Enzyme and Microbial Technology 63 (2014) 13–20

Contents lists available at ScienceDirect

Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt

Xylose and xylose/glucose co-fermentation by recombinant Saccharomyces cerevisiae strains expressing individual hexose transporters Davi L. Gonc¸alves a , Akinori Matsushika b,∗ , Belisa B. de Sales a , Tetsuya Goshima b , Elba P.S. Bon c , Boris U. Stambuk a,∗∗ a

Departamento de Bioquímica, Centro de Ciências Biológicas, Universidade Federal de Santa Catarina, Florianópolis, SC 88040-900, Brazil Biomass Refinery Research Center (BRRC), National Institute of Advanced Industrial Science and Technology (AIST), 3-11-32 Kagamiyama, Higashi-hiroshima, Hiroshima 739-0046, Japan c Departamento de Bioquímica, Instituto de Química, Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ 21941-909, Brazil b

a r t i c l e

i n f o

Article history: Received 19 March 2014 Received in revised form 8 May 2014 Accepted 9 May 2014 Available online 17 May 2014 Keywords: Saccharomyces cerevisiae HXT transporters Xylose fermentation Glucose/xylose co-fermentation Bioethanol

a b s t r a c t Since the uptake of xylose is believed to be one of the rate-limiting steps for xylose ethanol fermentation by recombinant Saccharomyces cerevisiae strains, we transformed a hxt-null strain lacking the major hexose transporters (hxt1-hxt7 and gal2) with an integrative plasmid to overexpress the genes for xylose reductase (XYL1), xylitol dehydrogenase (XYL2) and xylulokinase (XKS1), and analyzed the impact that overexpression of the HXT1, HXT2, HXT5 or HXT7 permeases have in anaerobic batch fermentations using xylose, glucose, or xylose plus glucose as carbon sources. Our results revealed that the low-affinity HXT1 permease allowed the maximal consumption of sugars and ethanol production rates during xylose/glucose co-fermentations, but was incapable to allow xylose uptake when this sugar was the only carbon source. The moderately high-affinity HXT5 permease was a poor glucose transporter, and it also did not allow significant xylose uptake by the cells. The moderately high-affinity HXT2 permease allowed xylose uptake with the same rates as those observed during glucose consumption, even under co-fermentation conditions, but had the drawback of producing incomplete fermentations. Finally, the high-affinity HXT7 permease allowed efficient xylose fermentation, but during xylose/glucose co-fermentations this permease showed a clear preference for glucose. Thus, our results indicate that approaches to engineer S. cerevisiae HXT transporters to improve second generation bioethanol production need to consider the composition of the biomass sugar syrup, whereby the HXT1 transporter seems more suitable for hydrolysates containing xylose/glucose blends, whereas the HXT7 permease would be a better choice for xylose-enriched sugar streams. © 2014 Elsevier Inc. All rights reserved.

1. Introduction Lignocellulosic biomass is an attractive raw material for bioethanol production since it is an abundant and renewable feedstock that does not compete with food and feed production [1,2]. The major fermentable sugars from hydrolysis of these feedstocks (such as sugarcane bagasse, corn stover, softwood, hardwood and grasses) are d-glucose and d-xylose, and to obtain an economically feasible industrial process for bioethanol production it is necessary

∗ Corresponding author. ∗∗ Corresponding author. Tel.: +55 48 3721 4449. E-mail addresses: [email protected] (A. Matsushika), [email protected] (B.U. Stambuk). http://dx.doi.org/10.1016/j.enzmictec.2014.05.003 0141-0229/© 2014 Elsevier Inc. All rights reserved.

to efficiently convert the xylose present in the biomass into ethanol [3]. The development of robust microorganisms for xylose fermentation is required for efficient bioethanol production, and abundant research has been devoted to improve xylose utilization by Saccharomyces cerevisiae [4–9], a yeast that it is not able to ferment pentoses, although the genome of this yeast has genes that when overexpressed allow the slow utilization of xylose for growth [10,11]. Indeed, a major focus in metabolic engineering for xylose fermentation has been in the area of establishing and improving an intracellular xylose-utilizing pathway in S. cerevisiae. Two xylose-assimilating pathways are currently being used to engineer yeasts: overexpression of xylose isomerase, or overexpression of xylose reductase (XR) and xylitol dehydrogenase (XDH). Since both pathways transform xylose into xylulose, it is also required to overexpress xylulokinase (XK) that will enhance the entrance of

14

D.L. Gonc¸alves et al. / Enzyme and Microbial Technology 63 (2014) 13–20

xylulose into the pentose-phosphate pathway [6,7,9,12]. Although the XR/XDH pathway generally presents unbalanced cofactor requirements and xylitol secretion, it is more thermodynamically advantageous than the xylose isomerase pathway, allowing faster xylose assimilation and ethanol production by engineered yeast strains [13,14]. However, independently of the xylose utilizing pathway used, the uptake of xylose across the yeast plasma membrane occurs through a transport system that has been reported to have significantly lower affinities for xylose, when compared to glucose, exhibiting substantial metabolic flux control especially when the intracellular pathway is optimized [15–22]. Furthermore, mutant or evolved yeast strains showing improved xylose fermenting performance have also improved xylose transport kinetics [23–26]. Thus, it is clear that xylose transport limits pathway flux, and improvements of intracellular metabolism will only exacerbate the transport bottleneck [27]. Furthermore, in mixed sugar fermentations with recombinant S. cerevisiae strains able to ferment xylose, co-consumption of pentoses with glucose has been reported to still be limited, as normally this yeast does not utilize xylose before significant glucose depletion from the medium [28–33]. A strategy to overcome this problem has focused on the isolation of heterologous sugar transporters with better xylose-transporting properties for functional expression in xylose fermenting S. cerevisiae cells [22,34–41]. However, up to now very few heterologous xylose transporters have been characterized in S. cerevisiae, probably due to structural or functional barriers for the expression of heterologous membrane permeases in yeasts [34,42,43]. For example, a recent survey with over 23 heterologous known and putative sugar transporters from seven different organisms revealed only five permeases that allowed utilization of xylose by S. cerevisiae cells [44]. In S. cerevisiae xylose enters the cell through native hexose transporters. The genome of this yeast contains a large family of 18 related transporter genes (HXT1 to HXT17 and GAL2) that allow the efficient fermentation of glucose and other hexoses [45–48]. These genes encode monosaccharide facilitators with 12 transmembrane domains, and under normal conditions only seven transporters (HXT1 to HXT7) are responsible for glucose uptake by S. cerevisiae, transporters that exhibit different affinities for the substrates as well as different expression profiles during growth [49–53]. Although any of the 18 transporter genes allows glucose uptake by yeast cells [45], a yeast strain deleted in the major HXT1-HXT7 and GAL2 transporters (the hxt-null strain KY73, see [51,54–56]) is unable to grow on, consume, or ferment glucose efficiently. When hxt-null yeast strains overexpress the XR and XDH enzymes (encoded by the XYL1 and XYL2 genes of the xylose-fermenting yeast Schefferomyces stipitis), xylose consumption depends on the expression of a sugar transporter, and thus hxt-null strains have been used as a suitable platform to study xylose uptake by different HXT permeases [17,20,35,44,57]. Unfortunately, the influence of individual HXT transporters on xylose fermentation is still unknown, as the above publications have focused mainly on reporting growth rates on xylose and/or xylose consumption rates, or uptake kinetics of 14 C-labelled xylose, by recombinant yeast strains that indeed grow very slowly on xylose. In the present report we analyzed the impact of individual HXT transporters on xylose fermentation by an hxt-null S. cerevisiae yeast strain overexpressing the XYL1, and XYL2 genes, together with overexpression of the endogenous XK encoding gene XKS1 from S. cerevisiae. These genes were integrated into the genome, ensuring high and stable enzymatic activities [58,59], and a multicopy plasmid was used to overexpress individual HXT transporter genes (HXT1, HXT2, HXT5 and HXT7) amplified from the genome of the laboratory S288C strain (www.yeastgenome.org, [60]). Anaerobic batch fermentations of high concentrations (40–50 g/l) of xylose, glucose and xylose/glucose co-fermentations

Table 1 S. cerevisiae strains and plasmids used in this study. Strain/plasmid S. cerevisiae BY4743

S288C KY73

MA-B43 DLG-K1 DLG-K2C DLG-K1T1 DLG-K1T2 DLG-K1T5 DLG-K1T7 Plasmid pAUR-101 pAUR-XKXDHXR

pPGK pPGK-HXT1 pPGK-HXT2 pPGK-HXT5 pPGK-HXT7

Relevant genotype or description

Source or reference

MATa/␣ his31/his31 leu20/leu20 LYS2/lys20 met150/MET15 ura30/ura30 MAT␣ SUC2 gal2 mal mel flo1 flo8-1 hap1 ho bio1 bio6 MATa hxt1::HIS3::hxt4 hxt2::HIS3 hxt3::LEU2::hxt6 hxt5::LEU2 hxt7::HIS3 gal2 ura3-52 his3-11,15 leu2-3,112 MAL2 SUC2 BY4743, AUR1::pAUR-XKXDHXR KY73, AUR1::pAUR-XKXDHXR KY73, AUR1::pAUR-101 DLG-K1, pPGK-HXT1 DLG-K1, pPGK-HXT2 DLG-K1, pPGK-HXT5 DLG-K1, pPGK-HXT7

Open Biosystems

AUR1-C AUR1-C [PGK1p-XKS1-PGK1t, PGK1p-XYL2-PGK1t, PGK1p-XYL1-PGK1t] URA3 PGK1p-PGK1t PGK1p-HXT1-PGK1t PGK1p-HXT2-PGK1t PGK1p-HXT5-PGK1t PGK1p-HXT7-PGK1t

Takara Bio [57]

[60] [56]

[59] This work This work This work This work This work This work

[60] This work This work This work This work

revealed unique and distinct properties for each HXT permease. 2. Materials and methods 2.1.1. Yeast strains and media Yeast strains used in this study are listed in Table 1. Escherichia coli strain DH5␣ was used for cloning. E. coli was grown in Luria broth (1% tryptone, 0.5% yeast extract, 0.5% sodium chloride) supplemented with ampicillin (50 mg/l). Yeasts were grown on complete YP medium (1% yeast extract, 2% Bacto peptone) or synthetic complete (SC) medium lacking uracil (0.67% yeast nitrogen base without amino acids, supplemented with adequate auxotrophic requirements), containing 2% maltose or the indicated amounts of glucose or/and xylose. The pH of the medium was adjusted to pH 5.0 with HCl. When required, 2% Bacto agar and 0.5 mg/l aureobasidin A (Takara Bio, Kyoto, Japan) were added to the medium.

2.1.2. Plasmids The plasmids used in this study are listed in Table 1. The chromosomeintegrative plasmid pAUR-XKXDHXR [58] contains the phosphoglycerate kinase (PGK) promoter for overexpression of XR (XYL1), XDH (XYL2) and XK (XKS1). Since S. cerevisiae has XKS1 but expresses XK at low levels, the presence of the exogenous PGK1p-XKS1 construct in transformed strains was confirmed with primers PGKProFSaI-F and XK-P-SQ-R (Table 2). The chromosome-integrative plasmid pAUR-101, without xylose metabolizing genes was used as control plasmid. S. cerevisiae strain S288C genomic DNA, used for gene amplification of the HXT1, HXT2, HXT5 and HXT7 genes, was obtained using a MasterPure Yeast DNA Purification kit (Epicentre Biotechnologies, Madison, WI, USA). Each gene was amplified from genomic DNA by PCR using the primers listed in Table 2, based on the DNA sequence information of the Saccharomyces Genome Database (www.yeastgenome.org), and the PrimeSTAR Max DNA Polymerase mix (Takara Bio, Kyoto, Japan). The pPGK-HXT1 plasmid for HXT1 overexpression contained a 1.7-kbp HindIII–BamHI DNA fragment with HXT1 inserted into the pPGK shuttle vector [61], which is a multicopy plasmid containing a PGK promoter and terminator as well as the URA3 gene used as selective marker. In the same way, the pPGK-HXT2 plasmid contained a 1.6-kbp BamHI–BamHI DNA fragment with HXT2, the pPGK-HXT5 plasmid contained a 1.8-kbp EcoRI–BamHI DNA fragment with HXT5, and the pPGK-HXT7 plasmid contained a 1.7-kbp EcoRI–BamHI DNA fragment with HXT7. The sequence of all cloned genes was confirmed using the primers listed in Supplementary Table S1.

D.L. Gonc¸alves et al. / Enzyme and Microbial Technology 63 (2014) 13–20 Table 2 Primers used in this study. Primer

Sequencea (5 –3 )

HXT1-F HXT1-R HXT2-F HXT2-R HXT5-F HXT5-R

CATAAGCTTATGAATTCAACTCCCGATCTAATATCTC TAAGGATCCTTATTTCCTGCTAAACAAACTCTTGTAA CATGGATCCATGTCTGAATTCGCTACTAGCCG TAAGGATCCTTATTCCTCGGAAACTCTTTTTTCT ATGAATTCATGTCGGAACTTGAAAACGCTC TAAAAGCTTTTATTTTTCTTTAGTGAACATCCTTTTATAAAATGGTCTC ATGAATTCATGTCACAAGACGCTGCTATTGCAGAGCAAAC AAGGATCCTTATTTGGTGCTGAACATTCTCTTGTACAATGGC CTCGTCGACGAGCTTGGAAAGATGCCGATTTG GACATTTCAGTTGTTGGGTC

HXT7-F HXT7-R PGKProF-SaI-F XK-P-SQ-R

a Underlined nucleotides indicate restriction enzyme sites (HindIII, BamHI or EcoRI).

2.1.3. Yeast transformation Yeast transformation was performed by the lithium acetate method [62] using a commercial kit for yeast transformation (YEASTMAKER yeast transformation system, Clontech Laboratories, Mountain View, CA, USA). Plasmid pAUR-XKXDHXR was previously digested with BsiWI and then chromosomally integrated into the AUR1 locus of the yeast strains. After 90 minutes cultivation on YP-2% maltose or glucose medium, the transformed cells were cultured on the same medium containing aureobasidin A. Strains transformed with the pPGK-derived plasmids were selected on synthetic complete (SC) medium lacking uracil and supplied with 2% glucose and aurobasidin A. 2.1.4. Enzyme assays Cell-free extracts for assays of xylose metabolizing enzymes were prepared with the yeast protein extraction reagent Y-PER (Pierce, Rockford, IL, USA) after cultivation on YP-2% maltose for 36 h. Protein concentrations in the cell-free extracts were determined with the Micro-BCA kit (Pierce) using a Biowave II spectrophotometer (WPA, Cambridge, UK). XR activity was measured by monitoring the oxidation of NADPH at 340 nm [63,64] at 30 ◦ C in 50 mM potassium phosphate buffer (pH 6.0), using 0.15 mM NADPH and 200 mM xylose as substrate. XDH activity was measured by monitoring the reduction of NAD+ at 340 nm [63,64] at 35 ◦ C in 50 mM Tris–HCl buffer (pH 9.0) containing 50 mM MgCl2 , 300 mM xylitol, and 1 mM NAD+ . The XK activity was determined by a coupled assay to measure ADP production as previously described [16,65] in 0.1 M Tris–HCl buffer (pH 7.0) containing 2 mM MgCl2 , 8 mM NaF, 2 mM ATP, 0.2 mM phosphoenolpyruvate, 3 mM reduced glutathione, 10 U of pyruvate kinase, 10 U of lactate dehydrogenase, 0.2 mM NADH, and 8.5 mM xylulose. One unit of enzyme activity was defined as the amount of enzyme that reduced or oxidized 1 ␮mol of NAD(P)+ or NAD(P)H per minute. These enzymatic activities were determined using a UV-2450 spectrophotometer (Shimadzu, Kyoto, Japan). 2.1.5. Fermentation conditions The recombinant yeast strains, pre-grown on synthetic complete (SC) medium containing glucose for 36 h at 30 ◦ C, were collected by centrifugation at 6.000 × g for 5 min at 4 ◦ C, washed with sterile water twice, and inoculated into 20 ml of fermentation medium. The initial cell density in the fermentation medium was adjusted to an absorbance at 600 nm of 1.1 ± 0.4. Anaerobic batch fermentations were performed

15

at 30 ◦ C in closed 50-ml bottles with a magnetic stir bar (2 cm in diameter) to allow mild agitation (100 rpm). During fermentation, cell growth was monitored by measuring the absorbance at 600 nm. Samples of the fermentation broth were removed at predetermined intervals, and diluted four times in 8 mM H2 SO4 . These diluted samples were stored at −30 ◦ C for further analysis of substrates and fermentation products as described below. 2.1.6. Determination of substrates and fermentation products Glucose, xylose, ethanol, xylitol, glycerol, and acetic acid were determined by high performance liquid chromatography (HPLC) equipped with a refractive index detector (RI-2031Plus; JASCO, Tokyo, Japan) using an Aminex HPX-87H column (BioRad Laboratories, Hercules, CA, USA). The HPLC apparatus was operated at 65 ◦ C using 8 mM H2 SO4 as the mobile phase at a flow rate of 0.6 ml/min and 0.02 ml injection volume.

3. Results Strain MA-B43 is a wild-type laboratory strain capable of fermenting xylose because it has integrated into the AUR1 loci the three genes required for efficient xylose utilization: XYL1 and XYL2 from S. stipitis encoding for XR and XDH, and XKS1 encoding XK from S. cerevisiae [58,59]. These three genes are under control of the PGK promoter and terminator (see integrative plasmid pAUR-XKXDHXR, Table 1). As with other strains transformed with this integrative plasmid [59,66], strain MA-B43 has a NADPH-dependent XR activity of 0.139 ± 0.025 U (mg protein)−1 , a NAD+ -dependent XDH activity of 1.203 ± 0.010 U (mg protein)−1 , and 0.030 ± 0.002 U (mg protein)−1 of XK activity. Although S. cerevisiae expresses XK at low levels, the moderate overexpression of XK for efficient ethanol production from xylose by recombinant S. cerevisiae has been supported by several independent investigations [16,65,67–70]. Fig. 1 shows the kinetics of glucose or/and xylose consumption and fermentation by this recombinant laboratory yeast strain. From the data in Fig. 1 and Tables 3 and 4, it is evident that there is roughly a 40–50% decrease in the rates of glucose or xylose consumption when equal amounts of both sugars are present in the medium, when compared with the fermentations carried out with each sugar individually, a result that has been attributed to competition between both sugars for the same transport system(s) present in the yeast cell during mixed-sugar fermentations [28,32,33]. In order to better characterize this competition, and the involvement of individual HXT transporters in this process, we integrated the pAUR-XKXDHXR plasmid into the hxt-null strain KY73, producing strain DGL-K1 (Table 1). This DLG-K1 strain showed significantly high xylose metabolizing enzyme activities (Table 5), exhibiting XR activity ∼13-fold higher, XDH 1.7-fold higher, and XK ∼9-fold higher activity than strain MA-B43 (as well as other strains transformed with the same plasmid, see [58,66]). It is important to

Fig. 1. Time course of glucose (SC-D), xylose (SC-X) or glucose plus xylose (SC-DX) fermentations by strain MA-B43. The kinetics of glucose (black circles) or xylose (white circles) consumption, and ethanol production during glucose (black triangles), xylose (white triangles) or glucose plus xylose (white squares) fermentations, were determined as described in Section 2. Data are averages from two independent experiments.

16

D.L. Gonc¸alves et al. / Enzyme and Microbial Technology 63 (2014) 13–20

Table 3 Rates and yields for anaerobic batch fermentation of glucose or xylose by recombinant yeast strains. Sugara /strain Glucose MA-B43 DLG-K1T1 DLG-K1T2 DLG-K1T5 DLG-K1T7 Xylose MA-B43 DLG-K1T1 DLG-K1T2 DLG-K1T5 DLG-K1T7

Sugar consumption (%)

VS (g L−1 h−1 )b

VE (g L−1 h−1 )c

Table 5 Activities of XR, XDH, and XK in cell extracts of recombinant yeast strains. Activitya (U [mg protein]−1 )

Strain

YE/S (g g−1 )d

100 100 59 56 93

1.40 2.50 0.63 0.67 0.71

± ± ± ± ±

0.05 0.02 0.03 0.03 0.02

0.57 ± 0.04 0.96 ± 0.03 0.25 ± 0.00 0.24 ± 0.00 0.33 ± 0.07

0.40 ± 0.03 0.39 ± 0.01 0.36 ± 0.01 0.33 ± 0.04 0.43 ± 0.02

78