every 24 h to maintain induction up to 72 h. 20 μl of culture supernatant was analyzed by 8 % sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). HSA/GH Expression by Fed-Batch Fermentation The inocula was first propagated in shake flask with 50 ml YPD medium at 150 rpm and 30 °C for 24 h, and then inoculated into 500 ml BMGY for 16 h at 30 °C and 150 rpm till OD600 reached 4–6. The fermentation was carried out in a 30 l bioreactor (GUJS-10-30, Orient Bioengineering Equipment and Technology, China) with a working volume of 12 l BSM (26.7 ml/l phosphoric acid, 0.93 g/l calcium sulfate, 18.2 g/l potassium sulfate, 14.9 g/l magnesium sulfate-7H2O, 4.13 g/l potassium hydroxide, 40 g/l glycerol) supplemented with 10 g/l yeast extract and 4.35 ml/l PTM1 trace salts (6.0 g/l cupric sulfate-5H2O, 0.08 g/l sodium iodide, 3.0 g/l manganese sulfate-H2O, 0.2 g/l sodium molybdae-2H2O, 0.02 g/l boric acid, 0.5 g cobalt chloride, 20.0 g/l zinc chloride, 65.0 g/l ferrous sulfate-7H2O, 0.2 g/l biotin, 5.0 ml sulfuric acid). Initially, the temperature was controlled at 30 °C and the pH at 5.25 (controlled with ammonium hydroxide). The agitation speed was set at 500 rpm and the pressure of the vessel was maintained at 0.05 MPa. The gas flow rate was set at 4 vvm. Glycerol feeding was started at a feeding rate of 18.15 ml/l/h (containing 50 % glycerol and 12 ml/l PTM1 trace salts) when the dissolved oxygen (DO) increased sharply. The glycerol feeding was stopped when the wet cell weight (WCW) reached 200 g/l, and the temperature was adjusted to 28 °C. The methanol induction phase was initiated when the DO increased to 100 %. The methanol feeding rate was increased in three steps: 1.57 ml/l/h for 10 h, 3.2 ml/l/h for 14 h and 9.6 ml/l/h till the end of fermentation. Quantification of HSA/GH Levels of intact HSA/GH secreted to the culture medium were estimated by densitometric comparing with purified HSA/GH in stained SDS-PAGE gels (8 %) or quantified using sandwich ELISA developed in our lab. HSA/GH fusion protein was first captured by rabbit anti-HSA polyclonal antibody on the inner surface of polystyrene microtiter wells and then reacted with mouse anti-GH monoclonal antibody. HRP-labeled goat anti-mouse IgG was used as secondary detective antibody. The working curve of the assay had a linear correlation coefficient of R2 =0.9935, ranging from 2.156 to 69 ng/ml. Immunodetection of Intracellular HSA/GH The cytoplasmic fraction (soluble) of the intracellular protein of P. pastoris was extracted using Yeast Total Protein Extraction Kit (Takara Bio). The membrane-associated fraction (insoluble) was extracted from the remaining pellet according to Damasceno et al. [1], using yeast breaking buffer (50 mM sodium phosphate, pH 7.4; 1 mM PMSF; 1 mM EDTA and 5 % glycerol (v/v)) plus 2 % (w/v) SDS. The concentration of cytoplasmic and membraneassociated proteins were determined by measuring UV absorbance at 280 and 260 nm using GENE Quant Pro system (Amersham Biosciences).
Appl Biochem Biotechnol
For Western Blot analysis, 20 μg of cytoplasmic protein or membrane-associated protein were first separated by SDS-PAGE and then transferred to a PVDF membrane (Millpore, MA, USA). Non-specific binding was blocked by incubating the membrane overnight at 4 °C with 10 % skimmed milk. The blocked membrane was then incubated with rabbit anti-HSA polyclonal antibody (1: 7,000 diluted) at 37 °C for 2 h. HRP-conjugated goat anti-rabbit IgG was used as secondary detecting antibody at 37 °C for 2 h, at a dilution of 1:5,000. Immunoreaction was detected using 3,3′-diaminobenzidine (DAB).
Results Effect of HSA/GH Gene Dosage on HSA/GH Secretion A selected colony from strain GS115 transformed with plasmid pPIC9-HSA/GH was verified to contain one copy of HSA/GH gene according to Nordén's method [15], and was used as a reference (named as strain S) in this study. By screening cells which was transformed with pPICZαB-HSA/GH on YPDS plates containing 1,000 μg/ml of Zeocin, we obtained a clone with up to seven copies of HSA/GH gene. The effect of HSA/GH dosage on HSA/GH secretion level in shake-flask culture was evaluated. As shown in Fig. 1, secretion level increased when more HSA/GH genes were integrated, whereas no significant differences were observed between two to three copies and seven copies. Fig. 1 Correlation between the recombinant gene dosage and the expression levels of HSA/GH. a SDS-PAGE analysis of supernatants from strains of multicopy HSA/GH integrants screened from YPDS+Zeocin plates. Expression cultures were normalized to same cell density at 600 nm (OD600). b HSA/GH quantification by sandwich ELISA, values are shown as mean±SD from three parallel cultures. Copy number of HSA/GH was detected by real-time PCR. Lane S (column S): strain contains one copy of HSA/GH gene as a control; Lanes H1–H3 (columns H1–H3): strains contain multicopy of HSA/GH gene screened from YPDS+Zeocin plates
Appl Biochem Biotechnol
Because the seven-copy clone (strain H3) did not secret more HSA/GH, we further investigated the intracellular level of HSA/GH among clones with different copy number. The result is shown in Fig. 2. As compared to one-copy clone, more HSA/GH appeared to be trapped inside the cell in two- to three-copy and seven-copy clones. Besides, the seven-copy clone had a little higher HSA/GH production in the membrane-associated fraction than twocopy and three-copy clones. A band with a molecular weight higher than expected was also found in all multicopy clones. This was probably due to inefficient cleavage of α-mating factor by Kex2, as Inan [8] speculated. All the results indicated the bottleneck in the secretory pathway in multicopy strain. Effect of PDI or ERO1 Co-expression on HSA/GH Secretion We have demonstrated that co-expression with PDI, which catalyzes formation, isomerization, and reduction of disulfide bonds of substrate proteins, could improve secretion level of HSA/ GH, as well as another albumin fusion protein—IL1Ra/HSA [18], indicating the bottleneck for secretion of HSA/GH could be protein folding limiting in the ER. In this study, the effect of PDI dosage on HSA/GH secretion was further studied. The effect of ERO1 co-expression was evaluated as well. The chaperone co-expression was based on strain harboring three copies of HSA/GH gene (strain H1). Multicopy integrants of PDI or ERO1 was screened by selecting against G418 resistance. As shown in Fig. 3a, strain carrying two copies of PDI (strain H1[P1]) showed increased yields of HSA/GH protein in supernatant than strain carrying only endogenous PDI (strain H1). The secretion level of HSA/GH was unchanged when further increasing copy number of PDI up to 7 or 12 copies (Fig. 3a, strains H1[P2] and H1[P3]). Co-expression with one copy of exogenous ERO1 was also beneficial for HSA/GH secretion (Fig. 3b, strain H1[E1]). However, we could see a decrease in secretion level with further increased copy number of ERO1 (Fig. 3b, strains H1[E2] and H1[E3]). Effect of Simultaneous Co-expression with PDI and ERO1 on Secretion of HSA/GH Based on the above observations, we have found that co-expression with one copy of exogenous PDI or ERO1 showed equal or better effect than that with multicopy exogenous
Fig. 2 Determination of intracellular residual HSA/GH protein by Western blot against HSA antibody. 20 μg of cytoplasmic protein or membrane-associated protein were first separated by SDS-PAGE and then transferred to a PVDF membrane. Lane M: HSA/GH standard; Lane S: strain contains one copy of HSA/GH gene as a control; Lanes H1–H3: strains contain three, two, and seven copies of HSA/GH gene, respectively
Appl Biochem Biotechnol Fig. 3 Effect of PDI or ERO1 co-expression on secretion of multicopy HSA/GH strain. Supernatants from HSA/GH multicopy strain co-expressed with PDI (a) or ERO1 (b) were analyzed by SDS-PAGE. Copy numbers of PDI or ERO1 were detected by real-time PCR. Expression cultures were normalized to same cell density at 600 nm (OD600). Duplicates shown for each strain represent two individual shake-flask cultures from the same transformant
PDI or ERO1. We further tested whether combination of PDI and ERO1 could synergistically facilitate secretion level of HSA/GH. PDI and ERO1 combination plasmid was constructed in vitro. Both of them were under the control of AOX1 promoter. Transformants were grown on RDB His- plates. The selected clone contained one copy of exogenous PDI and one copy of exogenous ERO1, as determined by real-time PCR. As shown in Fig. 4, the level of the secreted HSA/GH in strain with PDI and ERO1 simultaneous duplication (strain H1[P+E]) was strongly stimulated related to parental strain (strain H1). However, the secretion level was lower than that of strain carrying either one copy of exogenous ERO1 or PDI. After 72 h induction, strain containing one copy of exogenous PDI showed the highest secretion level. Large-Scale Fermentation Initial attempts for large-scale production of HSA/GH was based on the fed-batch fermentation developed by Invitrogen with modification, using strain H1[P1] (carrying three copies of HSA/GH and one copy of exogenous PDI). Methanol feeding was set at a lower rate and then increased gradually to make cells more adapt to methanol. The culture WCW of strain H1[P1] continued to increase during methanol induction. At the end of fermentation, the WCW reached from 200 g/l to 540 g/l (data not shown). The HSA/GH expression accumulated during the first 52 h of induction and kept constant subsequently (Fig. 5b). The expression level of HSA/GH was about 3–4 g/l as determined by both densitometric scanning of stained PAGE gels and sandwich enzyme-linked immunosorbent assay (ELISA). The expression level of strain S was about 350 mg/l, which was under the same fermentation condition.
Appl Biochem Biotechnol Fig. 4 Effect of PDI and ERO1 simultaneous co-expression on secretion of multicopy HSA/GH strain. SDS-PAGE analysis of supernatants from HSA/GH multicopy strain co-expressed with all tested chaperones of 48 h induction (a) and 72 h induction (b). Expression cultures were normalized to same cell density at 600 nm (OD600). c HSA/GH quantification by sandwich ELISA after 72 h induction, values are shown as mean±SD from three parallel cultures
Appl Biochem Biotechnol
Fig. 5 HSA/GH fermentation comparison between strain S and strain H1[P1]. a Strain S. b Strain H1[P1]
Discussion The fact that P. pastoris has been considered as the most efficient and economical expression system for the production of HSA [10], indicates the potential advantages for expression of HSA fusion proteins using P. pastoris. The goal of this study was to engineer a P. pastoris strain for high-level production of HSA/GH to be used in basic research and clinical application. Gene dosage is usually the first critical parameter to be evaluated for high-level expression. A number of studies have reported that an increase of gene dosage can significantly increase productivity [13–15, 24]. In this study, increasing gene dosage resulted in an increased production of HSA/GH both extracellularly and intracellularly (Figs. 1 and 2), implying the saturation of the secretory pathway, yet the accumulation of intracellular HSA/GH among twocopy, three-copy and seven-copy clones made tiny differences. Previously, we have observed a further increase of secreted HSA fusion protein by co-expressing with PDI in a strain containing multicopies of HSA fusion gene [18]. PDI catalyzes the formation of disulfide bonds and helps the correct folding of proteins. ERO1 directly interacts with PDI. The effects of ERO1 or PDI copy numbers were further evaluated, respectively. Co-expression with either one copy of exogenous ERO1 or PDI in a strain carrying three copies of HSA/GH gene resulted in a striking increase of secreted HSA/GH. Interestingly, the secretion level of HSA/
Appl Biochem Biotechnol
GH decreased with the increase of copy of exogenous ERO1 from 1 to 9 (Fig. 3b). Since oxidizing equivalents flow directly from ERO1 to secretory proteins via PDI, PDI might be limited when multicopies of ERO1 were introduced. Simultaneous co-expression with one copy of exogenous PDI and ERO1 (Fig. 4, strain H1[P+E]) failed to secret more HSA/GH than co-expressing with either one copy of exogenous PDI (Fig. 4, strain H1[P1]) or ERO1 (Fig. 4, strain H1[E1]). Surprisingly, level of PDI transcript in strain H1[P+E] was much lower than in strain H1[P1] (data not shown), indirectly indicating the resource competition for transcription and translation between PDI and ERO1 during simultaneous co-expression in our situation. This may partially explain the less effect of simultaneous co-expression, since the PDI-ERO1 activity probably did not exert in an appropriate way. An alternative strategy for simultaneous co-expression with PDI and ERO1 was also attempted by transfecting pPIC3.5KPDI into a strain harboring three copies of HSA/GH gene (plasmid pPICZαB-HSA/GH) and one copy of exogenous ERO1 (plasmid pPIC3.5K-ERO1). Clones contain two to three copies of exogenous PDI and one copy of exogenous ERO1 were obtained, of which the expression levels were lower than strain H1[P1] but comparable to strain H1[E1] (data not shown). Although Lodi et al. [12] reported the acceleration of secretion of HSA in Kluyveromyces lactis which simultaneously co-expressed with PDI and ERO1, the secretion level was similar to coexpressing with either PDI or ERO1 when normalized to cell density. Selection of chaperone combinations to obtain synergistic effects is not a simple thing. Zhang et al. [23] have also reported that co-expression of chaperone pairs exclusively in cytoplasm or ER failed to markedly improve secretion, and secretion was lower than that mediated by single chaperone. P. pastoris-derived HSA expression has already been achieved by up to g/l by strain manipulation and fermentation optimization [11]; however, there are few reports about g/l expression level of HSA fusion proteins. In our study, the strain which has three copies of HSA/GH gene and two copies of PDI gene (strain H1[P1]), revealed a higher secretion of HSA/GH and thereby was tested in large-scale fermentation mode preferentially. Cells appeared to be more sensitive to excess methanol in the initial stage of methanol induction, thus methanol application was controlled at a lower rate at the beginning of induction in order to make cells more adapt to methanol. The secreted intact HSA/GH was accumulated progressively with the extension of cultivation time (Fig. 5b). It accounted for ~70 % of the total secreted proteins and the secretion level reached 3–4 g/l, which was much higher than the parental strain (Fig. 5a, strain S) when performed in the same fermentation condition. We believe that the production level of strain H1[P1] can be further improved through the optimization of fermentation conditions. In conclusion, the effects of co-expressing with exogenous ERO1 or PDI or both of them on HSA/GH secretion level were investigated. Introducing one copy of exogenous PDI into P. pastoris strain expressing multicopies of HSA/GH gene revealed as an optimized strain for high-level production, and this optimized strain has been successfully applied to large-scale fermentation with the productivity of 3–4 g/l. Acknowledgment This work was financially supported by a grant (No. 2010C13006) from the Science and Technology Department of Zhejiang Province, China.
References 1. Damasceno, L. M., Anderson, K. A., Ritter, G., Cregg, J. M., Old, L. J., & Batt, C. A. (2007). Applied Microbiology and Biotechnology, 74(2), 381–389.
Appl Biochem Biotechnol 2. Damasceno, L. M., Huang, C. J., & Batt, C. A. (2012). Applied Microbiology and Biotechnology, 93(1), 31–39. 3. Dou, W. F., Lei, J. Y., Zhang, L. F., Xu, Z. H., Chen, Y., & Jin, J. (2008). Protein Expression and Purification, 61(1), 45–49. 4. Frand, A. R., & Kaiser, C. A. (1999). Molecular Cell, 4(4), 469–477. 5. Gasser, B., Sauer, M., Maurer, M., Stadlmayr, G., & Mattanovich, D. (2007). Applied and Environmental Microbiology, 73(20), 6499–6507. 6. Hintz, R. L. (2004). BMJ Br Med J, 328(7445), 907–908. 7. Huang, Y. S., Chen, Z., Yang, Z. Y., Wang, T. Y., Zhou, L., & Wu, J. B. (2007). European Journal of Pharmaceutics and Biopharmaceutics, 67(2), 301–308. 8. Inan, M., Aryasomayajula, D., Sinha, J., & Meagher, M. M. (2006). Bioeng Biotechnol, 93(4), 771–778. 9. Jariyachawalid, K., Laowanapiban, P., Meevootisom, V., & Wiyakrutta, S. (2012). Microbial Cell Factories, 11, 47. 10. Kobayashi, K. (2006). Biologicals, 34(1), 55–59. 11. Kobayashi, K., Kuwae, S., Ohya, T., Ohda, T., Ohyama, M., Ohi, H., et al. (2000). Journal of Bioscience and Bioengineering, 89(1), 55–61. 12. Lodi, T., Neglia, B., & Donnini, C. (2005). Applied and Environmental Microbiology, 71(8), 4359–4363. 13. Mansur, M., Cabello, C., Hernandez, L., Pais, J., Varas, L., Valdes, J., et al. (2005). Biotechnology Letters, 27(5), 339–345. 14. Marx, H., Mecklenbrauker, A., Gasser, B., Sauer, M., & Mattanovich, D. (2009). FEMS Yeast Research, 9(8), 1260–1270. 15. Norden, K., Agemark, M., Danielson, J. A., Alexandersson, E., Kjellbom, P., & Johanson, U. (2011). BMC Biotechnology, 11, 47. 16. Osborn, B. L., Sekut, L., Corcoran, M., Poortman, C., Sturm, B., Chen, G., et al. (2002). European Journal of Pharmacology, 456(1–3), 149–158. 17. Physicians Desk Reference. (2002). Oradell, NJ. 18. Shen, Q., Wu, M., Wang, H. B., Naranmandura, H., & Chen, S. Q. (2012). Applied Microbiology and Biotechnology, 96(3), 763–772. 19. Subramanian, G. M., Fiscella, M., Lamouse-Smith, A., Zeuzem, S., & McHutchison, J. G. (2007). Nature Biotechnology, 25(12), 1411–1419. 20. Tu, B. P., & Weissman, J. S. (2002). Molecular Cell, 10(5), 983–994. 21. Wang, F., Wu, M., Liu, W., Shen, Q., Sun, H., & Chen, S. (2013). Biotechnology and Applied Biochemistry, 60, 405–411. 22. Wu, M., Shen, Q., Yang, Y., Zhang, S., Qu, W., Chen, J., et al. (2013). Journal of Industrial Microbiology and Biotechnology, 40(6), 589–599. 23. Zhang, W., Zhao, H. L., Xue, C., Xiong, X. H., Yao, X. Q., Li, X. Y., et al. (2006). Biotechnology Progress, 22(4), 1090–1095. 24. Zhu, T., Guo, M., Tang, Z., Zhang, M., Zhuang, Y., Chu, J., et al. (2009). Journal of Applied Microbiology, 107(3), 954–963.
